Method for reducing cellulose content of rice and application thereof

Abstract

The invention relates to a method for reducing the cellulose content of rice and application thereof, and belongs to the technical field of gene editing. According to the method for reducing the cellulose content of the rice, the OsSND2, CEF1 and IBC genes of the rice are mutated by utilizing a gene editing technology, so that the functions of the genes are deleted, and the cellulose content of the rice is reduced. The method can promote the feed application of the rice straws, solves the problem of gap of high-quality roughage in the livestock breeding industry, improves the self-sufficiency rate of the high-quality roughage in the animal husbandry and the breeding industry, solves the practical problems caused by excessive straw returning to the field, and promotes the comprehensive utilization of the rice straws.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene editing, and particularly relates to a method for reducing cellulose content of rice and application thereof. BACKGROUND

[0002] With the popularization of fine breeds and the expansion of the flock size, the proportion of mutton in the total meat production in China and the proportion of mutton industry in the total output value of livestock industry are increasing, and the domestic mutton industry has made great progress, and has formed distinct local characteristics in various breeding areas. The scale sheep industry has a high requirement for the nutritional value of feed raw materials. With the rise of feed prices, the original mutton industry mode relying on high-consumption feed and purchasing high-quality alfalfa and grass for fattening is restricted, and the good momentum of the mutton breeding industry and the rapid development of the sheep industry driven thereby highlight the urgency and importance of solving the key problem of the lack of high-quality roughage.

[0003] Rice straw is an important agricultural production byproduct. At present, straw treatment has formed a comprehensive and diversified utilization pattern with mechanical straw returning to the field as the main mode, and fertilizer, energy, feed, base material and raw material being used. However, the excessive straw returning to the field all the year round can cause many problems, such as adverse effects on the growth of the following crops, and the rapid decomposition of straw can release a large amount of soluble organic carbon (DOC), nitrogen and phosphorus in a short period, thereby causing pollution of farmland surface water sources. Although rice straw feed has high potential energy, ordinary rice straw is a poor and unconventional roughage with poor palatability, low digestibility and low nutritional value. The cellulose (32% to 47%) and lignin (5% to 24%) contents in rice straw are high, and they are cross-linked to form a complex network structure, which limits the digestion and utilization of rice straw by ruminants. Purely feeding rice straw can hardly meet the nutritional needs of animals, and even can cause adverse effects in the feeding process.

[0004] Genetic improvement of existing rice varieties can reduce the contents of cellulose and lignin while maintaining the original field performance, so as to realize the feed application of rice straw. The existing technology has cloned a plurality of fragility-related genes, most of which are related to cellulose synthesis genes in cell walls, such as BC6, BC7, BC11, BC13, BC88 all of which encode plant cellulose synthase catalytic subunits and are directly involved in cell wall synthesis; BC1, BC3, BC10, BC12, BC14, BC15 、 BC19 indirectly involved in cell wall synthesis and regulate the synthesis of cellulose, cell wall polysaccharides and other components, so as to thin the cell wall in rice straw, reduce the contents of cellulose and lignin, and finally improve the feeding value of rice straw. However, the yield and quality of rice are reduced, and the rice is prone to lodging, which cannot be widely used in production practice. SUMMARY

[0005] The present application aims to provide a method for reducing the cellulose content of rice and its application, so as to solve the problems of yield reduction, quality decline and easy lodging of low cellulose rice in the prior art.

[0006] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions. The present application provides a method for reducing the cellulose content of rice, which utilizes gene editing technology to mutate the OsSND2 gene, CEF1 gene and IBC gene of rice, so as to reduce the cellulose content of rice. The nucleotide sequence of the OsSND2 gene is shown in SEQ ID NO. 1. The nucleotide sequence of the CEF1 gene is shown in SEQ ID NO. 2. The nucleotide sequence of the IBC gene is shown in SEQ ID NO. 3.

[0007] The present application also provides the application of a rice multi-gene editing vector based on a CRISPR-Cas9 gene editing system in reducing the cellulose content of rice. The rice multi-gene editing vector is a gRNA expression vector based on a CRISPR-Cas9 gene editing system. The gRNA expression vector targets the OsSND2 gene, CEF1 gene and IBC gene of rice for editing, so as to cause the functional loss of the OsSND2 gene, CEF1 gene and IBC gene of rice. The nucleotide sequence of the OsSND2 gene is shown in SEQ ID NO. 1. The nucleotide sequence of the CEF1 gene is shown in SEQ ID NO. 2. The nucleotide sequence of the IBC gene is shown in SEQ ID NO. 3.

[0008] Preferably, in the gRNA, the nucleotide sequence of the action site of the gRNA targeting the OsSND2 gene is shown in SEQ ID NO. 4-5, the nucleotide sequence of the action site of the gRNA targeting the CEF1 gene is shown in SEQ ID NO. 6-7, and the nucleotide sequence of the action site of the gRNA targeting the IBC gene is shown in SEQ ID NO. 8-9.

[0009] The application also provides a method for reducing cellulose content of rice by multi-gene editing, introducing a rice multi-gene editing vector based on a CRISPR-Cas9 gene editing system into rice to obtain a transgenic rice plant, and screening a low-cellulose rice from the transgenic rice plant.

[0010] Preferably, the rice multi-gene editing vector is a gRNA expression vector based on the CRISPR-Cas9 gene editing system. The gRNA expression vector targets the genes of OsSND2 gene, CEF1 gene and IBC gene for editing, so as to make the rice OsSND2 gene, CEF1 gene and IBC gene lose function. The nucleotide sequence of the OsSND2 gene is shown as SEQ ID NO. 1. The nucleotide sequence of the CEF1 gene is shown as SEQ ID NO. 2. The nucleotide sequence of the IBC gene is shown as SEQ ID NO. 3.

[0011] Preferably, the nucleotide sequence of the transgenic tag detection primer for detecting the transgenic rice plant is shown as SEQ ID NO. 28-29.

[0012] The application also provides a low-cellulose rice prepared by the method.

[0013] The application also provides an application of the low-cellulose rice in preparing low-cellulose rice straw feed.

[0014] The application has the following technical effects and advantages: The gene editing technology of the application can direct the improvement of the cell wall components of high-biomass rice varieties such as Huaimai 43, Huaimai 49 and Huaimai 57, so as to screen and identify a low-cellulose rice strain, and determine the feed value of the straw of the low-cellulose rice strain through a feeding test. The application creates a rice strain with low cellulose and lignin content in straw, high feed value of straw, good yield, quality and lodging resistance, which can promote the application of rice straw feed, solve the problem of lack of high-quality roughage in the livestock breeding industry, improve the self-sufficiency rate of high-quality roughage in the livestock and breeding industry, solve the practical problems caused by excessive straw returning to the field, and promote the comprehensive utilization of rice straw. The diet prepared from low-cellulose rice in this invention can replace conventional feed for feeding male Hu sheep without negatively impacting their overall growth performance, rumen fermentation, blood physiology, and most slaughter traits. This invention also found that the lung weight of the experimental group of male Hu sheep was significantly reduced, and the serum alanine aminotransferase activity was extremely significantly reduced, indicating that the diet prepared from low-cellulose rice in this invention can improve liver function in male Hu sheep. Therefore, low-cellulose rice is a potential alternative to conventional feed. Attached Figure Description

[0015] Figure 1 This is a schematic diagram of the technical route of the present invention. Detailed Implementation

[0016] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0017] In the test materials of this invention, the Huai Dao 36 rice variety came from the Huaiyin Agricultural Science Research Institute in the Xuhuai region of Jiangsu Province, and the 5-month-old male Hu sheep came from Jiangsu Huayang Agricultural Ecological Technology Development Co., Ltd. The feed of this invention is No. 003 fattening compound feed for meat sheep, which contains 13.5% crude protein, 2.1271% crude fat, 15.2524% crude fiber, 9.2427% crude ash, 0.85% calcium, 0.3781% total phosphorus, 1.1768% salt, 0.6501% lysine, and 13% moisture. It was purchased from Huai'an Meibiao Feed Co., Ltd. In the reagents of this invention, the quality control sample is Nangeng 9108 rice straw (GBW1002), which comes from the scientific research and innovation base of Huaiyin Agricultural Science Research Institute in Xuhuai region, Jiangsu Province.

[0018] Example 1 Creation of low-cellulose rice

[0019] (1) Using the Huai Dao 36 rice variety with high biomass yield as the parent, rice varieties were obtained from the MSU database (https: / / rice.uga.edu / ). OsSND2 (Database ID: LOC_Os05g48850) CEF1 (Database ID: LOC_Os08g05520) ) , IBC (Database ID: LOC_Os03g18140) and other genes' nucleotide sequences, and then select appropriate PAM target sites in CRISPR-P (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) as targeted rice.OsSND2, CEF1, IBC The nucleotide sequence of the PAM target site of each gene is shown in Table 1.

[0020] Rice OsSND2 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; SEQ ID NO. 1: ATGACGTGGTGCAACAGCTTCAGCGACGTCCGCACCGCCGTGGACAGCAGCTTGTCGCCGGCCGCCGCCGTGGCCGCCGCCGCGGGGAAGAAGGCGGCGGCGTCGCTCGCCGTCCTCGTCAAGATGTGCCCCTCCTGCGGCCACCGCGCGCGGTATGAACAGGAGACGACGATCCAGGACCTGCCGGGGCTGCCGGCCGGAGTGAAGTTCGATCCGACGGACCAGGAGCTTCTTGAGCATTTGGAAGGGAAGGCGAGGCCGGACTCGAGGAAGCTCCACCCTCTCGTCGACGAGTTCATCCCCACCATCGAGGGCGAGAATGGCATCTGCTACACCCATCCCGAGAGGCTTCCCGGTGTGAGCAAGGACGGGCTGGTGAGGCACTTCTTCCACCGGCCGTCGAAGGCGTACACGACGGGGACGAGGAAGCGGCGGAAGGTGCACAGCGACGAGGTCGACGGCGGCGAGACGCGGTGGCACAAGACCGGCAAGACGAGACCGGTGATGGCCAACGGCCGGCCCAGGGGCTACAAGAAGATCCTCGTCCTCTACACCAACTACGGCAAGCAGCGCAAGCCGGAGAAGACCAACTGGGTGATGCACCAGTACCACCTCGGCTCCGACGAGGAGGAGCGGGACGGCGAGCTCGTCGTCTCCAAGGTCTTCTTCCAGACGCAGCCCAGGCAGTGCGGCTCCACCGCCGCCGCCGCCGCCGCCAAGGAGGCCTCCGCCGCCGTCGCCGCCGCCGTGGTGAACAGCAACTACTCCATCGTCCATGGCCATCAAGGTGGTGGTGGTGGTAGCTTTCTCAAGGAGGCAAACGTTGTGCACGAGTTCTACGACCCGGCAGCAACGATGGGTTACCGGCCACCTGCTCCTGCTGCGCACTTCGCGCCAAACTTCGCGGTGCACGCGGCAAGGAACAGCTTTGGTGGCCCTTGA Oryza sativa CEF1 The nucleotide sequence of the gene is shown as SEQ ID NO. 2; SEQ ID NO. 2: Oryza sativa IBC The nucleotide sequence of the gene is shown as SEQ ID NO. 3; SEQ ID NO. 3: Table 1 PAM target sites of each rice gene

[0021] (2) The sgRNA expression cassette containing the PAM target site is amplified by overlapping PCR and nested PCR, and the specific steps include: The first round of PCR: amplifying U6 promoter and gRNA, wherein the pU6a amplification system is 10 μL, including 2×PowerPol PCR MIX 5 μL, U-F 0.2 μL, Cas-9-OsU6aT1 0.2 μL, OsU6a template 0.1 μL, and the rest of ddH2O; the pU6a-gRNA amplification system is 10 μL, including 2×PowerPol PCR MIX 5 μL, gRNA-R 0.2 μL, Cas-9-gRT1 0.2 μL, sgRNA template 0.1 μL, and the rest of ddH2O; the pU6b amplification system is 10 μL, including 2×PowerPol PCR MIX 5 μL, U-F 0.2 μL, Cas-9-OsU6aT2 0.2 μL, OsU6b template 0.1 μL, and the rest of ddH2O; the pU6b-gRNA amplification system is 10 μL, including 2×PowerPol PCR MIX 5 μL, gRNA-R 0.2 μL, Cas-9-gRT2 0.2 μL, sgRNA template 0.1 μL, and the rest of ddH2O; the amplification conditions of the first round of PCR are set as follows: 98℃ pre-denaturation for 2 min→(98℃ denaturation for 20 s→55℃ annealing for 30 s→72℃ extension for 40 s)×20 cycles→72℃ final extension for 5 min, respectively obtaining the first round of pU6 product and the first round of gRNA product; the nucleotide sequences of the primers are shown in Table 2; The second round of PCR: amplifying the sgRNA expression cassette, and the amplification system is 50 μL, including 2×PowerPol PCR MIX 25 μL, Pps-R 1 μL, Pps-L 1 μL, the first round of pU6 product 0.5 μL, the first round of gRNA product 0.5 μL, and the rest of ddH2O; the amplification conditions of the second round of PCR are set as follows: 98℃ pre-denaturation for 2 min→(98℃ denaturation for 20 s→55℃ annealing for 30 s→72℃ extension for 40 s)×30 cycles→72℃ final extension for 5 min, obtaining the sgRNA expression cassette of each gene; the nucleotide sequences of the primers are shown in Table 2.

[0022] (3) The sgRNA expression cassette of each gene was subjected to enzyme digestion-linking reaction, E. coli DH5a competent transformation and colony PCR detection in turn, the detection system was 20 μL, including 2xTaq MIX 10 μL, SP-L 0.5 μL, RB-R 0.5 μL, monoclonal colony and the rest of ddH2O; the detection conditions were set as follows: 95℃ pre-denaturation for 5 min→(95℃ denaturation for 30 s→55℃ rehydration for 30 s→72℃ extension for 2 min) x 25 cycles→72℃ final extension for 4 min, to obtain positive monoclonal colonies; the nucleotide sequences of the primers are shown in Table 2.

[0023] (4) The positive monoclonal colonies were expanded and the obtained plasmid of the rice multi-gene editing vector was introduced into the rice callus and cultured, and the transgenic rice plants with the knockout of the OsCSL4, OsCslA, OsCslB, OsCslC, OsCslD, OsCslE, OsCslF, OsCslG, OsCslH, OsCslI, OsCslJ, OsCslK, OsCslL, OsCslM, OsCslN, OsCslO, OsCslP, OsCslQ, OsCslR, OsCslS, OsCslT, OsCslU, OsCslV, OsCslW, OsCslX and OsCslY genes were obtained through sequencing detection. OsSND2 、 CEF1 、 IBC The transgenic rice plants were planted in the field, the stamens of the rice panicles were removed at the heading stage and wrapped with hybridization bags; the wild type Huai rice 36 variety without gene editing was used as the parent, the flowering rice panicles were placed in the hybridization bags for pollination, and the hybridization bags were sealed. The sealed bags were opened 20 days after pollination, and the rice seeds were harvested after culture, and then were planted the next year. After extraction of the rice DNA, the transgenic tag detection primers Cas9-F / R were used for detection, and the process was repeated multiple times until the transgenic tag could not be detected, to obtain the low cellulose rice; the nucleotide sequences of the transgenic tag detection primers are shown in Table 2, and the technical route is shown in Figure 1 .

[0024] Table 2 Primer sequences for amplifying the sgRNA expression cassette of each gene

[0025] Example 2 Quality identification of low cellulose rice

[0026] The low cellulose rice created in Example 1 was planted in the field, and the rice straw was harvested and treated by scattering, scattering after half wrapping, and scattering after full wrapping, respectively, to obtain the scattering sample, the half wrapping sample and the full wrapping sample of the rice straw, respectively. The contents of crude protein, cellulose, hemicellulose, lignin, crude fiber, neutral detergent fiber and acid detergent fiber of each sample were determined, and the soybean straw in the 003 number of mutton fattening compound feed was used as a control sample, and the results are shown in Table 3. Among them: the quality control sample used for determining the content of crude protein was GBW10020, and the standard curve equation for determining the content of cellulose was y = 238.5460 x + 3.1266( R 2= 0.9989), the standard curve equation for determining the hemicellulose content is y = 3.4731 x + 0.0016( R 2 = 0.9979).

[0027] Table 3 quality index detection results of each sample

[0028] Results show that the low cellulose rice created by the application has a cellulose content of 70% of the normal rice straw content, and its field performance is similar to that of wild type Huai rice 36 variety rice, without yield reduction and easy lodging, and has field popularization potential.

[0029] Example 3 Feeding test of low cellulose rice

[0030] Soybean straw in 003 mutton fattening compound feed was replaced by low cellulose rice straw harvested in Example 2 to obtain a daily ration. 20 heads of 5-month-old male Hu sheep with similar body shape and similar weight were selected and divided into two groups, namely the test group and the control group, 10 heads of male Hu sheep in each group; the test group of male Hu sheep was fed with daily ration, and the control group of male Hu sheep was fed with 003 mutton fattening compound feed, and after 70 days of feeding, all were slaughtered and the growth performance, slaughter traits, rumen fluid indexes and blood indexes were determined, and the results are shown in Tables 4-7.

[0031] Table 4 Growth performance of male Hu sheep in each group

[0032] Table 5 Slaughter traits of male Hu sheep in each group

[0033] Table 6 Rumen fluid indexes of male Hu sheep in each group

[0034] Table 7 Blood indexes of male Hu sheep in each group

[0035] Results show that there is no significant difference in initial body weight between the test group of male Hu sheep fed with daily ration prepared from low cellulose rice straw of the application and the control group of male Hu sheep fed with 003 mutton fattening compound feed ( P > 0.05), which indicates that the basis of the two groups of male Hu sheep is consistent at the beginning of the test. After 70 days of feeding, the final body weight, total feed intake, daily average feed intake, feed conversion ratio, total dry matter intake and daily average dry matter intake of the two groups of male Hu sheep have no significant difference ( P>0.05); Although the absolute weight gain and average daily weight gain of the experimental group male Hu sheep were higher than those of the control group male Hu sheep, the difference was not statistically significant. P >0.05). This indicates that feeding the diet prepared from the low-cellulose rice of this invention will not have a negative impact on the growth performance of male Hu sheep; There was no significant difference in the pre-slaughter live weight between the two groups of male Hu sheep. P >0.05), consistent with the final body weight results in growth performance. Regarding major carcass traits, there were no significant differences between the two groups of male Hu sheep in hoof weight, skin weight, tail weight, testis weight, carcass weight, head weight, backfat thickness, and longissimus dorsi muscle weight. P >0.05); Regarding organ weight, the lung weight of male Hu sheep in the experimental group was significantly lower than that of male Hu sheep in the control group ( P <0.01), while there were no significant differences in the weights of the heart, liver, kidneys, spleen, each stomach compartment (rumen, reticulum, omasum, abomasum), large intestine, and small intestine. P >0.05). This indicates that feeding the diet prepared from the low-cellulose rice of this invention, apart from significantly reducing lung weight, did not have a significant impact on other slaughter traits or the development of major organs; There were no significant differences in the concentrations of volatile fatty acids (acetic acid, propionic acid, butyric acid, isobutyric acid, isovaleric acid, valeric acid, hexanoic acid, etc.), ammonia nitrogen concentration, microbial protein concentration, and pH value in the rumen fluid of the two groups of male Hu sheep. P >0.05). This indicates that feeding the diet prepared from the low-cellulose rice of this invention does not alter the rumen fermentation pattern and internal environment stability of male Hu sheep; Regarding blood biochemical indicators, the serum alanine aminotransferase activity in the experimental group of male Hu sheep was significantly lower than that in the control group of male Hu sheep. P <0.01), and the white-to-globulin ratio tended to be lower than that of the control group of male Hu sheep. P =0.05); there were no significant differences in albumin, total protein, globulin, calcium, glucose, urea nitrogen, inorganic phosphorus, amylase, cholesterol, total bilirubin, alkaline phosphatase, creatinine, urea nitrogen-to-creatinine ratio, creatine kinase, and other indicators between the two groups of male Hu sheep. P >0.05); Regarding routine blood counts, there were no significant differences between the two groups of male sheep in white blood cell count, red blood cell count, hemoglobin content, hematocrit, various red blood cell indices (MCV, MCH, MCHC, RDW), platelet count, and related parameters (MPV, PDW, PCT). P >0.05). This indicates that feeding the diet prepared from the low-cellulose rice of this invention will not have adverse effects on the blood physiological state and immune function of male Hu sheep.

[0036] The ration prepared from the low cellulose rice can replace conventional feed and is used for feeding the male Hu sheep, and does not have negative influence on the overall growth performance, rumen fermentation, blood physiology and most of the slaughter traits of the male Hu sheep. It is found that the lung weight of the male Hu sheep in the test group is significantly reduced, and the serum alanine aminotransferase activity is extremely significantly reduced, indicating that the ration prepared from the low cellulose rice can improve the liver function of the male Hu sheep, and therefore, the low cellulose rice is a potential conventional feed replacement.

[0037] From the above examples, it is found that the present application provides a method for reducing the cellulose content of rice and its application. The present application creates a rice line with low straw cellulose and lignin content, high straw feeding value, good yield, quality and lodging resistance, which can promote the application of rice straw feed, solve the problem of high-quality roughage shortage in the livestock breeding industry, improve the self-sufficiency rate of high-quality roughage in the livestock and breeding industry, solve the practical problems caused by excessive straw returning to field, and promote the comprehensive utilization of rice straw.

[0038] The above only describes the preferred embodiments of the present application, and it should be pointed out that for ordinary skilled persons in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A method of reducing the cellulose content of rice, characterized by, Using gene editing technology to make rice OsSND2 genes , CEF1 genes and IBC genes are mutated so that the function of the genes is lost, thereby reducing the cellulose content of the rice; The OsSND2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The CEF1 The nucleotide sequence of the gene is shown as SEQ ID NO. 2; The IBC The nucleotide sequence of the gene is shown as SEQ ID NO.

3.

2. Application of a rice multi-gene editing vector based on a CRISPR-Cas9 gene editing system in reducing cellulose content in rice. The rice multi-gene editing vector is a gRNA expression vector based on a CRISPR-Cas9 gene editing system. The gRNA expression vector targets rice OsSND2 genes, CEF1 genes and IBC genes for editing, enabling rice OsSND2 genes, CEF1 genes and IBC genes to be functionally deleted; The OsSND2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The CEF1 The nucleotide sequence of the gene is shown as SEQ ID NO. 2; The IBC The nucleotide sequence of the gene is shown as SEQ ID NO.

3.

3. Use according to claim 2, characterized in that, In the gRNA, the target OsSND2 The nucleotide sequence of the action site of the gRNA of the gene is shown in SEQ ID NO. 4-5, and the target CEF1 The nucleotide sequence of the action site of the gRNA of the gene is shown in SEQ ID NO. 6-7, and the target IBC The nucleotide sequence of the action site of the gRNA of the gene is shown in SEQ ID NO. 8-9.

4. A method of reducing cellulose content in rice by multi-gene editing, characterized in that, Introducing the rice multi-gene editing vector based on the CRISPR-Cas9 gene editing system into rice to obtain transgenic rice plants, and screening low-cellulose rice from the transgenic rice plants.

5. The method of claim 4, wherein, The rice multi-gene editing vector is a gRNA expression vector based on a CRISPR-Cas9 gene editing system. The gRNA expression vector targets rice OsSND2 genes, CEF1 genes and IBC genes for editing, enabling rice OsSND2 genes, CEF1 genes and IBC genes to be functionally deleted; The OsSND2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The CEF1 The nucleotide sequence of the gene is shown as SEQ ID NO. 2; The IBC The nucleotide sequence of the gene is shown as SEQ ID NO.

3.

6. The method of claim 4, wherein, The nucleotide sequence of the transgenic tag detection primer for detecting the transgenic rice plants is shown as SEQ ID NO. 28-29.

7. Low-cellulose rice prepared by the method of any one of claims 4-6.

8. Application of the low-cellulose rice of claim 7 in preparing low-cellulose rice straw feed.

Images