ZmKOB1 gene and application thereof in regulation and control of lodging resistance of corn

Abstract

The invention discloses a ZmKOB1 gene and application thereof in regulation and control of lodging resistance of corn, and belongs to the field of plant biotechnology breeding. The corn ZmKOB1 gene provided by the invention has the functions of thickening plant stalks and / or enhancing lodging resistance after high expression in plants or knockout of a uORF element of the ZmKOB1 gene, and the gene resource and the application method thereof have wide application prospects in the field of corn breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the utilization of ZmKOB1 Methods and applications for regulating maize stalk thickness and lodging resistance through gene overexpression or loss-of-function mutations. Background Technology

[0002] In recent years, due to the deterioration of the climate and environment, the intensification of various adverse stresses and disasters, the large-scale application of nitrogen fertilizer, and the promotion of dense planting, the situation of maize lodging damage has become increasingly severe, and lodging has become a major limiting factor for high and stable maize yields. Maize lodging is a phenomenon caused by external forces that cause maize roots or stalks to bend or break. Its damage is mainly manifested in the following ways: 1) Lodging disrupts the spatial order of leaves, causing plants to collide and damage leaf tissues, resulting in reduced photosynthetic efficiency and affecting yield; 2) Lodging damages the root and stem transport system, affecting the transport of nutrients, water, and photosynthetic products, resulting in yield reduction; 3) Lodging can cause ear sprouting, aggravating ear diseases and affecting maize quality; 4) Lodging can cause disordered plant arrangement, greatly increasing harvesting difficulty and costs. Existing statistics show that maize lodging can cause yield reductions of 15-50%, and in severe cases, even total crop failure; for every 1% increase in the maize lodging rate, the yield reduction is approximately 108 kg / hm². The survey also shows that among all traits, including yield, lodging resistance is the trait that farmers care about most and is the primary factor they consider when selecting varieties. Therefore, good lodging resistance is the primary breeding goal for new maize varieties. Summary of the Invention

[0003] All references cited herein are incorporated herein by reference. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise stated, the techniques used or mentioned herein are standard techniques known to one of ordinary skill in the art. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.

[0004] This application's embodiments, through a series of experimental studies, have found that improving [something] in maize plants [can] ZmKOB1 When the gene expression level is increased, it has unexpected technical effects. Plants with increased expression levels have phenotypes of thicker stems and / or enhanced lodging resistance. Thicker stems include increased diameter of the long axis and / or the short axis of the stem. Enhanced lodging resistance refers to increased thrust at 40 cm above the ground, increased thrust at 20 cm above the ground, and / or increased piercing force of the stem at 20 cm above the ground. The aforementioned gene resources and functions are of great significance for maize breeding.

[0005] The embodiment of the present application provides a method for producing a corn plant with the phenotype of thickening stem and / or enhancing lodging resistance, the method comprises the steps of: (a) increasing the expression amount or protein content of a functional gene in the corn plant; ZmKOB1 (b) obtaining at least one seed of the corn plant produced in the step (a).

[0006] Optionally, the step of increasing the expression amount of the functional gene in the corn plant comprises introducing an overexpression vector of the functional gene into the corn plant, or performing knockout on the uORF element of the functional gene to increase the expression amount or protein content of the functional gene. ZmKOB1 ZmKOB1 ZmKOB1 ZmKOB1

[0007] Optionally, the thickening stem comprises increasing the long-axis diameter of the stem and / or increasing the short-axis diameter of the stem.

[0008] Optionally, the enhancing lodging resistance comprises enhancing the 40cm pushing force from the ground, enhancing the 20cm pushing force from the ground and / or enhancing the 20cm stem penetration force from the ground, and reducing the incidence of lodging.

[0009] Optionally, the polynucleotide sequence of the functional gene is selected from one of the following sequences: ZmKOB1 (a) the polynucleotide sequence as shown in SEQ ID No: 1, 2, 4 or 6; (b) the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No: 3, 5 or 7; (c) the polynucleotide sequence capable of hybridizing to the polynucleotide sequence in (a) or (b) under stringent hybridization conditions, and the overexpression of the polynucleotide sequence exogenous to the corn plant has the function of thickening the stem of the plant and / or enhancing the lodging resistance of the plant; (d) the polynucleotide sequence having at least 90%, 95%, 98% or more similarity with the polynucleotide sequence in any one of (a)-(c), and the overexpression of the polynucleotide sequence exogenous to the corn plant has the function of thickening the stem of the plant and / or enhancing the lodging resistance of the plant; or (e) the polynucleotide sequence complementary to the sequence in any one of (a)-(d). Optionally, the overexpression vector further comprises a promoter operably linked to the nucleotide sequence of the functional gene and improving the expression amount of the functional gene.

[0010]

[0011] ​​​​​​Optionally, the promoter is a overexpression or superexpression promoter such as CaMV 35S, Ubiquitin, or Actin1, etc. Optionally, the promoter can also be an inducible promoter or a tissue organ specific expression promoter. Optionally, the promoter utilizes ZmKOB1 naturally variant sequences of the promoter.

[0012] Optionally, those skilled in the art know that the embodiments of the present application disclose ZmKOB1 the function of the gene, any technology using natural variation to improve the expression amount or ZmKOB1 protein content of ZmKOB1 the gene to promote stem thickening and / or lodging resistance should also be covered within the protection scope of the present application.

[0013] Optionally, the ZmKOB1 nucleotide sequence of the uORF element of the gene is shown as SEQ ID NO: 14.

[0014] Optionally, the knockout described in the present application is CRISPR / Cas9, CRISPR / Cas12i, CRISPR / Cas12i3, CRISPR / Cas12j, CRISPR / Cas3C, CRISPR / cpf1, etc.

[0015] Optionally, the target sequence used for the CRISPR / Cas9 knockout is shown as SEQ ID NO 15 or 16.

[0016] Optionally, the present application also provides the use of any of the above-mentioned methods in the production of corn plants with increased stem thickening and / or lodging resistance.

[0017] Optionally, the ZmKOB1 gene provided in the embodiments of the present application also includes a homologous gene or the same gene in different varieties having at least 80%, 85%, 90%, 95%, 98%, or 99% sequence similarity to the polynucleotide sequence thereof, or a homologous gene or the same gene in different varieties having at least 90%, 95%, or 98% sequence similarity to the amino acid sequence of the ZmKOB1 gene disclosed in the embodiments of the present application, and the function of the homologous gene to make the plant stem thickening and / or lodging resistance after overexpression, the homologous gene can be isolated from any plant.

[0018] Optionally, the method provided by the present application can be applied to any plant containing ZmKOB1 the homologous gene. Preferably, the plant includes monocotyledonous plants such as corn, millet, wheat, barley, rye, rice, and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, tobacco, etc.

[0019] The percentage of sequence similarity described in this application can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0020] Those skilled in the art should know that single nucleotide polymorphisms (SNPs) exist for the same gene among different varieties of the same plant, meaning that the nucleotide sequence of the same gene often differs by a few bases. However, there are many varieties of the same crop, and it is impossible for the inventors to list them all. The embodiments of this application only provide sequences of representative varieties of maize. Therefore, those skilled in the art should know that sequences from different varieties may differ from those disclosed in this invention. ZmKOB1 Methods and applications for overexpressing genes and their nucleotide sequences containing SNPs to achieve thicker stems and / or enhanced lodging resistance in plants.

[0021] Optionally, embodiments of this application also provide feed, coarse flour, protein, or oil products made from corn, wherein the feed, coarse flour, protein, or oil product contains... ZmKOB1 Increased gene expression. This application also provides a corn-based feed, meal, protein, or oil product, wherein the feed, meal, protein, or oil product contains... ZmKOB1 Gene overexpression constructs.

[0022] Optionally, the methods described in the embodiments of this application for transferring nucleotide sequences, vectors, constructs, or expression cassettes into plants, introducing them into plants, or transforming plants all refer to transferring the target nucleotide sequence, construct, vector, or expression cassette into recipient cells or recipient plants through conventional transgenic methods or methods of hybridization with target transgenic plants. Any transgenic method known to those skilled in the art can be used to transform recombinant expression vectors into plant cells to produce transgenic plants or mutants of the embodiments of this application. Transformation methods may include direct or indirect transformation methods. Specifically, the transformation methods include, but are not limited to, polyethylene glycol-induced DNA uptake, liposome-mediated transformation, gene gun introduction, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods.

[0023] Compared with the prior art, this application has the following beneficial effects: (1) This application provides a method for producing maize plants and its application, by improving the quality of maize plants. ZmKOB1The expression amount of the gene, the plant with excellent agronomic traits such as thickening of stalks and / or enhanced resistance to lodging is obtained. The foregoing gene, method and application thereof provide new germplasm resources and breeding ideas for corn breeding, and have important significance for global food security and sustainable agricultural development. (2) The gene in corn is determined Techniques The function of the gene after overexpression and mutation is determined, and the upstream regulatory element is provided, thereby providing a new gene resource for crop species; (3) The breeding material with application value is obtained by overexpression or function inhibition of the gene, thereby providing a new idea for crop breeding and research on the network of gene action mechanisms. The terms involved in the present application are defined as follows:

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods, devices and materials are now described.

[0025] In the context of the present application, the term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides in single or double strand form and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides which have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0026] The term "homologous gene" in the present application refers to two or more gene sequences with a sequence similarity of 80%, which includes orthologous genes (also known as vertical homologous genes, positive homologous genes or directional evolution homologous genes), paralogous genes (also known as paralogous genes, parallel evolution homologous genes) and / or heterologous homologous genes.

[0027] The term "sequence similarity" refers to the degree of similarity between two sequences, which is a quantitative concept for comparing the degree of similarity between different sequences, so as to find and analyze the correlation between two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences and the like.

[0028] The term "strict hybridization conditions" as used in this application refers to conditions of low ionic strength and high temperature known in the art. Typically, under strict conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Strict hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the strictness of hybridization or washing conditions. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, ...). in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, Figure 1 (Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be below the melting point (T0) of the specific sequence at a specified ionic strength pH. m Approximately 5-10℃. m The temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence under equilibrium conditions (at specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is present in excess, therefore at T...). m (Under equilibrium conditions, 50% of the probe is occupied). Strict conditions may include: a salt concentration of less than about 1.0 M sodium ions at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ions (or other salts), and a temperature of at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal may be at least twice the background hybridization, and, where appropriate, 10 times the background hybridization. Exemplary strict hybridization conditions may be: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0029] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, a selection marker engineered for expression in plant cells, and the heterologous DNA sequence to be transcribed.

[0030] The "mutation" described in the present application refers to a "loss-of-function mutation" or a "loss-of-function mutation", which is a mutation in the coding sequence of a gene that causes the function of the gene product (usually a protein) to decrease or completely disappear. The loss-of-function mutation can be caused by, for example, truncation of the gene product (due to a frameshift or nonsense mutation), and the phenotype associated with the allele with the loss-of-function mutation can be recessive or dominant.

[0031] The term "overexpression", also known as "overexpression", refers to the process of operably linking the full-length sequence of a target gene to a constitutive promoter, an inducible promoter or a tissue-specific promoter, and transferring it into a plant by transformation technology, so that the gene product is accumulated in the plant.

[0032] The term uORF, also known as upstream Open Reading Frame, is a short coding sequence located between the start codon (usually AUG) and the stop codon in the 5' untranslated region (5'UTR) of a gene mRNA, usually less than 100 amino acids in length, although it often does not encode functional proteins, but can regulate the expression of the downstream main ORF (core sequence encoding target protein) through translational regulation. The small ORF (abbreviated as uORF) in the 5'-UTR region of a gene in general plants will affect the protein content of the gene product by affecting the protein translation efficiency of the gene. Generally, knocking out or changing the uORF will increase the translation efficiency of the corresponding gene, thereby increasing the protein content. BRIEF DESCRIPTION OF DRAWINGS

[0033] ZmKOB1 Figure 2 Gene editing design and mutant deletion sequence diagram.

[0034] ZmKOB1 Figure 3 Statistical graph of overexpression material gene expression.

[0035] ZmKOB1 Wild type separation control and Figure 4 Comparison chart of overexpression, gene editing mutant material small trumpet period stem.

[0036] ZmKOB1 Wild type separation control and Figure 5 Statistical chart of overexpression, gene editing mutant material anthesis period stem diameter.

[0037] ZmKOB1 Wild type separation control and Figure 6 Statistical chart of overexpression, gene editing mutant material anthesis period ear position, 40 cm from the ground, 20 cm from the ground, thrust and penetration force.

[0038] ​​ZmKOB1 is wild type isolate control and Figure 7 Lodging of mutant materials under natural conditions in the field.

[0039] Figure 8 is ZmKOB1-uORF gene editing design and mutant deletion sequence diagram.

[0040] Figure 9 is protein immunoblotting diagram of wild type isolate control and ZmKOB1-uORF gene editing mutant material.

[0041] Figure 10 is stem diameter statistics diagram of wild type isolate control and ZmKOB1-uORF gene editing mutant material at the anthesis stage.

[0042] Figure 11 is ear position, 40 cm from the ground, 20 cm from the ground, thrust and penetration force statistics diagram of wild type isolate control and ZmKOB1-uORF gene editing mutant material at the anthesis stage.

[0043] ZmKOB1 is lodging statistics diagram of wild type isolate control and ZmKOB1-uORF gene editing mutant material under natural conditions in the field. DETAILED DESCRIPTION

[0044] The present application will be further described below in connection with specific embodiments, and the advantages and characteristics of the present application will become more apparent as the description proceeds. However, these embodiments are only exemplary, and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the present application without departing from the spirit and scope of the present application, and such modifications and substitutions fall within the scope of the present application.

[0045] Example 1, ZmKOB1 Creation of mutant materials and overexpression materials In order to study the biological function of the gene in maize ZmKOB1 , the inventors plan to create mutant materials of the gene in the genetic transformation maize inbred ZC01 background material through the CRISPR / Cas9 gene editing system. The gene number of the gene in the B73_V3 genome is GRMZM2G123540, the gene number in the B73_V4 genome is Zm00001d039284, and the gene number in the B73_V5 genome is Zm00001eb119140. ZmKOB1 ZmKOB1 ZmKOB1 ​​The genomic DNA sequence is shown in SEQ ID NO:1, its coding region sequence (CDS) is shown in SEQ ID NO:2, 4 or 6, and the encoded amino acid sequence is shown in SEQ ID NO:3, 5 or 7.

[0046] The specific process is as follows: First, through steps such as CRISPR / Cas9 knockout target prediction, multicopy assessment of sequences in the B73 v5 genome, target-specific BLAST prediction, off-target rate prediction, and sgRNA secondary structure prediction, a design was developed. ZmKOB1 The optimal gene editing target sequences are identified, with a total of two target sites, whose sequences are as follows: ZmKOB1 -Target 1: 5'- GTAATGGGAAATCAGCTGCA -3' (SEQ ID NO:8) ZmKOB1 -Target 2: 5'- GGCTATCATTCGTGGCCTCA -3' (SEQ ID NO:9) Using the above target sequences, a [system / mechanism] was constructed. Figure 1 CRISPR / Cas9 gene editing vectors ( Zmkob1 ), and through genetic transformation of the maize inbred line ZC01, two independent genotypes were identified. Figure 1 mutant strains ( Zmkob1#1 ), and named them respectively Zmkob1#2 (KO#1) and ZmKOB1-Crispr-DT-F (KO#2), hereinafter referred to as KO#1 and KO#2 respectively. The identification PCR primers are: ZmKOB1-Crispr-DT-R :5'-TCCCATGCTCTGCCAACGT-3' (SEQ ID NO:10) ZmKOB1 :5'- ACATCTGGTCATTCTGGGGTTG -3' (SEQ ID NO:11) Amino acid sequence analysis showed that these mutants contained ZmKOB1 The genes all underwent mutations, resulting in protein deletion, premature termination, frameshift mutations, or complete deletion, among which: The KO#1 mutation is characterized by: ZmKOB1 There is a 600bp deletion between bases 2647 and 3246 in the genomic DNA, or a 267bp deletion between bases 738 and 1004 in the CDS.

[0047] The KO#2 mutation is characterized by: ZmKOB1A 7bp deletion between bases 3243 and 3249 of the genomic DNA, or a 7bp deletion between bases 1001 and 1007 of the CDS.

[0048] To further determine ZmKOB1 The biological functions of the expression vector were constructed using a plant overexpression vector backbone (Ubi promoter). ZmKOB1 The overexpression vector of (SEQ ID NO:2) was obtained and genetically transformed into maize inbred line ZC01 to obtain ZmKOB1-qRT-F Gene overexpression was obtained, resulting in two independent lines. Both overexpression lines were planted at the Langfang experimental base in the spring and summer of 2024. Leaf samples were taken during the silking and pollination stage and flash-frozen in liquid nitrogen. RNA was extracted using the TRIzol method and then processed using specific primers. ZmKOB1-qRT- :5'-CTCCAATGGAATCTCGCTCTACC-3' (SEQ ID NO:12), ZmKOB1 R :5'-GCTGCTACTCTCTGCTTTGTCTTTA-3' (SEQ ID NO:13) qRT-PCR quantitative analysis identified two... ZmKOB1-OE3 The overexpression lines were named as follows: ZmKOB1-OE4 (OE3) Figure 2 (OE4), hereinafter referred to as OE3 and OE4 respectively, were overexpressed 7.18-fold and 21.15-fold compared to wild-type, respectively. The results are as follows... ZmKOB1 As shown.

[0049] Example 2 ZmKOB1 Positive regulation of corn stalk diameter First, ZC01 background plants were initially cultivated in a greenhouse with constant photoperiod, temperature, and humidity. ZmKOB1 Gene-edited mutant materials KO#1, KO#2 and their corresponding wild-type segregating controls CK, ZC01 background ZmKOB1 The overexpressing lines OE3 and OE4, along with their wild-type segregating controls CK3 and CK4, were observed at the small trumpet stage (i.e., the V6-V8 leaf expansion stage). Compared to the wild-type segregating controls CK3 and CK4, [the results were observed]. ZmKOB1 The stem diameters of the overexpressing gene lines OE3 and OE4 were significantly increased; compared with the wild-type segregating control CK, the stem diameters were significantly increased. Figure 3 The stem diameter of both gene-edited mutant materials KO#1 and KO#2 was significantly reduced. ZmKOB1 Furthermore, in the spring and summer of 2024, at the Langfang experimental base in Hebei Province, studies were conducted on the ZC01 background. ZmKOB1Gene editing mutant materials KO#1 and KO#2 and their corresponding wild type separation controls CK, ZC01 background ZmKOB1 Gene overexpression lines OE3 and OE4 and their corresponding wild type separation controls CK3 and CK4 were planted. At the mature powder stage, the wild type separation controls and the corresponding ZmKOB1 Gene editing mutant materials, wild type separation controls and Figure 4 Gene overexpression line materials, the diameters of the long axis and short axis of the stem were observed, measured and statistically analyzed. Statistical analysis of the data obtained found that, compared with the separation wild type controls CK3 and CK4, the long axis and short axis diameters of the overexpression lines OE3 and OE4 were significantly increased, among which, compared with CK3, the long axis diameter of OE3 was increased by an average of about 10.74%, and the short axis diameter was increased by an average of about 6.33%; compared with CK4, the long axis diameter of OE4 was increased by an average of about 8.26%, and the short axis diameter was increased by an average of about 8.67% ( Figure 4 ). On the contrary, compared with the wild type separation control CK, the stem diameters of the gene editing mutants KO#1 and KO#2 were significantly reduced, among which, the long axis diameter of KO#1 was reduced by about 11.24%, and the short axis diameter of KO#1 was reduced by about 9.60%; the long axis diameter of KO#2 was reduced by about 14.99%, and the short axis diameter of KO#2 was reduced by about 19.44% ( ZmKOB1 ). The above observation and statistical analysis results show that, ZmKOB1 Gene overexpression can significantly increase the long axis diameter and the short axis diameter of the stem, and has an important biological function of positively regulating the stem diameter of corn.

[0050] Example 3, ZmKOB1 Improving the lodging resistance of corn Using a stem strength tester, the materials were measured and statistically analyzed to evaluate the lodging resistance of corn stems and roots under simulated field wind conditions. The specific method is to use the stem strength tester to vertically hold or metal spike head to resist the corn stem, push the different corn materials at each height to the corresponding fixed angle or pierce the stem, and record the pushing force or piercing force at this time, including the pushing force at 30° from the vertical line at the ear position at the powder stage, the pushing force at 20° from the vertical line at 40 cm from the ground, the pushing force at 15° from the vertical line at 20 cm from the ground, and the piercing force of the stem at 20 cm from the ground. To ensure the accuracy of the measurement, select single plants with similar growth vigor for each material and take the average value, do not measure the materials at the beginning and end of each row, and ensure that at least 6 plants of each material are measured. In the spring and summer of 2024, in the field of the Langfang experimental base in Hebei, the ZmKOB1Genetic editing mutant materials KO#1 and KO#2 and their corresponding wild type separation controls CK, ZC01 background ZmKOB1 Overexpression strains OE3 and OE4 of the gene and their corresponding wild type separation controls CK3 and CK4 were planted. Also at the loose powder maturity stage, the wild type separation controls and the corresponding ZmKOB1 Genetic editing mutant materials, wild type separation controls and Figure 5 The determination and statistics of lodging resistance of the genetic overexpression strain materials were carried out. Statistical analysis of the obtained data found that compared with the wild type separation control CK, the ear position thrust, 40 cm from the ground thrust, 20 cm from the ground thrust and stem puncture force of the mutants KO#1 and KO#2 were significantly lower than the wild type, wherein the ear position thrust, 40 cm from the ground thrust, 20 cm from the ground thrust of the mutant KO#1 decreased by about 20.73%, 20.08%, 21.85% respectively, and the puncture force decreased by about 6.25%, the ear position thrust, 40 cm from the ground thrust, 20 cm from the ground thrust of the mutant KO#2 decreased by about 32.14%, 54.30%, 50.82% respectively, and the puncture force decreased by about 19.49% (Table 2). ZmKOB1 At the same time, compared with the separation wild type controls CK3 and CK4, Figure 5 The ear position thrust of the overexpression strains OE3 and OE4 of the gene had no significant difference; the 40 cm from the ground thrust was significantly enhanced, with an average increase of about 15.36%, 14.52% respectively; the 20 cm from the ground thrust was significantly enhanced, with an average increase of about 18.61%, 47.68% respectively; and the 20 cm from the ground stem puncture force was also significantly enhanced, with an average increase of about 5.65%, 12.10% respectively (Table 3). ZmKOB1

[0051] The determination and statistics of the materials by the stem strength tester thrust and puncture force can well simulate the evaluation of the lodging resistance of corn stem, and through the above ZmKOB1 The change characteristics of the thrust in the genetic editing mutant materials and Zmkob1 The genetic overexpression materials show that the mutants KO#1 and KO#2 are more prone to lodging than the wild type, and the overexpression materials OE3 and OE4 are more resistant to lodging than the wild type, combined with the phenotype observation of the long axis and short axis diameters of the stems of the mutants and overexpression materials, ZmKOB1 The stem diameter of the mutants is significantly reduced, making the corn more prone to lodging; the stem diameter of the overexpression material KOB1-OE is significantly increased, making the corn more resistant to lodging.

[0052] ​In addition, different genetic materials were planted under natural conditions in Langfang in 2025. The Langfang experimental station experienced two consecutive heavy rainstorms on August 7th and 13th, 2025 (data from the Langfang Meteorological Bureau shows instantaneous winds reaching level 10-11), causing widespread lodging of some maize materials in the fields. We... ZmKOB1 The lodging conditions of different genetic materials were statistically analyzed. A lodging coefficient of 1 was defined as the stem remaining vertical or tilted at an angle within 15°; 15° to 30° as a lodging coefficient of 2; 30° to 45° as a lodging coefficient of 3; 45° to 70° as a lodging coefficient of 4; and 70° or more, or stem breakage or root collapse, as a lodging coefficient of 5. The statistical results showed that… ZmKOB1 Mutants KO#1 and KO#2 showed an increased lodging rate after wind and rain disasters compared to the wild type, meaning they were more prone to lodging. Figure 6 Compared to wild-type OE4, overexpressed materials OE3 and OE4 showed a lower lodging rate after wind and rain disasters, indicating greater lodging resistance. ZmKOB1-uORF ).

[0053] Example 4: Precise knockout using gene editing ZmKOB1 Components improve corn's resistance to lodging More importantly, we are ZmKOB1 A 24nt regulatory mechanism was found in the 5' UTR region upstream of the gene's CDS. ZmKOB1 The expressed uORF (Upstream Open Reading Frame) element "ATGATCACAAATAAGCTAAGTTAA" (SEQ ID NO:14) is located in ZmKOB1-uORF -245 bp upstream of the ATG start codon in the gene.

[0054] In the genetically transformed maize inbred line ZC01, we plan to precisely create knockout gene editing systems using the CRISPR / Cas9 gene editing system. ZmKOB1-uORF The component is a lodging-resistant corn mutant material. Similarly, a design was created. ZmKOB1-uORF The optimal gene editing target sequences are identified, with a total of two target sites, whose sequences are as follows: ZmKOB1-uORF Target 1: 5'-ATTATGGTAGAAAGCTTGGA-3' (SEQ ID NO:15) ZmKOB1-uORF Target 2: 5'-TAACCTAACTTATATAATTT-3' (SEQ ID NO:16) Using the above target sequence , constructed Figure 7 CRISPR / Cas9 gene editing vectors ( Zmkob1-uorf), and through genetic transformation of the maize inbred line ZC01, two independent genotypes were identified. Figure 7 mutant strains ( Zmkob1-uorf#1 ), and named them respectively Zmkob1-uorf#2 (uORF-KO#1) and ZmKOB1-uORF-Crispr-DT-F (uORF-KO#2), and its isolation control is named uORF-CK (uORF-CK), hereinafter referred to as uORF-KO#1, uORF-KO#2, and uORF-CK, respectively. The identification PCR primers are: ZmKOB1-uORF-Crispr-DT-R :5'-GCAAGAGGCAGATGTACCTGA-3' (SEQ ID NO:17) Figure 7 :5'-GTTGGATGGAGGAGAGCTCG-3' (SEQ ID NO:18) Nucleotide sequence analysis showed that both uORF-KO#1 and uORF-KO#2 deleted 48 bp containing the uORF element, but there was one base difference between them ( ZmKOB1 The mutated 5' UTR sequence is shown in SEQ ID NO:19 and 20.

[0055] Furthermore, in order to detect the effects of uORF element sequence deletions or mutations... ZmKOB1-uORF The effect of protein-encoded abundance was investigated by growing ZC01-background proteins in a greenhouse under constant culture conditions. ZmKOB1-uORF Gene-edited mutant materials uORF-KO#1 and uORF-KO#2, and their corresponding wild-type segregating control uORF-CK, were used. The uppermost unfolded leaf at stage V3 was used to extract crude total protein. Protein immunoblotting was performed, and the abundance of the target protein ZmKOB1 and the internal control protein β-actin was detected using antibodies. The results showed that, compared with the wild-type segregating control uORF-CK, Figure 8 The abundance of ZmKOB1 relative to the internal reference protein β-actin was significantly increased in the gene-edited mutant materials uORF-KO#1 and uORF-KO#2. ZmKOB1 This indicates that deleting or mutating the uORF element can effectively improve... ZmKOB1-uORF The amount of encoded protein.

[0056] To investigate the biological functions of this uORF element, in the spring and summer of 2024, experiments were conducted at the Langfang Experimental Base in Hebei Province using ZC01 background materials. ZmKOB1-uORF Gene-edited mutant materials uORF-KO#1 and uORF-KO#2, along with their corresponding wild-type segregators uORF-CK, were planted. At maturity and pollen shedding stage, the wild-type segregators and corresponding... Figure 9The gene editing mutant material was observed, measured and statistically analyzed for the diameters of the long axis and short axis of the stem. Statistical analysis of the obtained data found that compared with uORF-CK, the stem diameter of uORF-KO#1 and uORF-KO#2 increased significantly, whether it was the long axis diameter or the short axis diameter. Among them, the long axis diameter of uORF-KO#1 stem increased by about 10.64%, and the short axis diameter of the stem increased by about 13.67%; the long axis diameter of uORF-KO#2 stem increased by about 9.06%, and the short axis diameter of the stem increased by about 9.65% Figure 10 ).

[0057] Further, in order to evaluate the effect of the uORF element on the lodging resistance of corn stem, the stem strength tester was used to determine and statistically analyze the push force at 30° from the vertical line at the ear position, the push force at 20° from the vertical line at 40 cm from the ground, the push force at 15° from the vertical line at 20 cm from the ground, and the puncture force of the stem at 20 cm from the ground, to simulate the field wind force on uORF-CK and uORF-KO#1 and uORF-KO#2 materials. The results found that compared with uORF-CK, the push force at the ear position, the push force at 40 cm from the ground, the push force at 20 cm from the ground, and the stem puncture force of uORF-KO#1 and uORF-KO#2 were significantly improved. Among them, the push force at the ear position of uORF-KO#1 increased by about 40.08%, the push force at 40 cm from the ground increased by about 45.31%, the push force at 20 cm from the ground increased by about 37.03%, and the stem puncture force increased by about 14.08%; the push force at the ear position of uORF-KO#2 increased by about 22.15%, the push force at 40 cm from the ground increased by about 37.98%, the push force at 20 cm from the ground increased by about 31.48%, and the stem puncture force increased by about 7.66% ZmKOB1-uORF ).

[0058] In addition, different ZmKOB1-uORF editing genetic materials were planted under natural conditions in Langfang in 2025. Two consecutive heavy rains occurred on August 7 and August 13, 2025 (Langfang Meteorological Bureau data showed that the instantaneous gale reached 10-11 levels), and part of the corn materials in the field were lodged. We counted the lodging of the Figure 11 editing genetic materials, in which the stem was still vertical or the inclination angle was within 15°, which was the first grade lodging coefficient, the inclination angle was between 15° and 30°, which was the second grade lodging coefficient, the inclination angle was between 30° and 45°, which was the third grade lodging coefficient, the inclination angle was between 45° and 70°, which was the fourth grade lodging coefficient, and the inclination angle was more than 70° or the stem was broken, which was the fifth grade lodging coefficient. The statistical results found that the lodging rate of uORF-KO#1 and uORF-KO#2 compared with the wild type decreased significantly after the wind and rain disaster, that is, more lodging resistance ZmKOB1 ).

[0059] The above results show that we found a uORF negative regulatory element of gene expression ZmKOB1 which, after being deleted or mutated, can effectively increase ZmKOB1-uORF the content of the encoded protein, and obtain the corresponding "knock-up" phenotype. Compared with the isolated wild type uORF-CK, ZmKOB1-uORF The gene editing mutants uORF-KO#1 and uORF-KO#2 have higher ZmKOB1 protein abundance and are more resistant to lodging. Combined with the observation and statistics of the long axis diameter and short axis diameter phenotypes of the stems, ​ The stem diameter of the gene editing mutants uORF-KO#1 and uORF-KO#2 is significantly increased, making the corn more resistant to lodging-related force and more resistant to lodging, which is finally reflected in the significant reduction of the lodging rate in the field.

Claims

1. A method of producing a maize plant, comprising, The corn plant has a phenotype of stem thickening and / or enhanced resistance to lodging, and the method comprises the steps of: (a) increasing the expression level or protein content of a functional gene in a maize plant ZmKOB1 ; (b) obtaining at least one seed of the corn plant produced in step (a).

2. The method of claim 1, wherein the increasing the expression of the functional gene ZmKOB1 in the maize plant comprises introducing an overexpression vector of the functional gene ZmKOB1 in the maize plant, or knocking out the uORF element of the ZmKOB1 gene to increase the expression of ZmKOB1 or the content of the protein.​​​ 3. The method of claim 1 or 2, wherein the stem thickening comprises an increase in the long axis diameter of the stem and / or an increase in the short axis diameter of the stem.

4. The method of claim 1 or 2, wherein the enhanced resistance to lodging comprises an increase in 40 cm push force, an increase in 20 cm push force, and / or an increase in 20 cm stem penetration force, and / or a decrease in the incidence of lodging.

5. The method of claim 1 or 2, wherein said ZmKOB1 polynucleotide sequence of a gene is selected from one of the sequences of the following group: (a) a polynucleotide sequence as set forth in SEQ ID No: 1, 2, 4, or 6; (b) a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID No: 3, 5, or 7; (c) a polynucleotide sequence capable of hybridizing to the polynucleotide sequence set forth in (a) or (b) under stringent hybridization conditions, wherein overexpression of the polynucleotide sequence in a corn plant has a function of thickening the stem of the plant and / or enhancing the resistance to lodging of the plant; or (d) a polynucleotide sequence complementary to the sequence set forth in any one of (a)-(c).

6. The method of claim 2, wherein the overexpression vector further comprises a promoter operably linked to the nucleotide sequence of the functional gene and increasing the expression level of the functional gene.

7. The method of claim 6, wherein the promoter is the Cauliflower Mosaic Virus CaMV 35S, the Maize Ubiquitin, the Rice Actinl, or a natural variation of the promoter. ZmKOB1 promoter.

8. The method of claim 2, wherein the nucleotide sequence of the uORF element is as set forth in SEQ ID NO:

14.

9. The method of claim 2 or 8, wherein the knockout is CRISPR / Cas9, CRISPR / Cas12i, CRISPR / Cas12i3, CRISPR / Cas12j, CRISPR / Cas3C, CRISPR / cpf1, or the like.

10. Use of the method of any one of claims 1-9 in the production of a corn plant with a thickened stem and / or enhanced resistance to lodging.

Images