A method and kit for preparing libraries for whole-genome sequencing of embryonic microcells
By using a one-step amplification method that directly breaks down and adds adapters to the DNA of trace cells, the problems of high cost, long time consumption, and poor heterogeneity in whole-genome amplification of trace cells have been solved. This method enables efficient and low-cost whole-genome sequencing library construction, which is suitable for the detection of trace cells in embryos.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YAZHOUWAN NATIONAL LABORATORY
- Filing Date
- 2025-12-23
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies suffer from high costs, long processing times, and poor amplification uniformity in the process of amplifying whole genomes from trace cells. This is especially true in the detection of trace cells in embryos, where traditional methods result in low uniformity and coverage of whole genome amplification.
A one-step method was used to directly break and add adapters to DNA from a small amount of lysed cells, followed by PCR amplification and construction of sequencing libraries. The entire process was completed in the same reaction tube, including the use of lysis reagents, enzyme digestion reagents, ligation reagents, and amplification and library construction reagents.
It enables a shorter, lower-cost, and simpler whole-genome sequencing library preparation process, improves the uniformity and coverage of amplification, and is suitable for early screening of genetic diseases in human individuals and early selection in livestock and poultry breeding.
Smart Images

Figure CN121380291B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a method and kit for preparing libraries for whole-genome sequencing of embryonic microcells. Background Technology
[0002] After an animal's sperm and egg unite to form a gamete, the individual's genomic information is fixed. Genomic testing can then be used to predict the individual's future phenotype, which is of great significance for early selection in livestock and poultry breeding. Embryonic genome testing is generally performed before the embryo implants in the placenta. This stage allows full utilization of the embryo's free state and the totipotency of its cells. By expelling the embryo from the body, a small number of cells are extracted using a cutting needle for whole-genome sequencing. While in vitro fertilization (IVF), embryo cutting, and embryo transfer techniques are relatively mature, whole-genome amplification technology targeting a small number of cells is a key bottleneck in achieving this process.
[0003] Currently, several mature technologies have been developed for the amplification of micro-cells, but these methods suffer from high costs, long processing times, and uneven amplification. Traditional micro-cell amplification methods involve amplifying DNA using primers immediately after cell lysis, aiming to rapidly enrich DNA to provide sufficient DNA for further library construction. However, this process involves two DNA amplification steps. Due to primer biases in binding to different regions of the genome and their varying amplification efficiencies, this ultimately leads to poor uniformity and low coverage of the entire genome amplification. Generally, given sufficient DNA substrate, efficient and uniform DNA amplification can be achieved by fragmenting the DNA and adding immobilized adapter primers. However, whether this method is suitable for whole-genome amplification of micro-cell DNA and the conditions required during the amplification process remain unclear. Summary of the Invention
[0004] The purpose of this invention is to provide a method and kit for library construction for whole-genome sequencing of embryonic microcells, in order to solve the problems existing in the prior art. By directly breaking and adding adapters to the DNA after lysis of microcells, the library required for subsequent high-throughput sequencing is obtained in one step. This method is faster, simpler to operate, and lower in cost.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a method for library construction for whole-genome sequencing of a small number of embryonic cells, comprising the following steps:
[0007] (1) Lyse 5-16 trace embryonic cells with a cell lysis reagent to release genomic DNA;
[0008] (2) The genomic DNA is digested and fragmented with enzymes to obtain DNA fragments;
[0009] (3) Connect the amplification adapter sequence to both ends of the DNA fragment;
[0010] (4) PCR amplification was performed using fixed primers complementary to the amplification adapter sequence to construct a sequencing library;
[0011] Steps (1) to (4) are completed in the same reaction tube.
[0012] Preferably, in step (1), the number of embryonic cells is 5-8.
[0013] Preferably, in step (1), the lysis includes: adding 2-3 μL of nuclease-free water and 5-10 μL of lysis reagent to the sample, treating it at 55°C for 10 min, and then treating it at 80°C for 5 min;
[0014] The lysis reagent includes lysis buffer, proteinase K, and nuclease-free water in a volume ratio of 7:7:26.
[0015] Preferably, in step (2), the enzyme digestion includes: adding 5-10 μL of enzyme digestion reagent to the system, shaking it evenly, then treating it at 37°C for 10 min, and then treating it at 72°C for 20 min;
[0016] The enzyme digestion reagent includes an endonuclease, an endonuclease buffer, Taq DNA polymerase, dATP, and nuclease-free water in a volume ratio of 5:20:1:8:26.
[0017] Preferably, in step (3), the ligation includes adding 5-6 μL of ligation reagent to the system, shaking it evenly, and then treating it at 22°C for 300-350 min;
[0018] The ligation reagent comprises T4 DNA ligase, ATP, amplification adapter, and nuclease-free water in a volume ratio of 2:1:4:3.
[0019] Preferably, in step (4), the PCR amplification includes: adding 10-15 μL of amplification library preparation reagent and 4 μL of immobilization primer, shaking well, and then performing amplification; the amplification program is: 98℃ for 2 min; 98℃ for 20 s, 60℃ for 30 s, 72℃ for 1 min, 18 cycles; 72℃ for 5 min; and storing at 4℃.
[0020] The amplification library preparation reagents include amplification buffer, dNTP Mix, amplification polymerase, and nuclease-free water in a volume ratio of 40:4:4:7.
[0021] Preferably, in step (4), the nucleotide sequence of the immobilized primer is as shown in SEQ ID NO.1-2.
[0022] This invention also provides a kit for preparing a library for embryonic micro-cell whole-genome sequencing, the kit comprising:
[0023] (a) A lysis reagent, comprising lysis buffer, proteinase K and nuclease-free water;
[0024] (b) Enzyme digestion reagents, including endonuclease, endonuclease buffer, Taq DNA polymerase, dATP and nuclease-free water;
[0025] (c) Ligation reagents, which include T4 DNA ligase, ATP, amplification adapters and nuclease-free water;
[0026] (d) Amplification library preparation reagents, including amplification buffer, dNTP Mix, amplification polymerase and nuclease-free water.
[0027] Preferably, in the lysis reagent, the volume ratio of the lysis buffer, proteinase K, and nuclease-free water is 7:7:26;
[0028] In the enzyme digestion reagent, the volume ratio of the endonuclease, endonuclease buffer, Taq DNA polymerase, dATP, and nuclease-free water is 5:20:1:8:26.
[0029] In the ligation reagent, the volume ratio of the T4 DNA ligase, ATP, amplification adapter, and nuclease-free water is 2:1:4:3.
[0030] In the amplification library preparation reagent, the amplification buffer, dNTP Mix, amplification polymerase, and nuclease-free water are in a volume ratio of 40:4:4:7.
[0031] Preferably, the primer sequences for amplifying the amplification adapter are as shown in SEQ ID NO.1-2.
[0032] The present invention discloses the following technical effects:
[0033] This invention uses bovine embryos as experimental material, directly fragmenting and adding adapters to the DNA from a small amount of lysed embryonic cells. A one-step amplification process yields the library required for subsequent high-throughput sequencing. Furthermore, it establishes a highly efficient whole-genome sequencing method that integrates micro-cell DNA fragmentation, amplification, and library preparation under different testing conditions. Compared to traditional single-cell amplification methods, this method is faster, simpler to operate, and lower in cost, facilitating the rapid advancement of early screening for genetic diseases in individuals and early selection processes in livestock breeding. Attached Figure Description
[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0035] Figure 1 This diagram illustrates the preparation of a library for amplification of the whole genome of embryonic microcellular DNA. In the diagram, A represents PloyA, Adapter represents adapter, Index represents tag, and P5 and P7 represent adapters.
[0036] Figure 2 Quality control results for library construction based on whole genome amplification of DNA from 5-8 embryonic cells;
[0037] Figure 3 The effect of whole-genome sequencing of DNA from different numbers of embryonic cells;
[0038] Figure 4 Statistics on the number and distribution of SNPs detected in the whole genome for different embryonic cell numbers; A: Total number of SNPs; B: Proportion of empty SNPs;
[0039] Figure 5 Comparison of the detection performance of different sequencing depths for genomic DNA from 5-8 cells of embryos; A: Error compared to the reference genome; B: Coverage; C: Proportion of SNP null values; D: Total number of SNPs;
[0040] Figure 6 Comparison of SNP detection effects after whole-genome amplification of 5-8 cells using different kits; A: Average number of SNPs; B: Proportion of empty SNPs. Detailed Implementation
[0041] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0042] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0044] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0045] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0046] Unless otherwise specified, all reagents and experimental materials used in this invention are available through conventional commercial channels.
[0047] Example 1
[0048] 1. Experimental Materials
[0049] Bovine embryos: Bovine embryos were cultured in vitro until day 8. The embryos were then cut using an embryo cutter with a laser perforator to obtain blastocyst trophoblast cells. Five to eight cells, nine to twelve cells, and three to thirty-six cells were collected by aspiration. The samples were washed three times in preservation solution, and each sample was transferred to a 200 μL centrifuge tube with 3 μL of preservation solution for storage. Short-term storage was at -20°C, and long-term storage was at -80°C. Dry ice was used for transportation. Strict aseptic sampling conditions were maintained to avoid subsequent amplification failure.
[0050] 2. Reagents and preparation methods required for the experiment
[0051] The basic reagents used in this experiment were obtained either by purchasing existing products or by preparing them ourselves. Specific information is shown in Table 1.
[0052] Table 1. Information on reagents used in this experiment.
[0053]
[0054] Note: In the table, Protease K is proteinase K; Nuclease-free water is nuclease-free water; T4 DNAligase (High Concentrated) is T4 ligase (high concentration); KAPA HiFi fridelity Buffers supplied with polymerase is KAPA high-fidelity enzyme buffer.
[0055] The adapter primers required for this experiment are shown in Table 2. The primers were synthesized by Sangon Biotech.
[0056] Table 2 Primer information used in this experiment
[0057]
[0058] Note: "*" in the table represents phosphorylation.
[0059] To facilitate subsequent experiments, the reagents purchased above were prepared a second time according to the actual operating procedures and named R1, R2, R3 and R4 according to the order of use. The preparation scheme for each reagent module is shown in Table 3.
[0060] Table 3. Information on the reagent preparation methods developed in this experiment.
[0061]
[0062] 3. Experimental Procedure
[0063] The genomic detection of embryonic microcells using this kit involves five steps, the first of which is the amplification and library preparation of embryonic microcell DNA. The specific principle is as follows: Figure 1 As shown, the steps are briefly as follows: A small amount of embryonic cells are placed in a PCR tube, and the cells are lysed using nuclease-free water to release DNA. The DNA is then fragmented by enzyme digestion. Amplification adapter sequences are added to the fragmented DNA, and amplification and library construction are performed using fixed primers. The detailed steps of this experiment are as follows:
[0064] 3.1 Embryonic cell lysis and whole-genome DNA amplification library construction:
[0065] (1) After the sample is thawed, centrifuge it for 2 minutes using a small centrifuge;
[0066] (2) Lysis: Add 2 μL of nuclease-free water and 8 μL of R1 to the sample, centrifuge for 10 s (do not shake), then treat at 55℃ for 10 min and at 80℃ for 5 min;
[0067] (3) Enzyme digestion: Add 7 μL R2, shake to mix, centrifuge for 10 s, then treat at 37℃ for 10 min, and then at 72℃ for 20 min.
[0068] (4) Connecting connector: Add 5 μL of R3, shake to mix, centrifuge for 10 s, and then treat at 22℃ for 30 min;
[0069] (5) Library construction and amplification: Add 11 μL of R4, 2 μL each of I5 and I7 (I5 and I7 are each a sequence of primer + Index5 / 7 + P5 / P7- combination, where P5 is “AATGATACGGCGACCACCGAGATCTACAC, (SEQ ID NO.3)”, P7 is “CAAGCAGAAGACGGCATACGAGAT, (SEQ ID NO.4)”, P5 and P7 are fixed sequences linked to the Illumina sequencing chip, and the Index sequence is convenient for data splitting after sequencing), vortex to mix, centrifuge for 10 s, put into PCR instrument, experimental parameters: 98℃ for 2 min, [(98℃ 20 s, 60℃ 30 s, 72℃ 1 min) 18 cycles], 72℃ for 5 min, and store at 4℃.
[0070] The index sequence is shown in Table 4.
[0071] Table 4 Single-cell whole-genome sequencing indexes
[0072]
[0073] 3.2 Sorting:
[0074] (1) Add 0.6 times the volume of magnetic beads to the amplification product (the magnetic beads should be equilibrated at room temperature for 20 min in advance), shake to mix, centrifuge for 2 s, let stand for 5 min, transfer to a magnetic rack and place for 5 min, then discard the magnetic beads.
[0075] (2) Add 0.25 times the volume of magnetic beads, shake to mix, centrifuge for 2 s, let stand for 5 min, transfer to a magnetic rack and place for 5 min, then discard the liquid.
[0076] 3.3 Washing:
[0077] (1) Add 200 μL of 80% ethanol to the PCR tube, move it four times on the magnetic rack to move the magnetic beads, and discard the liquid;
[0078] (2) Repeat the previous step;
[0079] (3) Let it stand in the fume hood for 5 minutes;
[0080] (4) Add 30 μL of nuclease-free water to dissolve, shake to mix, centrifuge for 2 s, let stand for 5 min, transfer to a magnetic rack and place for 5 min, then discard the magnetic beads.
[0081] 3.4 Detection of library construction concentration
[0082] The product concentration was determined using Qubit fluorescence quantitative quantification to evaluate the library construction concentration.
[0083] 3.5 Sequencing
[0084] The sorted products were aliquoted into 15 μL and sent to a next-generation sequencing company (Beijing Gezhi Boya). After quality inspection, PE150 sequencing was performed using a DNBSEQ-T7 instrument.
[0085] 4. Sequencing data evaluation and analysis
[0086] The data obtained after sequencing were subjected to quality control processing. FastQC software was used to remove adapter sequences and low-quality reads from the sequencing sequences. Qualified reads were aligned to the bovine reference genome ARS-UCD2.0 using BWA software. SNPs for each sample were further detected and filtered using GATK software. All analysis was performed using the software's default parameters.
[0087] After obtaining the aligned .bam file and the .vcf file containing sample SNP information, statistical analysis was performed on the alignment results and SNP distribution using samtools and bedtools, respectively. For each sample, the genome coverage, repetition rate, alignment ratio, uniformity of the 50k window read count, total number of SNPs, and percentage of zero-value SNPs in the 50k window were statistically analyzed. To avoid the influence of sex chromosomes, this experiment only performed statistical comparisons on autosomes.
[0088] 5. Experimental Results
[0089] 5.1 Comparison of sequencing results for different numbers of embryonic cells
[0090] Embryo biopsies typically extract about 10 cells. Generally, a higher cell count leads to better genome amplification, but also causes greater damage to the embryo. Conversely, a lower cell count results in less damage to the embryo, but presents greater challenges for genome amplification. To investigate the minimum cell count required for this sequencing library preparation protocol, this invention conducted amplification experiments in three groups: 5-8 cells, 9-12 cells, and 13-16 cells. Nine samples were collected from the 5-8 cell and 9-12 cell groups, and eight samples from the 13-16 cell groups. The amplification results showed that the method of this invention can achieve the required DNA concentration (up to 260 ng / μL) for micro-cell whole-genome sequencing using only 5-8 cells. (See [link to relevant documentation]). Figure 2 .
[0091] By extracting 5X data from sequencing data of different cell numbers, comparative analysis was conducted. Figure 3 As shown, the results indicate that sequencing reads from 5-8 cells showed the best alignment with the reference genome, but the difference compared to other cell numbers was not significant. Regarding genome coverage, 9-12 cells performed best, with no significant difference compared to 5-8 cells. In terms of duplication amplification, 9-12 cells had the lowest performance, with no significant difference compared to 5-8 cells. These results show that the kit of this invention can achieve good amplification and sequencing results with both 5-8 and 9-12 cell numbers. The main reason for the poor results with 13-16 cells is likely that although 13-16 cells have more DNA, insufficient lysis leads to poor final whole-genome amplification.
[0092] like Figure 4 As shown, there was no significant difference in the number of SNPs detected among 5-8, 9-12, and 13-16 cells, with an average of over 2 million SNPs obtained. Furthermore, statistical analysis of the proportion of empty SNPs in the 50kb window showed that this kit can achieve uniform whole-genome amplification with 5-8 cells, and the maximum percentage of empty SNPs in the 50kb window is less than 10%, which is suitable for subsequent whole-genome analysis.
[0093] 5.2 Analysis of the effect of different sequence depths after DNA amplification and library construction from 5-8 embryonic cells
[0094] Whole-genome amplification was performed on 5-8 cell samples from collected embryos, followed by sequencing at different depths. Results showed that the alignment errors with the reference genome were relatively large at 1X and 2X sequencing depths, while those at 3X and above were more stable, averaging 95%. Figure 5 (A) As sequencing depth increases, the coverage of reads across the entire genome increases, reaching 50% coverage at a sequencing depth of 3×. Further increases in sequencing depth result in a slower increase in coverage. Figure 5 (B) The SNP zero rate in the 50k window showed the largest error and low stability at 1× and 2× sequencing depths, but achieved a more stable result at 3X sequencing depth with better distribution uniformity. Figure 5 (C) Regarding the number of SNPs detected, the number of SNPs detected gradually increases with increasing sequencing depth, reaching up to 2 million SNPs at 3X sequencing depth. Figure 5 (D).
[0095] 5.3 Comparative Analysis with Commercial Kits
[0096] Two commercially available kits were purchased and compared with the kit used in this study under parallel conditions. Whole-genome amplification was performed on 5-8 embryonic cells using the same kits, and 3× data were obtained for comparison. Results showed that the kit (New-kit) could obtain an average of 1.9 million SNPs, a significant advantage over kit (Kit1), and a detection difference of 300,000 SNPs compared to kit (Kit2). Figure 6 (A); However, in terms of amplification uniformity, this kit has a clear advantage due to its strategy of first breaking and adding adapters before amplification. The two commercial kits, especially Kit1, have significant shortcomings in amplification uniformity. Figure 6 (See section B). Furthermore, the kit in this invention only requires 1 hour and 55 minutes for amplification, which is shorter than existing kits (minimum 2 hours and 10 minutes), and has the advantage of being more efficient.
[0097] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for library construction for whole-genome sequencing of embryonic microcells, characterized in that, Includes the following steps: (1) After lysing 5-16 embryonic cells with a cell lysis reagent, genomic DNA is released; (2) The genomic DNA is digested with enzymes to obtain DNA fragments; (3) Connect the amplification adapter sequence to both ends of the DNA fragment; (4) PCR amplification was performed using fixed primers complementary to the amplification adapter sequence to construct a sequencing library; Steps (1) through (4) are completed in the same reaction tube; In step (1), the lysis reagents include lysis buffer, proteinase K, and nuclease-free water; In step (2), the enzyme digestion reagents include endonuclease, endonuclease buffer, Taq DNA polymerase, dATP, and nuclease-free water; In step (3), the ligation reagents include T4 DNA ligase, ATP, amplification adapters, and nuclease-free water; In step (4), the nucleotide sequence of the immobilized primer is shown in SEQ ID NO.1-2.
2. The method as described in claim 1, characterized in that, In step (1), the lysis includes: adding 2-3 μL of nuclease-free water and 5-10 μL of lysis reagent to the sample, treating it at 55°C for 10 min, and then treating it at 80°C for 5 min; The volume ratio of lysis buffer, proteinase K, and nuclease-free water in the lysis reagent is 7:7:
26.
3. The method as described in claim 1, characterized in that, In step (2), the enzyme digestion includes: adding 5-10 μL of enzyme digestion reagent to the system, shaking it evenly, then treating it at 37°C for 10 min, and then treating it at 72°C for 20 min; The volume ratio of the restriction enzyme, restriction enzyme buffer, Taq DNA polymerase, dATP, and nuclease-free water in the enzyme digestion reagent is 5:20:1:8:
26.
4. The method as described in claim 1, characterized in that, In step (3), the ligation involves adding 5-6 μL of ligation reagent to the system, shaking it until homogeneous, and then treating it at 22°C for 30-35 min. The volume ratio of T4 DNA ligase, ATP, amplification adapter, and nuclease-free water in the ligation reagent is 2:1:4:
3.
5. The method as described in claim 1, characterized in that, In step (4), the PCR amplification includes: adding 10-15 μL of amplification library preparation reagent and 4 μL of immobilization primer, shaking well, and then performing amplification; the amplification program is: 98℃ for 2 min; 98℃ for 20 s, 60℃ for 30 s, 72℃ for 1 min, 18 cycles; 72℃ for 5 min; and storing at 4℃. The amplification library preparation reagents include amplification buffer, dNTP Mix, amplification polymerase, and nuclease-free water in a volume ratio of 40:4:4:7.
Citation Information
Patent Citations
Rapid single cell library building method
CN114350748A