A normal-temperature stable sample DNA storage solution and a preparation method thereof
By innovatively combining compound surfactants and enzymatic hydrolysis aids with a nucleic acid protection system, the problems of long-term stable preservation of fecal sample DNA at room temperature and efficient lysis of Gram-negative bacteria have been solved, achieving long-term stability and integrity of DNA and providing reliable samples for molecular biology detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies struggle to stably preserve fecal sample DNA at room temperature for extended periods, efficiently lyse Gram-negative bacteria while maintaining DNA integrity, and traditional lysozyme Lyso-V suffers from low extraction efficiency, significant activity loss, and insufficient purity.
An innovative combination of composite surfactants and enzymatic hydrolysis aids is employed, along with a nucleic acid protection system and a buffering and stabilizing system. This system includes components such as polyether polyol fatty acid esters, cocamidopropyl hydroxysulfonate betaine, lysozyme Lyso-V, nitrogen heterocyclic polyamine-carboxylic acid derivatives, and dextran sulfate esters. Through precise concentration ratio design and optimized extraction methods, a multi-dimensional protection and lysis mechanism is formed.
This technology enables the long-term stable preservation of fecal sample DNA at room temperature for two years, efficiently lyses Gram-negative bacteria while maintaining DNA integrity, provides high-quality nucleic acid templates for subsequent molecular biological detection, and improves the accuracy and reliability of test results.
Smart Images

Figure CN121380292B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological sample preservation technology, and in particular to a preservation solution for stable preservation of sample DNA at room temperature and its preparation method. Background Technology
[0002] Fecal samples contain rich microbial information, which is of great significance for studying the structure and function of the gut microbiota and for the diagnosis of related diseases. Stable preservation of DNA is a crucial step in the analysis of fecal samples. However, many problems currently exist in this field.
[0003] On the one hand, fecal samples have a complex composition, rich in various enzymes, microbial metabolites, and metal ions, which can easily lead to DNA degradation at room temperature. While existing preservation methods, such as cryopreservation, can delay DNA degradation to some extent, they suffer from high costs and inconvenient transportation, making it difficult to meet the needs of large-scale and convenient testing.
[0004] On the other hand, during the lysis of Gram-negative bacteria to release DNA, existing preservation solutions and lysis methods often fail to achieve efficient lysis while fully preserving the integrity of nucleic acids. Common lysis agents, such as single surfactants or traditional acid-base reagents, either have low lysis efficiency or cause irreversible damage to nucleic acids, affecting the accuracy of subsequent molecular biological detection results. Furthermore, most existing patented products are relatively simple in composition and mechanism of action, failing to comprehensively and effectively address the complex characteristics of fecal samples. Therefore, there is an urgent practical need to develop a novel fecal sample DNA preservation solution that can achieve long-term stable preservation of DNA at room temperature, efficiently lyse Gram-negative bacteria, and ensure nucleic acid integrity. Summary of the Invention
[0005] To address the existing technical problems of lacking a preservation solution specifically designed for the long-term stable preservation of fecal sample DNA at room temperature, and the inability of existing sample DNA preservation solutions to simultaneously lyse Gram-negative bacteria in fecal samples and ensure DNA integrity, and to solve the technical problems of low extraction efficiency, significant activity loss, and insufficient purity of lysozyme Lyso-V derived from Bacillus subtilis (strain number BNCC109047), this invention aims to provide a preservation solution for the stable preservation of sample DNA at room temperature and its preparation method.
[0006] The technical solution of the present invention is as follows:
[0007] A preservation solution for stabilizing sample DNA at room temperature, characterized in that it comprises: a lysis system, a nucleic acid protection system, and a buffer and stabilization system;
[0008] The pyrolysis system includes a complex surfactant and an enzymatic hydrolysis aid;
[0009] The composite surfactants include: polyether polyol fatty acid esters and cocamidopropyl hydroxysulfonate betaine;
[0010] Enzymatic hydrolysis aids include lysozyme Lyso-V and proteinase K;
[0011] The nucleic acid protection system includes: nitrogen-containing heterocyclic polyamine-carboxylic acid derivatives and dextran sulfate esters;
[0012] Nitrogen heterocyclic polyamine-carboxylic acid derivatives include: 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-nitrocyclic derivatives, and diethylenetriaminepentaacetic acid-piperazine derivatives;
[0013] Buffering and stabilizing systems include: amphoteric buffers and polymeric stabilizers;
[0014] Amphoteric buffers include: 2-(N-morpholino)ethanesulfonic acid and N-tris(hydroxymethyl)methylglycine;
[0015] Polymer stabilizers include: polyvinyl alcohol.
[0016] The composite surfactant includes: 0.6~1.0 g / L polyether polyol fatty acid ester and 0.4~0.8 g / L cocamidopropyl hydroxysulfonate betaine;
[0017] Preferably, the lysozyme Lyso-V is extracted from Bacillus subtilis strain number BNCC109047. Bacillus subtilis Lyso-V, a lysozyme;
[0018] Preferably, the final concentration of lysozyme Lyso-V in the preservation solution is 0.1~0.3 g / L;
[0019] Preferably, the final concentration of proteinase K in the preservation solution is 0.05~0.15 g / L.
[0020] The mass ratio of 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-azacycloderivative, and diethylenetriaminepentaacetic acid-piperazine derivative in the azacyclopolyamine-carboxylic acid derivative is 2:2:3:3;
[0021] Preferably, the final concentration of the nitrogen-containing heterocyclic polyamine-carboxylic acid derivative in the preservation solution is 0.08~0.12 g / L;
[0022] Preferably, the final concentration of dextran sulfate in the preservation solution is 2-3 g / L.
[0023] The final concentration of 2-(N-morpholino)ethanesulfonic acid in the preservation solution was 8-12 mmol / L; the final concentration of N-tris(hydroxymethyl)methylglycine in the preservation solution was 6-10 mmol / L; and the final concentration of polyvinyl alcohol in the preservation solution was 1.0-1.5 g / L.
[0024] The sample is a fecal sample; the room temperature refers to 25±2℃.
[0025] The method for preparing a preservation solution for stabilizing sample DNA at room temperature involves sequentially adding a lysis system, a nucleic acid protection system, and a buffer and stabilization system to deionized water.
[0026] Polyether polyol fatty acid esters are obtained by esterification of polyether polyols with fatty acids;
[0027] Preferably, the polyether polyol is selected from: polyethylene oxide-propylene oxide block diol, polytetrahydrofuran diol, and polypropylene oxide triol;
[0028] Preferably, the fatty acid is selected from: lauric acid, myristic acid, linoleic acid, and oleic acid;
[0029] Preferably, the esterification reaction includes: feeding polyether polyol hydroxyl groups and fatty acid carboxyl groups at a molar ratio of 1:1.05-1.2, refluxing at 120-130℃ for 1 hour, then heating to 150-160℃ and holding for 4-6 hours, and then removing excess fatty acids and residual toluene under a vacuum of 0.08-0.09 MPa to obtain a reaction solution, and then performing post-treatment on the reaction solution;
[0030] Preferably, the molar ratio of the hydroxyl groups to the carboxyl groups of the polyether polyol is 1:1.05-1.2;
[0031] Preferably, the post-treatment refers to: cooling the reaction solution to 80°C, washing it with a 5% sodium carbonate aqueous solution until neutral, drying it with anhydrous magnesium sulfate, and then filtering it;
[0032] Preferably, the extraction method of the lysozyme Lyso-V includes the following steps:
[0033] S1. After the bacterial cells in the fermentation broth were precipitated, they were crushed and centrifuged under ultrasonic conditions of 300W power, 3s working time, 5s intermittent time, and a total duration of 30min to obtain crude enzyme solution.
[0034] S2. The crude enzyme solution was subjected to DEAE-52 ion exchange chromatography and Sephadex G-75 gel filtration chromatography to obtain lysozyme Lyso-V.
[0035] Preferably, S0 is performed before S1. The strain Bacillus subtilis (strain number BNCC109047) is used. Bacillus subtilis The seed culture was inoculated into a fermentation medium containing 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L glucose, and pH 7.2, and fermented at 37°C and 200 r / min for 48 h.
[0036] Preferably, in S0, the seed liquid is obtained through the following steps: preserving Bacillus subtilis strain number BNCC109047 (… Bacillus subtilis Inoculate onto LB solid medium and incubate at 37°C for 18-24 hours to activate; pick a single colony and inoculate onto LB liquid medium, incubate at 37°C with shaking at 180 rpm for 24 hours.
[0037] Preferably, in S1, the bacterial fermentation broth is centrifuged at 8000 r / min and 4℃ for 15 min to obtain bacterial precipitate;
[0038] Preferably, the bacterial cell pellet is washed twice with PBS buffer at pH 7.0 before being lysed;
[0039] Preferably, in S1, the centrifugation conditions are 12000 r / min and 4℃ for 20 min;
[0040] Preferably, in S2, the elution conditions for DEAE-52 ion exchange chromatography are as follows: using PBS buffer with 0-0.5 mol / L NaCl as the elution solution, and performing gradient elution.
[0041] 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid was synthesized by the following method: using 1,4,7,10-tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide as reactants, and deionized water as solvent, the reaction was carried out at 55-65℃ for 10-12h to obtain a reaction solution, which was then post-treated.
[0042] Preferably, the molar ratio of 1,4,7,10-tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide is 1:4.2:4.5;
[0043] Preferably, the order of adding the reaction raw materials is as follows: first, 1,4,7,10-tetraazacyclododecane is dissolved in an aqueous sodium hydroxide solution at pH 10-11, and then sodium chloroacetate is added in batches;
[0044] Preferably, the solid-liquid ratio of the reactants to the solvent is 1:5-1:8;
[0045] Preferably, the post-treatment refers to: adjusting the pH of the reaction solution to 2-3 with hydrochloric acid, precipitating the solid, filtering, recrystallizing twice with deionized water, and drying to obtain pure DOTA;
[0046] Preferably, 1,4,7-triazacyclononane-N,N',N''-triacetic acid is synthesized by the following method: using 1,4,7-triazacyclononane and chloroacetic acid as reactants, the reaction is stirred at 45-55°C for 8-10 h to obtain a reaction solution, and then the reaction solution is post-treated.
[0047] Preferably, the molar ratio of 1,4,7-triazacyclononane to chloroacetic acid is 1:3.1~3.3;
[0048] Preferably, the pH of the reaction is adjusted to be maintained at pH 9-10 using sodium carbonate;
[0049] Preferably, the post-treatment refers to: concentrating the reaction solution to 1 / 3 of its original volume, acidifying it with hydrochloric acid to pH 2-3, cooling to crystallize, and filtering and drying.
[0050] The disodium ethylenediaminetetraacetate-azo heterocyclic derivative was synthesized by the following method: using EDTA dianhydride and piperazine as reactants and N,N-dimethylformamide as solvent, the reaction was carried out at 80-90℃ under nitrogen protection for 6-8 hours to obtain a reaction solution, which was then post-treated.
[0051] Preferably, the molar ratio of EDTA dianhydride to piperazine is 1:1;
[0052] Preferably, the mass ratio of solvent to reactants is 2-3:1;
[0053] Preferably, the post-treatment refers to: after the reaction solution is cooled, it is poured into ice water to precipitate the solid, filtered, washed twice with ethanol, and vacuum dried at 60°C for 4 hours;
[0054] The diethylenetriaminepentaacetic acid-piperazine derivative was synthesized by the following method: using DTPA anhydride and N-methylpiperazine as reactants and anhydrous ethanol as solvent, the reaction was refluxed at 70-80℃ for 5-7 h to obtain a reaction solution, which was then post-treated.
[0055] Preferably, the amount of solvent used is 3-4 times the total mass of DTPA anhydride and N-methylpiperazine;
[0056] Preferably, the molar ratio of DTPA anhydride to N-methylpiperazine is 1:1.05;
[0057] Preferably, the mass ratio of the solvent to the reactants is 3-4:1;
[0058] Preferably, the post-processing refers to: distilling to recover ethanol, recrystallizing the residue with ethyl acetate, and filtering and drying.
[0059] The CAS number for 2-(N-morpholino)ethanesulfonic acid is 145224-94-8; the CAS number for N-tris(hydroxymethyl)methylglycine is 5704-04-1.
[0060] After adding to deionized water, stir at 30-35℃ until dissolved and clear, then bring to the target volume with deionized water.
[0061] The beneficial effects of this invention are as follows:
[0062] This invention provides a fecal sample DNA preservation solution that can stably preserve DNA in fecal samples for up to two years at room temperature. It effectively lyses Gram-negative bacteria and releases their DNA while ensuring the integrity of nucleic acids, providing reliable samples for subsequent precise molecular biological testing. The sample DNA preservation solution of this invention achieves the following beneficial effects:
[0063] 1. Long-term DNA stability: Through the synergistic effect of a novel antioxidant chelating agent (AHPCD) and a saccharide polymer protectant (DS), combined with a well-defined concentration ratio, the degradation of DNA by various adverse factors in fecal samples is effectively resisted, enabling stable preservation of DNA at room temperature for up to two years. This greatly extends the shelf life of the samples and reduces the cost and complexity of sample processing.
[0064] 2. Highly Efficient Lysis and Guaranteed Nucleic Acid Integrity: The innovative combination and quantitative ratio design of the composite surfactants (PEFA and CAPHSB) and enzymatic hydrolysis aids (Lyso-V and Proteinase K) significantly improves the lysis efficiency against Gram-negative bacteria. Simultaneously, due to the low-damage characteristics of each component to nucleic acids and the synergistic ratio control, the integrity of the released DNA is fully guaranteed while efficiently lysing bacteria. This provides high-quality nucleic acid templates for subsequent molecular biology assays such as PCR amplification and next-generation sequencing, improving the accuracy and reliability of the test results.
[0065] 3. Unique composition and mechanism of action: Compared with existing patented products, the preservation solution of this invention clearly defines the specific raw materials of PEFA, the preparation method of Lyso-V, the specific types of AHPCD and the chemical parameters of DS. Combined with the synergistic ratio of key components, it forms a unique multi-dimensional mechanism of action from lysing bacteria to protecting nucleic acids. It is more adaptable to the complex characteristics of fecal samples and outperforms similar products on the market.
[0066] Meanwhile, the innovative extraction method of lysozyme Lyso-V, one of the enzymatic hydrolysis aids in the DNA preservation solution of the present invention, is significantly superior to the traditional Lyso-V extraction method in key indicators such as enzyme expression level, purity, and recovery rate, and has stronger batch stability, making it suitable for large-scale preparation. Attached Figure Description
[0067] Figure 1The amplification curves of sample DNA by real-time PCR in the experimental group of Experiment Example 3 of the present invention under storage conditions of 0 months (left figure) and 24 months (right figure) are shown.
[0068] Figure 2 The amplification curves of sample DNA in control group 1 of Experimental Example 3 of the present invention are obtained by real-time PCR under storage conditions of 0 months (left figure) and 24 months (right figure).
[0069] Figure 3 The amplification curves of sample DNA in control group 2 of Experimental Example 3 of the present invention are obtained by real-time PCR under storage conditions of 0 months (left figure) and 24 months (right figure).
[0070] Figure 4 The amplification curves of sample DNA in the control group 3 of Experimental Example 3 of the present invention are obtained by real-time PCR under the storage conditions of 0 months (left figure) and 24 months (right figure).
[0071] Figure 5 The amplification curves of sample DNA in the control group 4 of Experimental Example 3 of the present invention are shown by real-time PCR of the DNA in the storage state of 0 months (left figure) and 24 months (right figure). Detailed Implementation
[0072] The present invention will be further described in detail below with reference to specific embodiments and experimental examples. Those skilled in the art should understand that the experimental examples are only for the purpose of helping to understand the present invention and should not be regarded as specific limitations on the scope of protection of the present invention.
[0073] biomaterial sources
[0074] The strain Bacillus subtilis with strain number BNCC109047 used in Experiment Example 1 ( Bacillus subtilis Available for commercial purchase.
[0075] Group 1 Examples, DNA Preservation Solution of the Present Invention
[0076] This set of embodiments provides a preservation solution for stabilizing sample DNA at room temperature. All embodiments in this set share the following common feature: the preservation solution comprises: a lysis system, a nucleic acid protection system, and a buffer and stabilization system;
[0077] The pyrolysis system includes a complex surfactant and an enzymatic hydrolysis aid;
[0078] The composite surfactants include: polyether polyol fatty acid esters and cocamidopropyl hydroxysulfonate betaine;
[0079] Enzymatic hydrolysis aids include lysozyme Lyso-V and proteinase K;
[0080] The nucleic acid protection system includes: nitrogen-containing heterocyclic polyamine-carboxylic acid derivatives and dextran sulfate esters;
[0081] Nitrogen heterocyclic polyamine-carboxylic acid derivatives include: 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-nitrocyclic derivatives, and diethylenetriaminepentaacetic acid-piperazine derivatives;
[0082] Buffering and stabilizing systems include: amphoteric buffers and polymeric stabilizers;
[0083] Amphoteric buffers include: 2-(N-morpholino)ethanesulfonic acid and N-tris(hydroxymethyl)methylglycine;
[0084] Polymer stabilizers include: polyvinyl alcohol.
[0085] In some embodiments, the composite surfactant comprises: 0.6~1.0 g / L polyether polyol fatty acid ester and 0.4~0.8 g / L cocamidopropyl hydroxysulfonate;
[0086] Preferably, the lysozyme Lyso-V is extracted from Bacillus subtilis strain number BNCC109047. Bacillus subtilis Lyso-V, a lysozyme;
[0087] Preferably, the final concentration of lysozyme Lyso-V in the preservation solution is 0.1~0.3 g / L;
[0088] Preferably, the final concentration of proteinase K in the preservation solution is 0.05~0.15 g / L.
[0089] In other embodiments, the mass ratio of 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-azacyclo derivative, and diethylenetriaminepentaacetic acid-piperazine derivative in the azacyclopolyamine-carboxylic acid derivative is 2:2:3:3;
[0090] Preferably, the final concentration of the nitrogen-containing heterocyclic polyamine-carboxylic acid derivative in the preservation solution is 0.08~0.12 g / L;
[0091] Preferably, the final concentration of dextran sulfate in the preservation solution is 2-3 g / L.
[0092] In specific embodiments, the final concentration of 2-(N-morpholino)ethanesulfonic acid in the preservation solution is 8~12 mmol / L; the final concentration of N-tris(hydroxymethyl)methylglycine in the preservation solution is 6~10 mmol / L; and the final concentration of polyvinyl alcohol in the preservation solution is 1.0~1.5 g / L.
[0093] In a more specific embodiment, the sample is a fecal sample; the room temperature refers to 25±2℃.
[0094] The following table 1 shows the partition ratios (unit: g / L) and performance data of the DNA preservation solutions provided in some specific examples of this group:
[0095] Table 1
[0096]
[0097] For each DNA preservation solution corresponding to each number in Table 1 above, three replicates of fecal samples from the same source were prepared. The 16S Ct value and A value were measured after 24 months. 260 / A 280 The ratios are all the average of three replicates. 16S Ct values and A 260 / A 280 The method for detecting the ratio is shown in Experiment Example 3 below.
[0098] Group 2 Examples: Preparation Method of DNA Preservation Solution of the Present Invention
[0099] This set of embodiments provides a method for preparing a preservation solution for stabilizing sample DNA at room temperature, as described in any of the embodiments in Group 1. All embodiments in this set share the following common feature: the lysis system, nucleic acid protection system, buffer and stabilization system are sequentially added to deionized water.
[0100] In some embodiments, the polyether polyol fatty acid ester is obtained by esterification of polyether polyol and fatty acid;
[0101] Preferably, the polyether polyol is selected from: polyethylene oxide-propylene oxide block diol, polytetrahydrofuran diol, and polypropylene oxide triol;
[0102] Preferably, the fatty acid is selected from: lauric acid, myristic acid, linoleic acid, and oleic acid;
[0103] Preferably, the esterification reaction includes: feeding polyether polyol hydroxyl groups and fatty acid carboxyl groups at a molar ratio of 1:1.05-1.2, refluxing at 120-130℃ for 1 hour, then heating to 150-160℃ and holding for 4-6 hours, and then removing excess fatty acids and residual toluene under a vacuum of 0.08-0.09 MPa to obtain a reaction solution, and then performing post-treatment on the reaction solution;
[0104] Preferably, the molar ratio of the hydroxyl groups to the carboxyl groups of the polyether polyol is 1:1.05-1.2;
[0105] Preferably, the post-treatment refers to: cooling the reaction solution to 80°C, washing it with a 5% sodium carbonate aqueous solution until neutral, drying it with anhydrous magnesium sulfate, and then filtering it;
[0106] Preferably, the extraction method of the lysozyme Lyso-V includes the following steps:
[0107] S1. After the bacterial cells in the fermentation broth were precipitated, they were crushed and centrifuged under ultrasonic conditions of 300W power, 3s working time, 5s intermittent time, and a total duration of 30min to obtain crude enzyme solution.
[0108] S2. The crude enzyme solution was subjected to DEAE-52 ion exchange chromatography and Sephadex G-75 gel filtration chromatography to obtain lysozyme Lyso-V.
[0109] Preferably, S0 is performed before S1. The strain Bacillus subtilis (strain number BNCC109047) is used. Bacillus subtilis The seed culture was inoculated into a fermentation medium containing 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L glucose, and pH 7.2, and fermented at 37°C and 200 r / min for 48 h.
[0110] Preferably, in S0, the seed liquid is obtained through the following steps: preserving Bacillus subtilis strain number BNCC109047 (… Bacillus subtilis Inoculate onto LB solid medium and incubate at 37°C for 18-24 hours to activate; pick a single colony and inoculate onto LB liquid medium, incubate at 37°C with shaking at 180 rpm for 24 hours.
[0111] Preferably, in S1, the bacterial fermentation broth is centrifuged at 8000 r / min and 4℃ for 15 min to obtain bacterial precipitate;
[0112] Preferably, the bacterial cell pellet is washed twice with PBS buffer at pH 7.0 before being lysed;
[0113] Preferably, in S1, the centrifugation conditions are 12000 r / min and 4℃ for 20 min;
[0114] Preferably, in S2, the elution conditions for DEAE-52 ion exchange chromatography are as follows: using PBS buffer with 0-0.5 mol / L NaCl as the elution solution, and performing gradient elution.
[0115] This set of examples addresses the industry pain points of low extraction efficiency, significant activity loss, and insufficient purity of lysozyme Lyso-V from Bacillus subtilis (strain number BNCC109047). Based on traditional extraction processes, three key innovations are achieved, as follows:
[0116] I. Fermentation Medium Optimization: Precise control of carbon source supply significantly improves enzyme expression, solving the following pain points of existing technologies: Traditional lysozyme fermentation often uses basic LB medium (10g / L peptone, 5g / L yeast extract, 10g / L NaCl, pH 7.2). This formula can only meet the basic metabolic needs of the strain, and has two major problems:
[0117] (i) Carbon source deficiency leads to enzyme production stagnation in the later stage of fermentation: After the logarithmic growth phase of Bacillus subtilis for 48 hours of fermentation, it will enter the stationary phase due to carbon source depletion, and the enzyme synthesis efficiency will drop sharply, with the final Lyso-V expression level being only 600-700 U / mL.
[0118] (ii) Nutritional imbalance leads to insufficient bacterial activity: When a specific carbon source is lacking, the strain will preferentially consume its own reserves to maintain survival rather than synthesize the target enzyme, and is prone to producing miscellaneous proteins (such as proteases), which increases the difficulty of subsequent purification.
[0119] The optimized solution of this invention is to precisely add 2 g / L glucose to the basic LB medium to form a synergistic nutritional system of "peptone-yeast extract-glucose". The specific design logic is as follows:
[0120] Carbon source dosage control: 2 g / L glucose avoids premature carbon source depletion caused by low dose (<1 g / L) and prevents the increase in culture medium osmotic pressure caused by high dose (>3 g / L) (osmotic pressure >300 mOsm / kg will inhibit cell growth).
[0121] Nutritional release matching: Glucose, as a fast-acting carbon source, can form a "step-by-step nutrient supply" with peptone (a slow-acting nitrogen source) and yeast extract (growth factor) - in the early stage, glucose provides rapid energy to promote cell proliferation, and in the later stage, peptone slowly decomposes to provide nitrogen source to support enzyme synthesis, ensuring that enzyme synthesis continues throughout the 48-hour fermentation cycle.
[0122] pH stability regulation: The small amount of organic acids produced by glucose metabolism can be buffered by NaCl in the culture medium to maintain a stable pH of 7.0-7.2 (the optimal pH range for Lyso-V synthesis), avoiding pH fluctuations (±0.5) caused by metabolic imbalance in traditional glucose-free cultured bacteria.
[0123] II. Ultrasonic Parameter Control: Precisely balancing cell disruption rate and enzyme activity protection, solving the following pain points of existing technologies: Bacillus subtilis has a relatively thick cell wall (including a peptidoglycan layer approximately 20-40 nm thick), and traditional ultrasonic disruption processes suffer from the dilemma of "insufficient disruption" or "significant loss of enzyme activity":
[0124] (a) Low power / short time disruption: For example, continuous ultrasonication at 200W power for 20 minutes results in a cell disruption rate of only 70%, a low crude enzyme yield (only 0.22g / L), and a large amount of enzyme protein remaining in the unbroken cells;
[0125] (ii) High power / long duration of crushing: For example, continuous ultrasonication at 400W power for 40 minutes can achieve a crushing rate of 95%, but the local high temperature (>45℃) and mechanical shear force generated during the ultrasonication process will cause Lyso-V denaturation, resulting in an activity loss of 15%-20% (enzyme activity drops from 1000U / mg to below 800U / mg).
[0126] The optimized solution of this invention adopts a precise combination of ultrasonic parameters: "300W power + 3s working / 5s intermittent + total duration of 30min". The core design logic is as follows:
[0127] Power matching bacterial cell characteristics: 300W power is the "critical disruption power" of Bacillus subtilis cell wall - it can destroy the peptidoglycan structure of cell wall through mechanical vibration, but will not tear the spatial structure of enzyme protein due to strong shear force caused by excessive power (Lyso-V's secondary structure is mainly α-helix, and strong shear force can easily cause the helix to unwind).
[0128] Temperature control during intermittent time: After 3 seconds of operation, a 5-second interval is set to utilize the interval for heat dissipation (with the assistance of an ice bath, the temperature of the broken system is maintained at ≤4℃), avoiding the temperature accumulation caused by traditional continuous ultrasound (temperature rises by 5-8℃ every 10 minutes), thus reducing thermal denaturation from the source;
[0129] Total time optimization yield: 30 minutes is the balance point between "breakage rate and activity loss" - the breakage rate increases from 0 to 90% in the first 20 minutes, and only increases by 5% (to 95%) in the last 10 minutes. Continuing to extend the time will lead to a sharp increase in activity loss. Therefore, 30 minutes is chosen to achieve "high breakage rate + low activity loss".
[0130] III. Dual-layer chromatography purification combination: Stepwise removal of different types of impurities achieves a balance between high purity and high recovery rate, solving the following pain points of existing technologies: Traditional lysozyme purification often uses a single chromatography process, which is difficult to remove "charged proteins" and "impurities of different molecular weights" simultaneously, resulting in two major limitations:
[0131] (a) Single ion exchange chromatography (e.g., DEAE-52): It can only remove negatively charged proteins (e.g., proteases, nucleases) by charge difference, but it cannot separate impurities with similar charges to Lyso-V but different molecular weights (e.g., 12kDa subtilisin, 18kDa amylase), and the final purity is only 70%-75%;
[0132] (ii) Single gel filtration chromatography (such as Sephadex G-75): Although it can separate impurities by molecular weight difference, it cannot remove charged proteins with molecular weight close to Lyso-V (14-16k Da), and the sample loading is low (only 5mL crude enzyme solution / column), with a recovery rate of only 60%-65%, which is not suitable for large-scale preparation.
[0133] The optimized solution of this invention adopts a dual-chromatographic combination process of "DEAE-52 anion exchange chromatography → Sephadex G-75 gel filtration chromatography" to solve the problem of different types of impurities step by step. The specific process and design logic are as follows:
[0134] Step 1: DEAE-52 anion exchange chromatography (to remove charged proteins)
[0135] Chromatographic conditions:
[0136] Chromatography column specifications: Φ2.6×30cm, packing volume 160mL;
[0137] Equilibration solution: 0.02 mol / L PBS buffer (containing 0.1 mol / L NaCl) at pH 7.0;
[0138] Elution buffer: PBS buffer with 0-0.5 mol / L NaCl (gradient elution, elution time 60 min);
[0139] Sample loading volume: 5 mL DEAE-52 flow-through solution (after concentration, the enzyme protein concentration reaches 1.0 g / L).
[0140] Separation principle: Lyso-V has an isoelectric point (pI) of approximately 10.0, and is positively charged in a pH 7.0 buffer solution. It does not bind to DEAE-52 (a positively charged anion exchanger) and is collected directly with the flow-through solution. In contrast, contaminating proteins (such as proteases with pI=5.5 and nucleases with pI=6.2) are negatively charged and bind to DEAE-52. They are subsequently removed by elution with a high concentration of NaCl.
[0141] Step 2: Sephadex G-75 gel filtration chromatography (to remove impurities of different molecular weights)
[0142] Chromatographic conditions:
[0143] Chromatography column specifications: Φ1.6×100cm, packing volume 200mL;
[0144] Elution buffer: 0.02 mol / L PBS buffer (containing 0.15 mol / L NaCl) at pH 7.0;
[0145] Flow rate: 0.5 mL / min;
[0146] Sample loading volume: 5 mL DEAE-52 flow-through solution (after concentration, the enzyme protein concentration reaches 1.0 g / L).
[0147] Separation principle: Sephadex G-75 has a fractionation range of 3-80 kDa. Lyso-V has a molecular weight of about 15 kDa and can enter the interior of the gel particles, resulting in a large elution volume (about 80 mL). Impurities with a molecular weight >30 kDa (such as unbroken bacterial fragments and polymeric proteins) cannot enter the gel particles, resulting in a small elution volume (about 40 mL). Impurities with a molecular weight <10 kDa (such as small peptides and salts) can penetrate deep into the gel particles, resulting in a large elution volume (about 120 mL). The separation of Lyso-V and impurities is achieved through the difference in elution volume.
[0148] In some embodiments, the cocamidopropyl hydroxysulfonyl betaine is commercially available or can be prepared by the following steps:
[0149] S1: Coconut acid and N,N-dimethylpropanediamine are fed in a molar ratio of 1:1.1-1.2 to undergo an amidation reaction to obtain cocamidopropyl dimethylamine;
[0150] S2: Cocamidopropyl dimethylamine and sodium 3-chloro-2-hydroxypropanesulfonate are fed in a molar ratio of 1:1.05-1.1 to carry out a quaternization reaction;
[0151] In a further embodiment, the amidation reaction includes: reacting at 140-150℃ under nitrogen protection for 3-4 hours, and stopping when the acid value of the reaction system is ≤5mgKOH / g;
[0152] In some embodiments, the conditions for the quaternization reaction include: temperature: 65-75℃, pH controlled at 8.5-9.0, stirring rate 200-300 r / min, reaction time: 5-6 h, followed by post-treatment;
[0153] In a specific embodiment, the pH is adjusted with sodium hydroxide; the post-treatment includes: cooling the reaction solution to room temperature, decolorizing with activated carbon (0.5%-1%), and filtering.
[0154] In a preferred embodiment, the fermentation medium comprises: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L glucose, and pH 7.2.
[0155] In a specific embodiment, the conditions for ultrasonic fragmentation are: power 300W, working time 3s, interval 5s, total duration 30min.
[0156] In a preferred embodiment, the conditions for the DEAE-52 ion exchange chromatography are as follows: the eluent is PBS buffer containing 0-0.5 mol / L NaCl, and gradient elution is performed.
[0157] In a specific embodiment, the conditions for determining enzyme activity by turbidimetric assay are as follows: using Micrococcus lysate as substrate, a decrease of 0.01 / min in the OD450nm value at 37°C is considered as one activity unit.
[0158] In some embodiments, 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid is synthesized by the following method: using 1,4,7,10-tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide as reactants, and deionized water as solvent, the reaction is carried out at 55-65°C for 10-12 hours to obtain a reaction solution, which is then post-treated.
[0159] Preferably, the molar ratio of 1,4,7,10-tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide is 1:4.2:4.5;
[0160] Preferably, the order of adding the reaction raw materials is as follows: first, 1,4,7,10-tetraazacyclododecane is dissolved in an aqueous sodium hydroxide solution at pH 10-11, and then sodium chloroacetate is added in batches;
[0161] Preferably, the solid-liquid ratio of the reactants to the solvent is 1:5-1:8;
[0162] Preferably, the post-treatment refers to: adjusting the pH of the reaction solution to 2-3 with hydrochloric acid, precipitating the solid, filtering, recrystallizing twice with deionized water, and drying to obtain pure DOTA;
[0163] Preferably, 1,4,7-triazacyclononane-N,N',N''-triacetic acid is synthesized by the following method: using 1,4,7-triazacyclononane and chloroacetic acid as reactants, the reaction is stirred at 45-55°C for 8-10 h to obtain a reaction solution, and then the reaction solution is post-treated.
[0164] Preferably, the molar ratio of 1,4,7-triazacyclononane to chloroacetic acid is 1:3.1~3.3;
[0165] Preferably, the pH of the reaction is adjusted to be maintained at pH 9-10 using sodium carbonate;
[0166] Preferably, the post-treatment refers to: concentrating the reaction solution to 1 / 3 of its original volume, acidifying it with hydrochloric acid to pH 2-3, cooling to crystallize, and filtering and drying.
[0167] The disodium ethylenediaminetetraacetate-azo heterocyclic derivative was synthesized by the following method: using EDTA dianhydride and piperazine as reactants and N,N-dimethylformamide as solvent, the reaction was carried out at 80-90℃ under nitrogen protection for 6-8 hours to obtain a reaction solution, which was then post-treated.
[0168] Preferably, the molar ratio of EDTA dianhydride to piperazine is 1:1;
[0169] Preferably, the mass ratio of solvent to reactants is 2-3:1;
[0170] Preferably, the post-treatment refers to: after the reaction solution is cooled, it is poured into ice water to precipitate the solid, filtered, washed twice with ethanol, and vacuum dried at 60°C for 4 hours;
[0171] The diethylenetriaminepentaacetic acid-piperazine derivative was synthesized by the following method: using DTPA anhydride and N-methylpiperazine as reactants and anhydrous ethanol as solvent, the reaction was refluxed at 70-80℃ for 5-7 h to obtain a reaction solution, which was then post-treated.
[0172] Preferably, the amount of solvent used is 3-4 times the total mass of DTPA anhydride and N-methylpiperazine;
[0173] Preferably, the molar ratio of DTPA anhydride to N-methylpiperazine is 1:1.05;
[0174] Preferably, the mass ratio of the solvent to the reactants is 3-4:1;
[0175] Preferably, the post-processing refers to: distilling to recover ethanol, recrystallizing the residue with ethyl acetate, and filtering and drying.
[0176] In a specific embodiment, the CAS number of 2-(N-morpholino)ethanesulfonic acid is 145224-94-8; and the CAS number of N-tris(hydroxymethyl)methylglycine is 5704-04-1.
[0177] In other embodiments, after adding to deionized water, the mixture is stirred at 30-35°C until it becomes clear, and then diluted to the target volume with deionized water.
[0178] The specific performance of the DNA preservation solution of the present invention will be verified through experimental examples below.
[0179] Experimental Example 1: Detailed Description of the DNA Preservation Solution and its Components of the Invention
[0180] I. Pyrolysis System:
[0181] The composite surfactant consists of 0.6-1.0 g / L of a novel nonionic surfactant, polyether polyol fatty acid ester (PEFA), and 0.4-0.8 g / L of an amphoteric surfactant, cocamidopropyl hydroxysulfonate betaine (CAPHSB). PEFA has a unique molecular structure; its lipophilic end can penetrate deep into the lipid bilayer of the outer membrane of Gram-negative bacteria, disrupting membrane stability. CAPHSB can specifically bind to lipopolysaccharides in the outer membrane, further increasing membrane permeability. The synergistic effect of the two significantly improves the lysis efficiency against Gram-negative bacteria.
[0182] PEFA Synthesis: PEFA is obtained by esterification of the following specific polyether polyols with fatty acids: polyethylene oxide-polypropylene oxide block diol (EO-PO block diol, molecular weight 2000-3000 Da), polytetrahydrofuran diol (PTMG, molecular weight 1000-2000 Da), and polypropylene oxide triol (PPT, molecular weight 1500-2500 Da); the specific fatty acids are lauric acid (dodecanoic acid), myristic acid (tetradecanoic acid), linoleic acid (cis-9,12-octadecadienoic acid), and oleic acid (cis-9-octadecadienoic acid). Toluenesulfonic acid (0.5%-1.0% of the total mass of reactants) is selected as the catalyst, and toluene (volume ratio of reactants 1:1) is selected as the dehydrating agent. During synthesis, the polyether polyol hydroxyl groups and fatty acid carboxyl groups are first fed at a molar ratio of 1:1.05-1.2. The mixture is refluxed at 120-130℃ for 1 hour, then heated to 150-160℃ and held for 4-6 hours. In the later stage, excess fatty acids and residual toluene are removed under a vacuum of 0.08-0.09 MPa. In the post-treatment stage, the reaction solution is cooled to 80℃, washed with 5% sodium carbonate aqueous solution until neutral, dried with anhydrous magnesium sulfate, and filtered to obtain the PEFA product.
[0183] CAPHSB Synthesis: The synthesis is carried out by a two-step method of "amidation + quaternization". Step 1 (amidation): coconut oil acid (purity ≥98%), N,N-dimethylpropanediamine (molar excess 10%-20%); Step 2 (quaternization): product of step 1 (cocamidopropyl dimethylamine), sodium 3-chloro-2-hydroxypropanesulfonate (CHPS, purity ≥99%). Solvent: deionized water (used in the quaternization stage, the amount is 30%-40% of the total mass of the reactants); base adjuster: sodium hydroxide (used to adjust the pH of the quaternization system). Reaction conditions and parameters: (1) Amidation reaction: temperature: 140-150℃, reaction under nitrogen protection for 3-4h. Molar ratio: coconut oil acid: N,N-dimethylpropanediamine = 1:1.1-1.2. Endpoint judgment: stop when the acid value of the reaction system is ≤5mgKOH / g. (2) Quaternization reaction: Temperature: 65-75℃, pH controlled at 8.5-9.0 (adjusted with sodium hydroxide). Molar ratio: cocamidopropyl dimethylamine: CHPS = 1:1.05-1.1. Reaction time: 5-6h, stirring rate 200-300r / min. Post-treatment: The reaction solution is cooled to room temperature, decolorized with activated carbon (0.5%-1%), filtered, and CAPHSB aqueous solution is obtained.
[0184] Enzymatic hydrolysis aids: Lyso-V (0.1-0.3 g / L), a lysozyme extracted from Bacillus subtilis, is used in combination with proteinase K at 0.05-0.15 g / L. Lyso-V not only specifically targets the β-1,4 glycosidic bonds of peptidoglycan in the cell wall of Gram-negative bacteria, but also exhibits higher activity and less potential damage to nucleic acids compared to traditional lysozyme Lyso-V. Proteinase K has high specificity for proteins within Gram-negative bacterial cells, effectively degrading proteins bound to nucleic acids and promoting DNA release. The source of Lyso-V is Bacillus subtilis (…). Extraction method: The source strain is Bacillus subtilis (…). Bacillus subtilis (Strain number BNCC109047); extraction method is as follows:
[0185] Step S1: Strain activation and expansion culture. The preserved Bacillus strain was inoculated onto LB solid medium and cultured at 37°C for 18-24 hours for activation. Single colonies were picked and inoculated onto LB liquid medium, and cultured at 37°C with shaking at 180 rpm for 24 hours to obtain a seed culture. The seed culture was then inoculated at a 5% inoculation rate into fermentation medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L glucose, pH 7.2), and fermented at 37°C with shaking at 200 rpm for 48 hours.
[0186] Step S2: Cell collection and disruption. The fermentation broth was centrifuged at 8000 r / min and 4℃ for 15 min, and the cell pellet was collected. The pellet was washed twice with PBS buffer (pH 7.0), resuspended, and then disrupted by sonication (300W power, 3s operation, 5s interval, total duration 30 min). The disrupted solution was centrifuged at 12000 r / min and 4℃ for 20 min, and the supernatant was collected as the crude enzyme solution.
[0187] Step S3: Purification and Identification. The crude enzyme solution was subjected to DEAE-52 ion exchange chromatography (elution buffer: PBS buffer with 0-0.5 mol / L NaCl, gradient elution) to collect the active components; it was then further purified by Sephadex G-75 gel filtration chromatography to obtain pure Lyso-V; the molecular weight (approximately 15 kDa) was verified by SDS-PAGE electrophoresis, and the enzyme activity was determined by turbidimetric assay (using Micrococcus lysae as substrate, a decrease of 0.01 / min in OD450nm value at 37℃ was considered 1 unit of activity).
[0188] An experimental group (using the Lyso-V extraction method of this invention) and a control group (using the traditional Lyso-V extraction method) were set up, with 3 replicates in each group. The strain source was controlled (all were Bacillus subtilis). Bacillus subtilis (The strain number is BNCC109047), and other irrelevant variables such as the basic culture environment are consistent. The specific parallel experimental procedures are shown in Table 2 below:
[0189] Table 2
[0190]
[0191] (II) The performance comparison data of the Lyso-V extraction method of the present invention and the traditional Lyso-V extraction method in terms of various indicators are shown in Table 3 below:
[0192] Table 3
[0193]
[0194] The above data are the average values of three parallel experiments. Statistical analysis showed that the differences between the groups were significant (P<0.05), indicating that the lysozyme Lyso-V preparation method of the present invention is significantly superior to the traditional method in terms of key indicators such as enzyme expression level, purity, and recovery rate, and has stronger batch stability, making it suitable for large-scale preparation.
[0195] II. Nucleic Acid Protection System:
[0196] A novel antioxidant chelating agent: a synthesized nitrogen-heterocyclic polyamine-carboxylic acid derivative (AHPCD) at a concentration of 0.08-0.12 g / L. In this invention, AHPCD is specifically selected from a mixture of the following four compounds, with a mixing ratio of DOTA:NOTA:EDTA (nitrogen-heterocyclic derivative):DTPA (piperazine derivative) mass ratio = 2:2:3:3 (total concentration 0.08-0.12 g / L). AHPCD possesses multiple chelating sites, enabling it to efficiently bind metal ions (such as Fe) in fecal samples. 3+ Cu 2+ (etc.), preventing it from catalyzing the oxidative hydrolysis of nucleic acids. At the same time, the antioxidant groups in its structure can scavenge free radicals in the sample, reducing the damage of oxidative stress to nucleic acids.
[0197] Synthesis of DOTA (1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid):
[0198] Raw materials: 1,4,7,10-tetraazacyclododecane (Cyclen) (purity ≥97%), sodium chloroacetate (20%-25% molar excess), sodium hydroxide (to adjust alkalinity); 1,4,7,10-tetraazacyclododecane (Cyclen, purity ≥97%), sodium chloroacetate, and sodium hydroxide, in a molar ratio of 1:4.2:4.5, with sodium chloroacetate in 20%-25% molar excess (to ensure complete reaction of Cyclen).
[0199] Solvent: Deionized water (solid-liquid ratio 1:5-1:8)
[0200] Feeding sequence: First, dissolve Cyclen in an aqueous sodium hydroxide solution (pH 10-11), then add sodium chloroacetate in batches.
[0201] Reaction temperature: 55-65℃, keep the reaction at this temperature for 10-12 hours.
[0202] Post-processing: The pH of the reaction solution was adjusted to 2-3 with hydrochloric acid, the solid was precipitated, filtered, recrystallized twice with deionized water, and dried to obtain pure DOTA (purity ≥98%).
[0203] Synthesis of NOTA (1,4,7-triazacyclononane-N,N',N''-triacetic acid):
[0204] Raw materials: 1,4,7-triazacyclononane (purity ≥97%), chloroacetic acid (molar excess 15%-20%)
[0205] Alkali adjuster: Sodium carbonate (to maintain the system pH 9-10)
[0206] Reaction temperature: 45-55℃, stirring for 8-10 hours.
[0207] Molar ratio: 1,4,7-triazacyclononane:chloroacetic acid = 1:3.1-3.3.
[0208] Post-processing: The reaction solution was concentrated to 1 / 3 of its original volume, acidified with hydrochloric acid to pH 2-3, cooled to crystallize, filtered and dried to obtain the NOTA product.
[0209] Synthesis of EDTA-acid heterocyclic derivative (disodium ethylenediaminetetraacetate-acid heterocyclic derivative):
[0210] Raw materials: EDTA dianhydride (purity ≥98%), piperazine (a nitrogen-containing heterocyclic monomer, molar ratio 1:1)
[0211] Solvent: N,N-dimethylformamide (DMF, in an amount of 2-3 times the total mass of EDTA dianhydride and piperazine)
[0212] Reaction temperature: 80-90℃, reaction under nitrogen protection for 6-8 hours.
[0213] Post-processing: After cooling the reaction solution, pour it into ice water to precipitate the solid. After filtration, wash twice with ethanol and dry under vacuum (60℃, 4h) to obtain the product.
[0214] Synthesis of DTPA-piperazine derivatives (diethylenetriaminepentaacetic acid-piperazine derivatives):
[0215] Raw materials: DTPA anhydride (purity ≥98%), N-methylpiperazine (piperazine derivative), with a molar ratio of 1:1.05, wherein N-methylpiperazine is in 5% excess (to ensure complete reaction of DTPA anhydride).
[0216] Solvent: Anhydrous ethanol (3-4 times the total mass of DTPA anhydride and N-methylpiperazine)
[0217] Reaction temperature: 70-80℃, reflux reaction for 5-7 hours.
[0218] Post-processing: Ethanol was recovered by distillation, and the residue was recrystallized with ethyl acetate, filtered and dried to obtain the pure product (purity ≥97%).
[0219] Carbohydrate polymer protectant: 2-3 g / L of dextran sulfate (DS) is introduced. In this invention, DS is selected with the chemical formula (C6H7Na3O). 14 S3)n, where n ranges from 15 to 1200 (corresponding to a molecular weight of 6000-480000 Da). DS can form a dense hydration layer around nucleic acid molecules, blocking harmful external substances from contacting the nucleic acids. Furthermore, DS molecules interact with nucleic acids through hydrogen bonds, further stabilizing the secondary and tertiary structures of nucleic acids and enhancing their stability at room temperature.
[0220] III. Buffering and Stabilization System:
[0221] Amphoteric buffer: A mixed buffer system of 2-(N-morpholino)ethanesulfonic acid (MES) and N-tris(hydroxymethyl)methylglycine (Tricine) is used, with MES concentration of 8-12 mmol / L and Tricine concentration of 6-10 mmol / L. This mixed buffer system can maintain a stable pH value within a wide pH range (pH 6.0-7.5), adapting to possible pH fluctuations in fecal samples and ensuring the stability of nucleic acid and lyase activity.
[0222] Polymer stabilizer: Add 1.0-1.5 g / L of polyvinyl alcohol (PVA). PVA, through intermolecular interactions such as hydrogen bonds and van der Waals forces, ensures uniform dispersion of the components in the preservation solution, preventing component aggregation or precipitation during room temperature storage, and guaranteeing the uniformity and stability of the preservation solution's performance.
[0223] Synergistic ratio of key components:
[0224] The ratio of compound surfactants is: PEFA concentration = 1.0-1.5 times CAPHSB concentration (i.e. 0.6-1.0 g / L = 1.0-1.5 × 0.4-0.8 g / L), to ensure that the efficiency of the two in synergistically destroying the outer membrane of Gram-negative bacteria is maximized.
[0225] Enzymatic hydrolysis aid ratio: Lyso-V concentration = 1.5-2.5 times proteinase K concentration (i.e. 0.1-0.3 g / L = 1.5-2.5 × 0.05-0.15 g / L), to balance the rate of cell wall lysis and nucleic acid binding protein degradation, and reduce the risk of nucleic acid exposure damage.
[0226] Nucleic acid protection system ratio: DS concentration = 20-30 times AHPCD concentration (i.e. 2-3 g / L = 20-30 × 0.08-0.12 g / L), to achieve synergistic effect of metal ion chelation and nucleic acid hydration layer protection.
[0227] Buffer system ratio: MES concentration = 1.2-1.5 times Tricine concentration (i.e., 8-12 mmol / L = 1.2-1.5 × 6-10 mmol / L), maintaining the pH range of the preservation solution to meet the requirements of enzyme activity and nucleic acid stability.
[0228] Stabilizer ratio: PVA concentration ≤ 1 / 2 DS concentration (i.e., 1.0-1.5 g / L ≤ 1 / 2 × 2-3 g / L) to avoid excessive PVA affecting the hydrogen bond binding between DS and nucleic acid, thus ensuring the protective effect of nucleic acid.
[0229] Experimental Example 2: Preparation of the DNA Preservation Solution of the Present Invention
[0230] I. Weigh the following raw materials:
[0231] Polyether polyol fatty acid ester (PEFA) 0.8g: The esterification product of polyethylene oxide-polypropylene oxide block diol (EO-PO block diol, molecular weight 2500Da) and lauric acid;
[0232] Cocamidopropyl hydroxysulfonate betaine (CAPHSB) 0.6g;
[0233] Lyso-V variant (Lyso-V) 0.2g: Pure product extracted and purified from Bacillus subtilis (BNCC109047) (molecular weight approximately 15kDa, enzyme activity ≥1000U / mg).
[0234] Proteinase K 0.1g;
[0235] Azacyclic polyamine-carboxylic acid derivative (AHPCD) 0.1g: 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid (DOTA);
[0236] Dextran sulfate (DS) 2.5g: Chemical formula is (C6H7Na3O) 14 S3)n, n=500 (corresponding to a molecular weight of 200,000 Da);
[0237] 2-(N-morpholino)ethanesulfonic acid (MES): Convert its molecular weight to the corresponding mass and prepare a 10 mmol / L solution;
[0238] N-Tris(hydroxymethyl)methylglycine (Tricine): Convert its molecular weight to the corresponding mass and prepare an 8 mmol / L solution;
[0239] Polyvinyl alcohol (PVA) 1.2g.
[0240] 2. Add the above components sequentially to an appropriate amount of deionized water, stir and dissolve at 30-35°C. After complete dissolution, bring the volume to 1L with deionized water to obtain the fecal sample DNA preservation solution of the present invention (the proportions of each key component meet the following requirements: PEFA concentration = 1.33 times CAPHSB concentration, Lyso-V concentration = 2 times proteinase K concentration, DS concentration = 25 times AHPCD concentration, MES concentration = 1.25 times Tricine concentration, PVA concentration = 0.48 times DS concentration, satisfying the synergistic ratio requirements).
[0241] Experiment Example 3: Performance Testing of DNA Preservation Solution
[0242] I. Experimental Methods
[0243] Fresh fecal samples were collected and divided into five groups, with each group further divided into nine aliquots. The first group received the preservation solution of this invention (experimental group). The second group received a commercially available room-temperature fecal preservation solution (formula reference: *Journal of Microbiological Methods* 2020, 175:105987, core formula: 10 mmol / L Tris-HCl, 2 mmol / L EDTA, 0.5% SDS, 20% glycerol, pH 8.0) (control group 1). The third group received a traditional low-temperature preservation buffer (traditional low-temperature fecal DNA preservation buffer (formula: 10 mmol / L Tris-HCl, 1 mmol / L EDTA, 0.5 mol / L NaCl, pH 8.0, reference: *Molecular Cloning: A Laboratory Manual*, p. 3). (Control group 2, used only to compare the effect of room temperature preservation, actually placed at room temperature in actual operation), the fourth group was added with preservation solution No. 1 in Table 4 (control group 3), and the fifth group was added with preservation solution No. 2 in Table 4 (control group 4). The samples were stored at room temperature (25±2℃). At 0 months, 3 months, 6 months, 9 months, 12 months, 15 months, 18 months, 21 months, and 24 months, DNA was extracted from the samples using the phenol-chloroform method (such as the phenol-chloroform method described in the article "Comparison of Phenol / Chloroform Method and Salting Out Method for Extracting Genomic DNA from Human Peripheral Blood"). The Ct value of specific genes was determined by real-time PCR. Escherichia coli 16S rRNA gene, GenBank accession number GCA_000005845.2, PCR primer sequence:
[0244] Ecoli_F:CATGCCGCGTGTATGAAGAA (SEQ ID NO.1)
[0245] Ecoli_R:CGGGTAACGTCAATGAGCAAA(SEQ ID NO.2)
[0246] Ecoli_P-CY5: TATTAACTTTACTCCCTTCCTCCCCGCTGAA (SEQ ID NO.3);
[0247] The PCR reaction system is shown in Table 5 below;
[0248] PCR reaction program: 95°C for 2 min; 96°C for 3 s, 56°C for 5 s, 72°C for 3 s, 40 cycles.
[0249] Simultaneously, the concentration and purity of DNA were determined using an ultraviolet spectrophotometer (A). 260 / A 280ratio).
[0250] Table 4
[0251]
[0252] Table 5
[0253]
[0254] II. Experimental Results
[0255] Quantitative real-time PCR results showed that the Ct value of the *E. coli* 16S rRNA gene was 25.08 at 0 months in the experimental group; after 24 months of storage, the Ct value was 25.78. Figure 1 The CV value was 0.76%, showing only a slight increase, indicating that the total DNA amount remained stable; the control group had a Ct value of 27.80 and a CV value of 4.22% at 12 months, and the Ct value rose to 34.2 at 24 months. Figure 2 The CV value reached 6.85%, indicating significant DNA degradation. In the control group 2, the Ct value began to rise sharply after 6 months of storage at room temperature, the gene was almost undetectable after 18 months, and completely undetectable after 24 months. Figure 3 In both control groups 3 and 4, no effective DNA could be detected after 18 months. Figure 4 and Figure 5 The specific data is shown in Table 6 below:
[0256] Table 6
[0257]
[0258] Note: NA indicates that no usable DNA could be extracted (concentration <10ng / μl).
[0259] The results of ultraviolet spectrophotometry showed that the DNA A in the experimental group at 0 months was... 260 / A 280 The ratio is between 1.8 and 2.0; after storage for 24 months, A 260 / A 280 The ratio remained between 1.5 and 1.6, with a concentration decrease of only 8.5%, indicating good nucleic acid integrity; in control group 1, A at 12 months... 260 / A 280 The ratio had already fallen below 1.4, and after 24 months it dropped to 1.15, representing a concentration decrease of 42.3%; in control groups 2, after 12 months of storage at room temperature, A 260 / A 280The ratios were chaotic and the concentrations were extremely low, making it impossible to extract any usable DNA after 18 months; control groups 3 and 4 also failed to extract usable DNA after 18 months. This indicates that the preservation solution of this invention still exhibits significant advantages in DNA stability and integrity during a two-year storage period at room temperature, and the synergistic effect and ratio control of key components effectively ensure the quality of nucleic acids after long-term storage. Specific data are shown in Table 7 below.
[0260] Table 7
[0261] .
Claims
1. A preservation solution for storing sample DNA stably at room temperature, characterized in that, include: Lysis system, nucleic acid protection system, buffering and stabilization system; The pyrolysis system includes a complex surfactant and an enzymatic hydrolysis aid; The composite surfactant includes: 0.6~1.0 g / L polyether polyol fatty acid ester and 0.4~0.8 g / L cocamidopropyl hydroxysulfonate betaine; The enzymatic hydrolysis aids include lysozyme Lyso-V and proteinase K; the lysozyme Lyso-V is extracted from Bacillus subtilis strain number BNCC109047. Bacillus subtilis Lyso-V lysozyme; the final concentration of Lyso-V lysozyme in the preservation solution was 0.1~0.3 g / L; the final concentration of proteinase K in the preservation solution was 0.05~0.15 g / L; The nucleic acid protection system includes: nitrogen-containing heterocyclic polyamine-carboxylic acid derivatives and dextran sulfate esters; Nitrogen heterocyclic polyamine-carboxylic acid derivatives include: 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-nitrocyclic derivatives, and diethylenetriaminepentaacetic acid-piperazine derivatives; The mass ratio of 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid, 1,4,7-triazacyclononane-N,N',N''-triacetic acid, disodium ethylenediaminetetraacetate-azacycloderivative, and diethylenetriaminepentaacetic acid-piperazine derivative in the azacyclopolyamine-carboxylic acid derivative is 2:2:3:3; The final concentration of the nitrogen-containing heterocyclic polyamine-carboxylic acid derivative in the preservation solution was 0.08~0.12 g / L; The final concentration of dextran sulfate in the preservation solution is 2-3 g / L; Buffering and stabilizing systems include: amphoteric buffers and polymeric stabilizers; Amphoteric buffers include: 2-(N-morpholino)ethanesulfonic acid and N-tris(hydroxymethyl)methylglycine; Polymer stabilizers include: polyvinyl alcohol; The final concentration of 2-(N-morpholino)ethanesulfonic acid in the preservation solution was 8–12 mmol / L; the final concentration of N-tris(hydroxymethyl)methylglycine in the preservation solution was 6–10 mmol / L; and the final concentration of polyvinyl alcohol in the preservation solution was 1.0–1.5 g / L. The disodium ethylenediaminetetraacetate-azo heterocyclic derivative was synthesized by the following method: using EDTA dianhydride and piperazine as reactants and N,N-dimethylformamide as solvent, the reaction was carried out at 80-90℃ under nitrogen protection for 6-8 hours to obtain a reaction solution, which was then post-treated. The diethylenetriaminepentaacetic acid-piperazine derivative was synthesized by the following method: using DTPA anhydride and N-methylpiperazine as reactants and anhydrous ethanol as solvent, the reaction was refluxed at 70-80℃ for 5-7 h to obtain a reaction solution, which was then post-treated. The extraction method of the lysozyme Lyso-V includes the following steps: S1. After the bacterial cells in the fermentation broth were precipitated, they were crushed and centrifuged under ultrasonic conditions of 300W power, 3s working time, 5s intermittent time, and a total duration of 30min to obtain crude enzyme solution. S2. The crude enzyme solution was subjected to DEAE-52 ion exchange chromatography and Sephadex G-75 gel filtration chromatography to obtain lysozyme Lyso-V.
2. The preservation solution for stable preservation of sample DNA at room temperature according to claim 1, characterized in that, The sample is a fecal sample; the room temperature refers to 25±2℃.
3. A method for preparing a preservation solution for stable preservation of sample DNA at room temperature as described in claim 1 or 2, characterized in that, The lysis system, nucleic acid protection system, and buffer and stabilization system were added to deionized water in sequence.
4. The preparation method according to claim 3, characterized in that, Polyether polyol fatty acid esters are obtained by esterification of polyether polyols and fatty acids.
5. The preparation method according to claim 4, characterized in that, The polyether polyol is selected from: polyethylene oxide-propylene oxide block diol, polytetrahydrofuran diol, and polypropylene oxide triol.
6. The preparation method according to claim 4, characterized in that, The fatty acids are selected from: lauric acid, myristic acid, linoleic acid, and oleic acid.
7. The preparation method according to claim 4, characterized in that, The esterification reaction includes: feeding polyether polyol hydroxyl groups and fatty acid carboxyl groups at a molar ratio of 1:1.05-1.2, refluxing at 120-130℃ for 1 hour, then heating to 150-160℃ and holding for 4-6 hours, and finally removing excess fatty acids and residual toluene under a vacuum of 0.08-0.09 MPa to obtain a reaction solution, which is then post-treated.
8. The preparation method according to claim 7, characterized in that, The post-treatment of the esterification reaction refers to: cooling the reaction solution to 80°C, washing it with a 5% sodium carbonate aqueous solution until neutral, drying it with anhydrous magnesium sulfate, and then filtering it.
9. The preparation method according to claim 1, characterized in that, S0 was performed before S1. Bacillus subtilis strain number BNCC109047 was used. Bacillus subtilis The seed culture was inoculated into a fermentation medium containing 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L glucose, and pH 7.2, and fermented at 37°C and 200 r / min for 48 h.
10. The preparation method according to claim 9, characterized in that, In S0, the seed liquid is obtained through the following steps: preserving Bacillus subtilis strain number BNCC109047 (… Bacillus subtilis Inoculate onto LB solid medium and incubate at 37°C for 18-24 hours to activate; pick a single colony and inoculate onto LB liquid medium, incubate at 37°C and 180 r / min for 24 hours with shaking.
11. The preparation method according to claim 1, characterized in that, In S1, the bacterial fermentation broth was centrifuged at 8000 r / min and 4℃ for 15 min to obtain bacterial precipitate.
12. The preparation method according to claim 11, characterized in that, The bacterial pellet was washed twice with PBS buffer at pH 7.0 before being lysed.
13. The preparation method according to claim 1, characterized in that, In S1, the centrifugation conditions were 12000 r / min and 4℃ for 20 min.
14. The preparation method according to claim 1, characterized in that, In S2, the elution conditions for DEAE-52 ion exchange chromatography are as follows: using PBS buffer with 0-0.5 mol / L NaCl as the elution solution, and performing gradient elution.
15. The preparation method according to claim 3, characterized in that, 1,4,7,10-Tetraazacyclododecane-N,N',N'',N'''tetraacetic acid was synthesized by the following method: using 1,4,7,10-tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide as reactants, and deionized water as solvent, the reaction was carried out at 55-65℃ for 10-12 h to obtain a reaction solution, which was then post-treated.
16. The preparation method according to claim 15, characterized in that, The molar ratio of 1,4,7,10 - tetraazacyclododecane, sodium chloroacetate, and sodium hydroxide is 1:4.2:4.
5.
17. The preparation method according to claim 15, characterized in that, The order of adding the reaction raw materials is as follows: first, 1,4,7,10-tetraazacyclododecane is dissolved in an aqueous sodium hydroxide solution at pH 10-11, and then sodium chloroacetate is added in batches.
18. The preparation method according to claim 15, characterized in that, The solid-liquid ratio of the reaction raw materials to the solvent is 1:5-1:
8.
19. The preparation method according to claim 15, characterized in that, The post-processing of the synthesis method of 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''tetraacetic acid refers to: adjusting the pH of the reaction solution to 2-3 with hydrochloric acid, precipitating the solid, filtering, recrystallizing twice with deionized water, and drying to obtain pure DOTA.
20. The preparation method according to claim 3, characterized in that, 1,4,7-triazacyclononane-N,N',N''-triacetic acid was synthesized by the following method: using 1,4,7-triazacyclononane and chloroacetic acid as reactants, the reaction was stirred at 45-55℃ for 8-10 h to obtain a reaction solution, which was then post-treated.
21. The preparation method according to claim 20, characterized in that, The molar ratio of 1,4,7-triazacyclononane to chloroacetic acid is 1:3.1~3.
3.
22. The preparation method according to claim 20, characterized in that, The pH of the reaction was adjusted to be maintained at pH 9-10 using sodium carbonate.
23. The preparation method according to claim 20, characterized in that, The post-treatment of the synthesis method of 1,4,7-triazacyclononane-N,N',N''-triacetic acid refers to: concentrating the reaction solution to 1 / 3 of its original volume, acidifying it with hydrochloric acid to pH 2-3, cooling to crystallize, and filtering and drying.
24. The preparation method according to claim 3, characterized in that, The molar ratio of EDTA dianhydride to piperazine is 1:
1.
25. The preparation method according to claim 3, characterized in that, The mass ratio of solvent to reactants is 2~3:
1.
26. The preparation method according to claim 3, characterized in that, The post-processing of the method for synthesizing the disodium ethylenediaminetetraacetate-azo heterocyclic derivative refers to: after cooling the reaction solution, pouring it into ice water to precipitate the solid, filtering it, washing it twice with ethanol, and vacuum drying it at 60°C for 4 hours.
27. The preparation method according to claim 3, characterized in that, The amount of solvent used is 3-4 times the total mass of DTPA anhydride and N-methylpiperazine.
28. The preparation method according to claim 3, characterized in that, The molar ratio of DTPA anhydride to N-methylpiperazine is 1:1.
05.
29. The preparation method according to claim 3, characterized in that, The mass ratio of the solvent to the reaction raw materials is 3~4:
1.
30. The preparation method according to claim 3, characterized in that, The post-processing of the synthesis method of the diethylenetriaminepentaacetic acid-piperazine derivative refers to: distilling to recover ethanol, recrystallizing the residue with ethyl acetate, and filtering and drying.
31. The preparation method according to claim 3, characterized in that, The CAS number for 2-(N-morpholino)ethanesulfonic acid is 145224-94-8; the CAS number for N-tris(hydroxymethyl)methylglycine is 5704-04-1.
32. The preparation method according to claim 3, characterized in that, After adding to deionized water, stir at 30-35℃ until dissolved and clear, then bring to the target volume with deionized water.
Citation Information
Patent Citations
Fecal sample nucleic acid preserving fluid and preparation method thereof
CN113637723A
Preserving solution for preserving excrement at normal temperature, preparation method and application
CN115323033A