Biomarker for quantitatively detecting heart failure and application thereof

Abstract

The invention discloses a heart failure biomarker and application thereof, relates to the technical field of biology, solves the technical problem that BNP is insufficient in early signal recognition of HFpEF, and is characterized by providing a biomarker LECT2 protein or LECT2 coding gene for diagnosis or auxiliary diagnosis of heart failure. The invention provides application of a product for quantitatively detecting LECT2 protein in preparation of a tool for diagnosing heart failure, the heart failure is ejection fraction retention type heart failure, a pharmaceutical composition for treating HFpEF is provided, the pharmaceutical composition comprises an LECT2 inhibitor, and the inhibitor is selected from one or more of shRNA of a targeted LECT2 gene, an antibody of the targeted LECT2 protein and an antagonist of a targeted LECT2 receptor; the effects of being beneficial to early recognition of high-risk patients and remarkably improving the accuracy of HFpEF diagnosis and the early detection capability are achieved.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically, to a biomarker for heart failure and its application. Background Technology

[0002] Heart failure (HF) is a syndrome caused by various factors that impair the heart's pumping function, resulting in an inability to deliver sufficient blood to meet the body's basic metabolic needs. It is a serious and life-threatening clinical syndrome with a high and increasing global prevalence and mortality rate. The two main subtypes of heart failure are HFrEF (heart failure with reduced ejection fraction) and HFpEF (heart failure with preserved ejection fraction).

[0003] In the treatment of heart failure, several effective clinical drugs exist for heart failure with reduced ejection fraction (HFrEF), including renin-angiotensin system inhibitors (RASIs), beta-blockers, aldosterone receptor antagonists (MRAs), and sodium-glucose cotransporter 2 inhibitors (SGLT2i). These drugs can significantly improve the prognosis of HFrEF patients and reduce the risk of hospitalization for heart failure and cardiovascular death. In particular, in recent years, the "new quadruple therapy" regimen (including ARNIs, SGLT2i, beta-blockers, and MRAs) has been recommended as a basic treatment regimen for HFrEF patients, further optimizing treatment outcomes.

[0004] Heart failure with preserved ejection fraction (HFpEF) is a type of heart failure caused by abnormal diastolic function, characterized by a left ventricular ejection fraction (LVEF) ≥50% but the heart's inability to properly diastolic fill. The main symptoms are dyspnea, edema, and fatigue, and it is commonly seen in the elderly, those with hypertension, diabetes, and obesity. The pathophysiological mechanisms of HFpEF are complex, involving multiple factors, including myocardial stiffness, cardiac fibrosis, inflammation, oxidative stress, and metabolic abnormalities. These factors interact to collectively lead to impaired cardiac function.

[0005] Currently, treatment for heart failure with preserved ejection fraction (HFpEF) is relatively lagging, lacking effective drug treatment options. Existing treatments for HFpEF mainly rely on diuretics to alleviate symptoms and signs, and drugs such as SGLT2 inhibitors and sacubitril / valsartan to reduce the risk of the composite endpoint of heart failure hospitalization or cardiovascular death. However, the effectiveness of these treatments remains limited compared to drugs for treating HFrEF.

[0006] Although biomarkers such as BNP have been used clinically, their limitations in early heart failure diagnosis and targeted therapy are becoming increasingly apparent. Therefore, further research is needed to elucidate the molecular mechanisms and develop new therapeutic targets and drugs in order to better understand and treat HFpEF. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide a biomarker for heart failure and its application, which solves the technical problem of insufficient BNP in the early signal recognition of HFpEF, helps to identify high-risk patients earlier, and significantly improves the accuracy of HFpEF diagnosis and early detection capabilities.

[0008] The above-mentioned technical objective of the present invention is achieved through the following technical solution:

[0009] In a first aspect, a biomarker for the quantitative detection of heart failure is provided, wherein the biomarker is LECT2 protein or LECT2 encoding gene.

[0010] Secondly, the application of a product for quantitative detection of LECT2 protein in the preparation of a diagnostic tool for heart failure is provided, characterized in that the expression level of LECT2 protein in the blood of a subject is detected, and the LECT2 level is compared with a preset threshold to determine whether there is a risk of HFpEF.

[0011] The heart failure mentioned above is heart failure with preserved ejection fraction.

[0012] Furthermore, the product for detecting the expression level of LECT2 protein is a kit, chip, test strip, or high-throughput sequencing platform.

[0013] Furthermore, the kit contains a LECT2 protein-specific antibody, an ELISA detection reagent, and a LECT2 concentration control standard.

[0014] Furthermore, the product for quantitative detection of the LECT2 encoding gene is a reagent kit, chip, test strip, or high-throughput sequencing platform.

[0015] Thirdly, the application of LECT2 protein or LECT2 encoding gene as a therapeutic target in the preparation of drugs for treating HFpEF.

[0016] Fourthly, a pharmaceutical composition for treating HFpEF is provided, characterized in that it comprises a LECT2 inhibitor, said inhibitor being selected from one or more of shRNA targeting the LECT2 gene, antibodies targeting the LECT2 protein, and antagonists targeting the LECT2 receptor.

[0017] Furthermore, the LECT2 inhibitor is an shRNA targeting the LECT2 gene, delivered to liver tissue via the adeno-associated virus vector AAV8, specifically silencing LECT2 expression to improve cardiac diastolic function, reduce myocardial fibrosis, and alleviate inflammatory responses.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. This invention provides LECT2 as a novel biomarker for heart failure. LECT2 protein expression is significantly increased in the plasma of HFpEF patients and is positively correlated with the known heart failure biomarker pro-BNP, which significantly improves the accuracy of HFpEF diagnosis and early detection capability.

[0020] 2. This invention provides a treatment measure that uses LECT2 as a therapeutic target, which significantly alleviates HFpEF symptoms, including diastolic dysfunction, myocardial fibrosis and inflammatory response, by inhibiting its expression, effectively improving cardiac diastolic function and reducing pathological damage;

[0021] 3. This invention provides a pharmaceutical composition for treating HFpEF containing a LECT2 inhibitor. By elucidating the molecular mechanism by which LECT2 regulates HFpEF, it clarifies that LECT2 regulates HFpEF through macrophage-mediated inflammation and fibrosis pathways. RNA-seq and GSEA analyses validated the enrichment of inflammatory pathways. This effect links liver-heart interaction with HFpEF pathology, solving the problem of the lack of existing therapeutic targets. In in vitro experiments, treatment of bone marrow-derived macrophages with LECT2 blocked the activation of the p-STAT3 / TGFβ pathway, significantly reducing the secretion of inflammatory factors. This lays the foundation for the development of precision medicine and helps to address the current clinical pain point of delayed HFpEF treatment. Attached Figure Description

[0022] The accompanying drawings, which are included to provide a further understanding of embodiments of the invention and form part of this application, do not constitute a limitation thereof. In the drawings:

[0023] Figure 1 This is an analysis diagram illustrating the identification of LECT2 as a regulatory factor in liver-heart interaction in Example 2 of the present invention.

[0024] Figure 1 A is a diagram from Example 2 of this invention, in which liver secretion factors and cardiac gene expression were correlated by RNA sequencing in the HMDP and BXD mouse databases, and LECT2 was selected as the liver secretion protein that mediates the regulation of cardiac gene expression in liver-heart interaction.

[0025] Figure 1 B is the cross-tissue prediction significance score map in Embodiment 2 of the present invention, showing the association strength between the expression of all liver genes and heart genes in HMDP and BXD;

[0026] Figure 1C represents the mRNA expression level of LECT2 in various tissues of adult C57BL / 6J male mice fed a normal diet in Example 2 of this invention, as well as the expression level of LECT2 in various cell types of the liver.

[0027] Figure 1 D is the enrichment analysis screening diagram of key cardiac transcripts in Example 2 of the present invention. The GWAS Catalog gene library was used to perform pathway enrichment analysis on the 500 cardiac transcripts in HMDP that are most related to liver LECT2 expression.

[0028] Figure 1 E is a graph showing the mRNA expression levels of LECT2 in the livers of mice fed normal and high-fat diets in Example 2 of this invention;

[0029] Figure 1 F is a graph showing the protein levels of LECT2 in the plasma of mice fed normal and high-fat diets in Example 2 of this invention;

[0030] Figure 2 This is a graph illustrating the aggravation of diastolic dysfunction by LECT2 in the HFpEF mouse model according to Example 2 of the present invention.

[0031] Figure 2 A is a schematic diagram in Example 2 of the present invention. Eight-week-old male C57BL / 6J mice were injected with adeno-associated virus AAV8-TBG-GFP or AAV8-TBG-Lect2, and then treated with a high-fat diet HFD and L-NAME for 7 weeks.

[0032] Figure 2 B shows the relative level of plasma LECT2 protein as displayed by Western blot images and quantitative analysis in Example 2 of this invention.

[0033] Figure 2 C is the left ventricular ejection fraction (LVEF) diagram in Embodiment 2 of the present invention;

[0034] Figure 2 D is the left ventricular ejection fraction (LVFS) diagram in Embodiment 2 of the present invention;

[0035] Figure 2 E represents the E / A ratio diagram in Embodiment 2 of the present invention;

[0036] Figure 2 F is the E / e' ratio diagram in Embodiment 2 of the present invention;

[0037] Figure 2 G is the left ventricular mass (LV) diagram in Embodiment 2 of the present invention;

[0038] Figure 2H-2J represents the Masson trichrome staining, WGA immunohistochemical images, statistical WGA staining results, Masson staining and statistical results graphs in Example 2 of the present invention.

[0039] Figure 2 K represents the relative mRNA levels of HFpEF-related genes in Example 2 of this invention.

[0040] Figure 2 This is a diagram illustrating the analysis of the MET / p-STAT3 / TGFβ pathway in macrophages activated by LECT2 in this invention.

[0041] Figure 3 A represents the genes that showed significant (p<0.05) changes in the heart tissue in Example 2 of this invention, analyzed using KEGG.

[0042] Figure 3 B represents the genes that were significantly (p<0.05) upregulated in the heart tissue of Example 2 of this invention, analyzed by GSEA.

[0043] Figure 3 C is a graph showing the mRNA levels of various macrophage marker genes in the heart tissue of Example 2 of the present invention;

[0044] Figure 3 D is a graph showing the mRNA level of the marker gene CCR2 in macrophages in Example 2 of this invention;

[0045] Figure 3 E is a graph showing the mRNA level of the LECT2 receptor in macrophages in Example 2 of this invention;

[0046] Figure 3 F is a graph showing the mRNA levels of inflammation and fibrosis-related genes in macrophages in Example 2 of this invention;

[0047] Figure 3 G is a Western blot image and quantitative analysis diagram showing the relative levels of p-STAT3 and STAT3 and the protein level of TGFβ in macrophages after treatment with LECT2 protein and p-STAT3 inhibitor in Example 2 of the present invention.

[0048] Figure 3 This is a graph showing the progress analysis of silencing the Lect2 gene to reverse mouse HFpEF in Example 2 of the present invention;

[0049] Figure 4 A is an overview diagram of the shLect2 experimental design in Example 2 of this invention; mice were first subjected to a high-fat diet (HFD) and L-NAME treatment for 5 weeks, then injected with AAV8-shGFP or shLect2, and HFpEF modeling continued, and tissues were harvested in the 10th week;

[0050] Figure 4 B is a graph showing the body weight and exercise tolerance of mice 5 weeks after HFpEF modeling in Example 2 of this invention;

[0051] Figure 4 C is the E / e' ratio graph of echocardiographic assessment of cardiac function in mice 5 weeks after HFpEF modeling in Example 2 of the present invention.

[0052] Figure 4 D is a graph showing the E / A ratio of mice after 5 weeks of HFpEF modeling in Example 2 of this invention;

[0053] Figure 4 E is the LV Mass image of mice after 5 weeks of HFpEF modeling in Example 2 of this invention;

[0054] Figure 4 F is the left ventricular ejection fraction (LVEF) diagram of mice after 5 weeks of HFpEF modeling in Example 2 of this invention;

[0055] Figure 4 G is the left ventricular shortening fraction (LVFS) graph of mice after 5 weeks of HFpEF modeling in Example 2 of this invention.

[0056] Figure 4 H represents the systolic blood pressure (SBP) and diastolic blood pressure (DBP) of mice after 5 weeks of HFpEF modeling in Example 2 of this invention;

[0057] Figure 4 I is a gene expression map related to heart function in Embodiment 2 of the present invention;

[0058] Figure 4 This is a graph showing the correlation between elevated LECT2 levels and human heart failure in Example 2 of the present invention.

[0059] Figure 5 A is a graph showing the protein levels of BNP in the plasma of HFpEF patients and non-heart failure patients, obtained by detecting plasma samples from the population using ELISA in Example 2 of this invention.

[0060] Figure 5 B is a graph showing the protein levels of LECT2 in the plasma of HFpEF patients and non-heart failure patients, obtained by detecting plasma samples from the population using ELISA in Example 2 of this invention.

[0061] Figure 5 C is a correlation diagram of LECT2 and BNP protein levels in human plasma samples in Example 2 of the present invention;

[0062] Figure 5D is a diagram illustrating the mechanism of action of LECT2-mediated liver-heart interaction in regulating HFpEF in Embodiment 2 of the present invention. Detailed Implementation

[0063] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0064] Example 1:

[0065] This invention provides a biomarker for the quantitative detection of heart failure, wherein the biomarker is LECT2 protein or the LECT2 encoding gene; and provides the application of a product for the quantitative detection of LECT2 protein in the preparation of a diagnostic tool for heart failure, wherein the expression level of LECT2 protein in the blood of a subject is detected, and the LECT2 level is compared with a preset threshold to determine whether there is a risk of HFpEF; wherein the heart failure is heart failure with preserved ejection fraction; the product for detecting the expression level of LECT2 protein is a kit, chip, test strip, or high-throughput sequencing platform; the kit includes a LECT2 protein-specific antibody, ELISA test reagent, and LECT2 concentration control standard; the product for the quantitative detection of the LECT2 encoding gene is a kit, chip, test strip, or high-throughput sequencing platform.

[0066] Application of providing LECT2 protein or LECT2 encoding gene as a therapeutic target in the preparation of drugs for treating HFpEF.

[0067] A pharmaceutical composition for treating HFpEF is provided, comprising a LECT2 inhibitor selected from one or more shRNAs targeting the LECT2 gene, antibodies targeting the LECT2 protein, and antagonists targeting the LECT2 receptor. The LECT2 inhibitor is a shRNA targeting the LECT2 gene, delivered to liver tissue via the adeno-associated virus vector AAV8, specifically silencing LECT2 expression to improve diastolic function, reduce myocardial fibrosis, and alleviate inflammatory responses.

[0068] The Lect2 gene sequence is as follows:

[0069] atgattcccacaac aatcctcatt tcagctgctt tgctttcctc tgccctagca ggaccatgggctaacatatg tgccagcaaa tcttccaacg agatccggac gtgtgacagc tatggctgtggacagtactctgctcaaaga acccaaaggc atcacccagg tgtggacgtc ctgtgctcggatggatctgt ggtgtatgcaccattcactg ggaagatagt gggccaggag aaaccctata gaaacaaaaa tgccatcaat gatggcattcgactgtctgg aagaggtttt tgtgtcaaaattttctacat taagccaatt aagtataaag gttctatcaaaaagggggag aagctgggcaccttgctgcc cctgcagaaa gtttacccgg gcatccagtc gcatgtacacgttgaaaactgcgactccag tgaccccaca gcatacctgt aa

[0070] Example 2:

[0071] This embodiment provides the experimental process and analysis, as detailed below:

[0072] I. Construction of a liver-specific LECT2 gene overexpression mouse model

[0073] 1. Selection and Principles of Gene Editing Technology

[0074] Adeno-associated virus type 8 (AAV8) vector-mediated gene transfer technology was selected. AAV8 is a gene delivery vector with multiple advantages; it can efficiently infect various cell types, including liver cells, and has low immunogenicity, enabling long-term stable gene expression in vivo. The principle is that after the virus enters liver cells, it is internalized through receptor-mediated endocytosis and unpacked in the cytoplasm. Subsequently, the single-stranded viral genome is transported to the cell nucleus and converted into double-stranded epichromic extrachromosomal DNA. The LECT2 gene is expressed under the drive of the TBG promoter, thereby achieving stable transgene expression in liver cells. In this invention, an AAV8 viral vector containing the LECT2 gene was constructed and injected into mice via tail vein, resulting in specific overexpression of the LECT2 gene in liver cells.

[0075] 2. Model Construction Strategy – Construction of Liver-Specific LECT2 Gene Overexpression Mice (LECT2-Tg)

[0076] First, an AAV8 viral vector containing the coding sequence of the LECT2 gene was constructed. The LECT2 gene was cloned downstream of a specific promoter on the AAV8 vector plasmid to ensure high specific expression of the LECT2 gene in liver cells. A liver-specific promoter (such as the Albumin promoter) was used in this experiment. After construction, the virus was packaged in a suitable cell line (such as HEK293T cells). Infective AAV8-LECT2 viral particles were generated by co-transfecting the packaging plasmid, helper plasmid, and the AAV8 vector plasmid carrying the LECT2 gene into the cells. The viral particles were collected, purified, and the viral titer was determined. The viral titer was determined at a specific concentration (1×10⁻⁶). 12 AAV8-LECT2 virus (vg / ml) was injected into mice via the tail vein. After entering liver cells, the virus carried the LECT2 gene, which integrated into the liver cell genome and was expressed, thus achieving liver-specific LECT2 gene overexpression. This model was used to investigate the effect of LECT2 overexpression on heart failure with cardiac emphysema (HFpEF) to evaluate its potential value in the treatment of HFpEF.

[0077] II. Grouping and Treatment of Animal Models

[0078] 1. Selection and grouping of laboratory animals

[0079] C57BL / 6 mice were randomly divided into the following groups: HFpEF model group (HFpEF), in which heart failure was induced in mice using a high-fat diet combined with L-NAME to simulate the pathophysiological state of HFpEF. The high-fat diet could simulate the symptoms of metabolic disorders such as diabetes and obesity in HFpEF, and L-NAME could induce hypertension; LECT2-Tg+HFpEF group, in which heart failure was induced in mice with liver-specific LECT2 gene overexpression, and the effect of LECT2 overexpression on the progression of HFpEF was observed.

[0080] 2. Processing Procedures and Time Point Settings

[0081] All mice were housed under identical environmental conditions, with free access to food and water, and the quality of feed and water met laboratory animal standards. Baseline body weight was measured before the experiment. For the heart failure model group and the LECT2-Tg+HFpEF group, treatment followed a predetermined heart failure induction protocol for 7 weeks. During treatment, mouse body weight was monitored regularly, and cardiac function-related tests were performed at specific time points (e.g., 0, 4 weeks, 7 weeks).

[0082] III. Cardiac Function Testing and Assessment

[0083] 1. Echocardiography

[0084] The examination was performed in mice under mild anesthesia using a high-resolution echocardiogram system (such as the VisualSonics Vevo F2 system).

[0085] The indicators tested include: Left ventricular ejection fraction (LVEF), which reflects cardiac systolic function and is calculated by measuring the volume change of the left ventricle during systole and diastole. The formula is LVEF = (End-diastolic volume - End-systolic volume) / End-diastolic volume × 100%; Left ventricular fractional shortening (LVFS) is also an indicator of cardiac systolic function, calculated as LVFS = (End-diastolic diameter - End-systolic diameter) / End-diastolic diameter × 100%; Mitral valve flow spectrum parameters E / A ratio and E / e' ratio, as mentioned above, are used to assess cardiac diastolic function; a decreased E / A ratio or an increased E / e' ratio suggests impaired cardiac diastolic function; other indicators include left ventricular end-diastolic dimension (LVEDD) and left ventricular end-systolic dimension (LVsystolic diameter). Dimensions (LVESD), etc., are used to comprehensively assess changes in cardiac structure and function.

[0086] Echocardiography was performed at different time points during the experiment (such as before treatment, 4 weeks after treatment, 7 weeks after treatment, etc.) to dynamically observe changes in cardiac function.

[0087] 2. Histopathological examination of cardiac tissue (Histopathology)

[0088] At the end of the experiment, the mice were euthanized and the heart tissue was quickly removed, fixed with 4% paraformaldehyde, routinely embedded in paraffin, and sectioned (approximately 4-6 μm thick).

[0089] Perform the following staining and analysis:

[0090] Hematoxylin-Eosin (HE) staining is used to observe the morphology, size, arrangement, and nucleus morphology of cardiomyocytes, and to assess pathological changes such as cardiomyocyte hypertrophy, necrosis, or inflammatory cell infiltration. Masson's Trichrome staining is used to detect the degree of myocardial fibrosis. Collagen fibers are stained blue, and cardiomyocytes are stained red. The proportion of collagen fiber area to the total area of ​​myocardial tissue is calculated using image analysis software to quantitatively assess the degree of myocardial fibrosis.

[0091] IV. Molecular Biological Detection

[0092] 1. RNA extraction and real-time quantitative PCR (RT-PCR)

[0093] Mouse heart tissue was collected, and total RNA was extracted using Trizol reagent. cDNA was then synthesized via reverse transcription. Trizol reagent is a commonly used RNA extraction reagent that can effectively lyse cells and separate RNA. The cDNA was complementary DNA.

[0094] Specific primers targeting the LECT2 gene and genes related to cardiac function, inflammation, and fibrosis (such as myocardial contraction-related genes, inflammatory factor genes, and fibrosis-related genes) were designed as shown in the table below:

[0095] Table 1. LECT2 gene and genes related to cardiac function, inflammation, fibrosis, etc.

[0096] Figure 5 Species Gene Sequence (5'-3') Mouse Actin-F GTGACGTTGACATCCGTAAAGA Mouse Actin-R GCCGGACTCATCGTACTCC Mouse Lect2-F CCCACAACAATCCTCATTTCAGC Mouse Lect2-R ACACCTGGGTGATGCCTTTG Mouse Nppb-F GAGGTCACTCCTATCCTCTGG Mouse Nppb-R GCCATTTCCTCCGACTTTTCTC Mouse SMA-F GTCCCAGACATCAGGGAGTAA Mouse SMA-R TCGGATACTTCAGCGTCAGGA Mouse IL6-F AGTTGCCTTCTTGGGACTGA Mouse IL6-R TCCACGATTTCCCAGAGAAC Mouse Tnf-F CCTGTAGCCCACGTCGTAG Mouse Tnf-R GGGAGTAGACAAGGTACAACCC Mouse Tgfb1-F CTCCCGTGGCTTCTAGTGC Mouse Tgfb1-R GCCTTAGTTTGGACAGGATCTG Mouse Col3a1-F CTGTAACATGGAAACTGGGGAAA Mouse Col3a1-R CCATAGCTGAACTGAAAACCACC Mouse Col1a1-F GCTCCTCTTAGGGGCCACT Mouse Col1a1-R ATTGGGGACCCTTAGGCCAT Mouse Col5a3-F CGGGGTACTCCTGGTCCTAC Mouse Col5a3-R GCATCCCTACTTCCCCCTTG Mouse Col5a1-F CTTCGCCGCTACTCCTGTTC Mouse Col5a1-R CCCTGAGGGCAAATTGTGAAAA Mouse Nectin1-F GACTCCATGTATGGCTTCATCG Mouse Nectin1-R CACTCGTTTCTCGTAGGGAGG Mouse Icam1-F GTGATGCTCAGGTATCCATCCA Mouse Icam1-R CACAGTTCTCAAAGCACAGCG Mouse Igtb2-F TGCCGCATTCAATGTGACTTT Mouse Igtb2-F

[0097] PCR amplification was performed using a real-time quantitative PCR instrument to detect the mRNA expression levels of the genes in Table 1 in the heart tissues of mice in different groups. By comparing the differences in gene expression among different groups, the regulatory role of LECT2 on the expression of heart-related genes was analyzed, revealing the molecular mechanism by which LECT2 affects the pathophysiological processes of heart disease at the gene transcription level.

[0098] 2. Protein extraction and Western blotting analysis

[0099] Total protein was extracted from mouse heart tissue. Cells were lysed using RIPA lysis buffer, and the supernatant was collected after centrifugation to obtain total protein. The RIPA lysis buffer contains protease inhibitors and phosphatase inhibitors, which can prevent protein degradation and dephosphorylation.

[0100] Protein concentration was determined using the BCA protein quantification kit. Equal amounts of protein samples were subjected to SDS-PAGE gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis, separating proteins according to their molecular weight) and then transferred to an NC membrane (nitrocellulose membrane).

[0101] NC membranes were incubated overnight at 4°C with specific primary antibodies (such as anti-LECT2 antibody or signaling pathway-related antibodies), followed by incubation at room temperature with corresponding secondary antibodies (horseradish peroxidase-labeled). Protein bands were detected by chemiluminescence immunoassay, and the grayscale values ​​of the protein bands were analyzed using image analysis software such as ImageJ. The expression levels of related proteins in the heart tissues of different groups of mice were quantitatively compared, further validating the effect of LECT2 on the expression of cardiac function-related proteins at the protein level.

[0102] V. Cellular Experiments (In Vitro Studies)

[0103] 1. Isolation and processing of primary bone marrow macrophages (BMDM)

[0104] The isolated primary mouse macrophages were cultured under suitable conditions, such as 37°C, 5% CO2, 10% fetal bovine serum, and 30% L929 conditioned medium in 1640 medium.

[0105] The experiment was divided into the following groups:

[0106] Control group (Ctrl): BMDM cultured normally without special treatment;

[0107] LECT2-treated group: Recombinant LECT2 protein was added to the culture medium to achieve a final concentration of 10-100 ng / ml, and the optimal concentration was determined based on preliminary experiments. The treatment lasted for 24-72 hours, and the direct effects of LECT2 on macrophage function and related gene expression were observed.

[0108] 2. Detection Indicators and Methods

[0109] PCR amplification was performed using a real-time quantitative PCR instrument to detect the expression levels of genes related to macrophage function in BMDM treated with different groups. By comparing the differences in gene expression among different groups, the regulatory role of LECT2 on macrophages was analyzed, revealing the molecular mechanism by which LECT2 affects the immune infiltration process at the gene transcription level.

[0110] Western Blotting analysis: Total protein was extracted from treated macrophages and subjected to Western blotting to analyze changes in the expression of proteins related to macrophage activation and inflammatory responses (such as p-STAT3 / TGFβ), revealing the mechanism by which LECT2 affects macrophage function at the molecular level.

[0111] VI. Data Analysis and Results Interpretation

[0112] 1. Data collection and organization

[0113] We systematically collected data from echocardiography, histopathological examination, molecular biological testing, and cell experiments. This included cardiac function indicators (such as LVEF, LVFS, E / A ratio, E / e' ratio, etc.), histological quantitative data (such as the proportion of myocardial fibrosis area, immunohistochemical positive cell count, etc.), gene and protein expression level data (Ct value of real-time quantitative PCR, gray value of protein bands in Western blotting, etc.), and cell viability, apoptosis rate, calcium ion concentration, etc., from cell experiments. We ensured the accuracy and completeness of the data, and recorded and labeled each data point in detail, indicating its experimental group, detection time point, and other information.

[0114] 2. Selection and application of statistical analysis methods

[0115] Appropriate statistical software, such as GraphPad Prism, was used for data analysis. For comparisons of multiple groups of data, normality and homogeneity of variance tests were first performed. If the data followed a normal distribution and homogeneity of variance, one-way ANOVA was used, followed by Tukey's multiple comparison test for pairwise comparisons between groups. If the data did not follow a normal distribution or had unequal variances, nonparametric tests such as the Kruskal-Wallis test were used, followed by Dunn's multiple comparison test for comparisons between groups. For comparisons of two groups of data, the independent samples t-test (for normal distribution) or the Mann-Whitney U test (for non-normal distribution) was selected based on the data distribution. In cell experiments, repeated measures ANOVA was used to analyze data at different time points. A p-value < 0.05 was considered statistically significant to determine whether there were significant differences between different treatment groups.

[0116] 3. Interpretation of Results and Discussion of Mechanisms

[0117] Based on data analysis, this study aims to explain the impact of LECT2 on the pathophysiological processes of heart failure with partial emphysema (HFpEF). For example, if significant improvements in cardiac function are observed in the LECT2-Tg+HFpEF group, such as increased left ventricular ejection fraction (LVEF) and a normalized E / A ratio, accompanied by reduced myocardial fibrosis and decreased expression of inflammatory factors, then LECT2 plays a protective role in cardiac function and reduces pathological damage in HFpEF. Combining molecular biological detection results, the study explores the mechanism of action of LECT2 from the perspective of cell signaling pathways. Through in-depth interpretation of the results and exploration of the mechanisms, the study clarifies the importance of LECT2 in HFpEF and its potential therapeutic value.

[0118] 3.1 The liver-secreted factor LECT2 was found to potentially regulate the progression of heart failure and serve as a diagnostic and therapeutic target.

[0119] The liver and heart are closely connected and mutually regulate each other, and heart failure is often accompanied by liver disease, suggesting that proteins secreted by the liver are involved in regulating heart function. To identify liver-secreted factors that regulate heart function through secretion, such as... CTTCTTGACGTTGTTGAGGTCAT As shown in Figure A, using tissue and database data from two mouse populations named HMDP and BXD, the association between transcriptional levels in the heart and liver was investigated. Bioinformatics analysis was employed to screen liver-secreting proteins associated with cardiac gene expression, and these proteins were ranked according to their correlation. From this, the liver-specific secretory protein LECT2 was identified. Figure 1 As shown in Figure B, LECT2 is specifically expressed and secreted by hepatocytes in the liver, such as... Figure 1 As shown in C. In the genome-wide association study (GWAS), LECT2 was highly associated with multiple disease parameters of heart failure, including myocardial hypertrophy and dilated cardiomyopathy, such as... Figure 1 As shown in D. Therefore, we focused on the relationship between LECT2 and heart failure with preserved ejection fraction (HFpEF), and used qPCR to detect the gene expression level of LECT2 in the liver of mice with the HFpEF model, as shown in Figure D. Figure 1 As shown in Figure E, the protein level of LECT2 in the plasma of mice with the HFpEF model was detected by Western blot. Figure 1 As shown in F, the results indicate that both the gene expression level and protein level of LECT2 are significantly increased in HFpEF. In summary, LECT2 is strongly correlated with HFpEF and participates in regulating cardiac function in HFpEF.

[0120] 3.2 In a mouse model of heart failure, overexpression of LECT2 exacerbated diastolic dysfunction and promoted myocardial hypertrophy, inflammation, and fibrosis.

[0121] To investigate the cause of LECT2 exacerbating heart failure, LECT2 protein was overexpressed in 8-week-old male C57BL / 6J mice using either AAV8-TBG-Lect2 or the control virus AAV8-TBG-GFP. A high-fat diet combined with L-NAME was used to establish a high-frequency heart failure (HFpEF) model. Seven weeks later, cardiac function was assessed using ultrasound. The experimental procedure is as follows: Figure 1 As shown in Figure A, the LECT2 overexpression efficiency is as follows: Figure 2 As shown in B, the cardiac ultrasound results are as follows: Figure 2 C- Figure 2 As shown in G, there were no significant changes in left ventricular ejection fraction (LVEF) and left ventricular shortening fraction (LVFS), as... Figure 2 C and Figure 2 As shown in Figure D, LECT2 overexpression does not affect the contractile function of the mouse heart, but increases the E / A ratio, E / e' ratio, and left ventricular mass (LV mass). Figure 2 E and Figure 2 As shown in Figure F, LECT2 overexpression significantly impairs cardiac diastolic function in mice. Immunohistochemistry was used to stain cardiac sections with HE, Masson's stain, and WGA. HE staining revealed that LECT2 overexpression caused cardiac hypertrophy. Figure 2 As shown in H; Masson staining and statistical results indicate increased cardiac fibrosis, such as... Figure 2 As shown in Figure I; statistical analysis of WGA staining results suggests cardiomyocyte hypertrophy, such as... Figure 2 As shown in J. In addition, the expression levels of Il-6, Tgfb1, Tnf, Sma, Col1a1, Col3a1, Col5a1, Col5a3, Icam1, Itgb2, and Nectin1 in mouse hearts were detected using real-time quantitative PCR, as shown in J. Figure 2 As shown in K, this indicates an increased degree of cardiac inflammation and fibrosis. In conclusion, LECT2 overexpression exacerbates diastolic dysfunction in mice and promotes cardiac inflammation and fibrosis.

[0122] 3.3 LECT2 activates the MET / p-STAT3 / TGFβ pathway in macrophages

[0123] To elucidate the mechanism by which LECT2 regulates cardiac function, RNA-seq was performed on the hearts of HFpEF mice overexpressing GFP and LECT2, and KEGG pathway enrichment analysis was conducted on differentially expressed genes, such as... Figure 2 As shown in Figure A, the results revealed significant activation of multiple inflammatory pathways. Furthermore, the GSEA analysis also indicated a significant upregulation of the inflammatory response, such as... Figure 3As shown in B. Using qPCR to detect marker genes in cardiac macrophages, it was found that the marker gene Ccr2 was significantly upregulated in infiltrative macrophages, as shown in Figure B. Figure 3 As shown in Figure C. Therefore, we focused on the regulatory role of LECT2 on macrophages in the heart. We isolated bone marrow-derived macrophages (BMDM) in vitro and treated them with LECT2 protein. qPCR analysis revealed significantly increased expression levels of Ccr2, Tgfb1, Tnf, Il-6, Il-β, Sma, Acta2, and Col1a1, indicating that LECT2 can activate macrophages and promote the increased expression of inflammation and fibrosis genes. Further investigation into the specific mechanism of LECT2 regulation of macrophages revealed significant upregulation of Met using qPCR. Western blot analysis showed significant upregulation of the downstream signaling pathway p-STAT3 of Met, and a significant increase in the downstream pro-fibrotic factor TGFβ. Treatment with a p-STAT3 inhibitor inhibited downstream TGFβ. In conclusion, LECT2 promotes cardiac fibrosis and inflammation by activating the MET / p-STAT3 / TGFβ pathway in macrophages.

[0124] 3.4 Validating LECT2 as a therapeutic target for heart failure

[0125] To verify the therapeutic effect of LECT2 inhibition on HFpEF, AAV8-TBG-shLect2, containing the promoter thyroid-binding globulin TBG (targeting the liver), and a control virus were used to evaluate the effect of LECT2 silencing on the heart. Figure 3 As shown in Figure A, shLECT2 is a short hairpin RNA (shRNA) molecule that targets and silences the leukocyte-derived chemokine 2 (LECT2) gene using RNA interference technology. An HFpEF model was established in 8-week-old male C57BL / 6J mice fed a high-fat HFD and L-NAME diet. After 5 weeks, echocardiography was performed to assess cardiac function and heart failure progression. Normal LVEF and LVFS, E / A greater than 2, and E / e' greater than 30 indicated successful establishment of a heart failure mouse model with preserved ejection fraction. At this point, the heart failure mice were injected with AAV8-TBG-shLect2 and a control virus, and continued high-fat and L-NAME diets for another 5 weeks. Exercise, cardiac function, and blood pressure were assessed. Results showed that LECT2 silencing alleviated exercise capacity, normalized LVEF and LVFS, significantly decreased E / A and E / e', and a decreasing trend in LVMass. Blood pressure remained unaffected. Figure 4As shown in B-4H. These results show that LECT2 silencing effectively improves diastolic function and exercise capacity in mice. The expression levels of Nppb, Il-6, Tnf, Tgfb1, Sma, Col1a1, Col3a1, Col5a1, and Col5a3 in mouse hearts were detected using qPCR. The results showed that LECT2 silencing significantly downregulated heart failure markers, as well as inflammatory and fibrotic factors. Figure 4 As shown in Figure I. Western blot analysis of TNFα protein levels in the heart also provided relief, as... Figure 4 As shown in J. In summary, silencing LECT2 with AAV virus significantly improved diastolic function and running ability in mice, and also alleviated inflammation and fibrosis.

[0126] 3.4 Investigating the correlation between LECT2 and human heart failure.

[0127] Further validation was conducted in plasma samples from healthy individuals and HFpEF patients, using ELISA to detect the levels of pro-BNP and LECT2 in the plasma, such as... Figure 4 A, Figure 5 As shown in B, correlation analysis of these two proteins revealed that, consistent with mouse experimental data, the level of LECT2 protein in the plasma of HFpEF patients was significantly elevated in human samples and positively correlated with the heart failure marker pro-BNP. Figure 5 Figure 5 As shown in C.

[0128] In summary, this invention reveals for the first time the pathogenic role of LECT2 in the development and progression of heart failure, identifying LECT2 as a novel regulator of liver-cardiac interaction. LECT2 expression is elevated in a HFpEF mouse model, and overexpression of LECT2 exacerbates diastolic dysfunction. Silencing LECT2 using shRNA significantly improves diastolic function. This invention demonstrates that LECT2 promotes cardiac inflammation and fibrosis by activating the MET / p-STAT3 / TGFβ pathway infiltrating macrophages in the heart, thereby exacerbating HFpEF. Furthermore, in human plasma samples, LECT2 protein levels are positively correlated with the heart failure biomarker pro-BNP. Therefore, LECT2 protein can serve as a diagnostic biomarker and therapeutic target for heart failure with preserved ejection fraction.

[0129] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A biomarker for the quantitative detection of heart failure, wherein the biomarker is LECT2 protein or LECT2 encoding gene.

2. The application of a product for quantitative detection of LECT2 protein in the preparation of tools for the diagnosis of heart failure, characterized in that, By detecting the expression level of the LECT2 protein in the blood of the subject and comparing the LECT2 level with a preset threshold, it is determined whether there is a risk of HFpEF. The heart failure mentioned above is heart failure with preserved ejection fraction.

3. The application of the product for quantitative detection of LECT2 protein according to claim 2 in the preparation of a tool for the diagnosis of heart failure, characterized in that, The products used to quantitatively detect the expression level of LECT2 protein include kits, chips, test strips, or high-throughput sequencing platforms.

4. The application of the product for quantitative detection of LECT2 protein according to claim 3 in the preparation of a tool for the diagnosis of heart failure, characterized in that, The kit contains a LECT2 protein-specific antibody, an ELISA assay reagent, and a LECT2 concentration control standard.

5. The application of the product for quantitative detection of LECT2 protein according to claim 2 in the preparation of a tool for the diagnosis of heart failure, characterized in that, The products for quantitative detection of the LECT2 encoding gene are kits, chips, test strips, or high-throughput sequencing platforms.

6. Application of LECT2 protein or LECT2 encoding gene as a therapeutic target in the preparation of drugs for the treatment of HFpEF.

7. A pharmaceutical composition for treating HFpEF, characterized in that, The invention includes a LECT2 inhibitor, wherein the inhibitor is selected from one or more of the following: shRNA targeting the LECT2 gene, antibody targeting the LECT2 protein, and antagonist targeting the LECT2 receptor.

8. The pharmaceutical composition according to claim 7, characterized in that, The LECT2 inhibitor is an shRNA that targets the LECT2 gene. It is delivered to liver tissue via the adeno-associated virus vector AAV8 to specifically silence LECT2 expression in order to improve cardiac diastolic function and reduce myocardial fibrosis and inflammatory response.

Images