Application of DRAP1 as biomarker in diagnosis and / or treatment of liver cancer

Abstract

The invention discloses an application of DRAP1 as a biomarker in diagnosis and / or treatment of liver cancer, and particularly discloses an application of a reagent for detecting DRAP1 in preparation of a product for diagnosing liver cancer, and expression of DRAP1 is up-regulated in liver cancer patients. The invention provides application of DRAP1 as a liver cancer biomarker. Database analysis, cell experiments and clinical sample verification prove that DRAP1 is a cancer promoting gene of liver cancer. On the basis of various public databases such as a DRAP1 database and a GEO database, the application of DRAP1 as a biomarker in liver cancer diagnosis and liver cancer prognosis risk assessment is provided through a bioinformatics analysis result, efficacy verification is carried out by using a large number of clinical samples, and the application of DRAP1 as a biomarker in liver cancer diagnosis and liver cancer prognosis risk assessment is provided. It is proved that DRAP1 can be used as a liver cancer biomarker to provide a prevention scheme or a treatment scheme for subjects clinically, and precise molecular treatment of liver cancer is achieved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of DRAP1 as a biomarker in the diagnosis and / or treatment of liver cancer. BACKGROUND

[0002] DRAP1 (DR1 associated protein 1) is a highly conserved protein-coding gene, and its coding product is a DR1-related auxiliary repressor protein, also known as negative regulatory factor 2 alpha subunit (NC2a). In the human body, DRAP1 is mainly highly expressed in testis, granulocytes, cerebellum and thyroid, etc., suggesting its potential role in reproduction, immunity and neural function.

[0003] The core function of DRAP1 is to participate in the transcription regulation mediated by RNA polymerase II. It forms a heterodimeric complex with DR1 (NC2β subunit) to specifically bind to the DNA sequence in the core promoter region of the gene. This complex can interact with the TATA binding protein (TBP) in the TFIID complex, preventing the transcription factors TFIIA and TFIIB from entering the pre-initiation complex, thereby inhibiting transcription initiation.

[0004] Recent studies have revealed that DRAP1 is closely related to malignant tumors, especially in multiple myeloma. Studies have confirmed that DRAP1 is highly expressed in multiple myeloma patients, and silencing the gene can significantly inhibit tumor cell proliferation, suggesting that it can be used as a biomarker for disease diagnosis and a therapeutic target. In addition, DRAP1 has also been found to be involved in the regulatory network of breast cancer and other malignant tumors, and is one of the key regulatory factors of invasive breast cancer subtypes. SUMMARY

[0005] Therefore, the present application proposes the application of a reagent for detecting DRAP1 in the preparation of a product for diagnosing liver cancer. DRAP1, as a biomarker for liver cancer, can be used to diagnose early liver cancer and predict the prognosis of patients.

[0006] The present application also proposes the application of DRAP1 as a biomarker.

[0007] The present application also proposes the application of a substance that inhibits the expression of DRAP1.

[0008] The present application also proposes a kit.

[0009] According to the first aspect of the present application, the reagent for detecting DRAP1 is used in the preparation of a product for diagnosing liver cancer.

[0010] In some embodiments of the present application, the expression of DRAP1 is up-regulated in liver cancer patients.

[0011] In some embodiments of the present application, the DRAP1 is up-regulated in tumor tissues and / or peripheral blood samples of liver cancer patients.

[0012] In some embodiments of the present application, the product detects the expression level of DRAP1 by at least one of RT-PCR, real-time fluorescent quantitative PCR, in situ hybridization, northern blotting, chip and high-throughput sequencing platform.

[0013] In some embodiments of the present application, the product for detecting the expression level of DRAP1 by in situ hybridization comprises a probe hybridized with the nucleic acid sequence of DRAP1 gene.

[0014] In some embodiments of the present application, the product for detecting the expression level of DRAP1 by chip comprises a probe hybridized with the nucleic acid sequence of DRAP1 gene.

[0015] In some embodiments of the present application, the reagent for detecting DRAP1 comprises a primer pair for amplifying DRAP1.

[0016] In some embodiments of the present application, the primer pair comprises the primer pair as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0017] In some embodiments of the present application, the product for diagnosing liver cancer can diagnose liver cancer by detecting the expression level of DRAP1 in a sample to be tested, which includes but is not limited to tumor tissues and blood samples.

[0018] According to the second aspect of the present application, it is proposed that DRAP1 is used as a biomarker for evaluating the prognosis risk of liver cancer patients.

[0019] In some embodiments of the present application, the DRAP1 is up-regulated in liver cancer patients with poor prognosis and down-regulated in liver cancer patients with good prognosis.

[0020] According to the third aspect of the present application, it is proposed that a substance for inhibiting the expression of DRAP1 is used for preparing a drug for treating and / or preventing liver cancer.

[0021] In some embodiments of the present application, the substance for inhibiting the expression of DRAP1 includes any one of antisense oligonucleotide (ASO), small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), clustered regularly interspaced short palindromic repeats (CRSIPR) system, transcription activator like effector nucleases (TALEN) system, and zinc finger nuclease (ZFN) system of DRAP1.

[0022] In some embodiments of the present application, the shRNA sequence is shown in SEQ ID NO: 3 and / or SEQ ID NO: 4.

[0023] In some embodiments of the present application, the substance for inhibiting the expression of DRAP1 further includes a carrier loaded with the ASO, siRNA, shRNA, miRNA, CRSIPR system, TALEN system, and ZFN system.

[0024] In some embodiments of the present application, the carrier includes any one of plasmid, lentivirus, adenovirus, and adeno-associated virus.

[0025] According to a fourth aspect of the present application, a kit is provided, which includes a reagent for detecting DRAP1, a nucleic acid extraction reagent, and a reverse transcription reagent.

[0026] In some embodiments of the present application, the nucleic acid extraction reagent includes TRIzol.

[0027] In some embodiments of the present application, the reverse transcription reagent includes reverse transcription polymerase, dNTPs, and RT primer.

[0028] In some embodiments of the present application, the reverse transcription polymerase includes Evo M-MLV RTase.

[0029] In some embodiments of the present application, the RT primer includes at least one of random primer and oligo dT.

[0030] In some embodiments of the present application, the reverse transcription reagent further comprises an RNase inhibitor, a gDNA removal reagent, and RNase-free water.

[0031] In some embodiments of the present application, the kit further comprises an internal reference primer pair.

[0032] In some embodiments of the present application, the internal reference primer pair is a primer pair for detecting beta-actin.

[0033] The present application has at least the following beneficial effects: The present application provides the application of DRAP1 as a biomarker for liver cancer, which is confirmed by database analysis, cell experiment and clinical sample verification that DRAP1 is a cancer-promoting gene of liver cancer. Based on various public databases such as TCGA database, GEO database and the like, the present application provides the application of DRAP1 as a biomarker in the diagnosis of liver cancer and the risk assessment of liver cancer prognosis through the results of bioinformatics analysis, and a large number of clinical samples are used for performance verification, which confirms that DRAP1 can be used as a biomarker for liver cancer to provide a prevention scheme or a treatment scheme for a subject in clinical practice, so as to realize the precise molecular treatment of liver cancer.

[0034] Additional aspects and advantages of the present application will be partially given in the following description, and partially become obvious from the following description. BRIEF DESCRIPTION OF DRAWINGS

[0035] The present application will be further described below in combination with the drawings and examples, in which: Figure 1 It is a result graph of the expression of DRAP1 in a large sample in Example 1 of the present application; wherein A is the expression of DRAP1 in TCGA large sample, and B is the immunohistochemical result of DRAP1 in liver cancer tissue (left) and normal tissue (right) in HPA public database; Figure 2 It is a result graph of the analysis of the correlation between the expression of DRAP1 and the clinical pathological characteristics of patients in Example 1 of the present application; wherein A is the expression of DRAP1 in tumor group and normal group, B is the expression of DRAP1 in paired samples, C is the expression of DRAP1 in different T stages, and D is the expression of DRAP1 in different N stages; Figure 3 It is a result graph of the analysis of the correlation between the expression of DRAP1 and the clinical pathological characteristics of patients in Example 1 of the present application; wherein A is the expression of DRAP1 in different M stages, B is the expression of DRAP1 in different AJCC Stage stages, C is the expression of DRAP1 in different Grade stages, and D is the prognosis KM curve of high and low expression groups of DRAP1 in ICGC-LIRI-JP data set; Figure 4 Figure 1 is a graph of the DRAP1 expression and prognosis analysis results of liver cancer patients in Example 1 of the present application; wherein A is the prognosis PFS KM curve in TCGA-LIHC, B is the prognosis DFS KM curve in TCGA-LIHC, C is the prognosis DSS KM curve in TCGA-LIHC, D is the prognosis KM curve in ICGC-JP data set, E is the prognosis OS KM curve in OEP000321, and F is the prognosis OS KM curve in GSE76427; Figure 5 Figure 2 is a graph of the correlation of DRAP1 and transcription factors in Example 2 of the present application; wherein A is a venn diagram of the transcription factors predicted to be correlated with DRAP1 in 4 transcription factor data, B is the expression distribution of 8 transcription factors in liver cancer and normal tissues, and C is the correlation analysis results of 4 transcription factors and DRAP1 expression; Figure 6 Figure 3 is a graph of the functional analysis results of DRAP1 in Example 2 of the present application; wherein A is the top 30 genes in liver cancer samples that are positively correlated with DRAP1 expression, B is the top 30 genes in liver cancer samples that are positively or negatively correlated with DRAP1 expression, C is a volcano plot of differential genes in DRAP1 high and low expression groups, and D is a scatter plot of the fold change and P value of the differential analysis results; Figure 7 Figure 4 is a graph of the functional analysis results of DRAP1 in Example 2 of the present application; wherein A is the GO enrichment results of DRAP1 co-expression differential genes, and B is the KEGG enrichment results of DRAP1 co-expression differential genes; Figure 8 Figure 5 is a graph of the GSEA analysis results in Example 2 of the present application; Figure 9 Figure 6 is a graph of the methylation-related analysis results in Example 3 of the present application; wherein A is the correlation analysis of DRAP1 expression and RNA m6A methylation-related genes, B is the beta value distribution of cg methylation sites in liver cancer and normal tissues, C is the correlation analysis of cg methylation sites and DRAP1 expression, and D is the relationship between cg methylation sites and the prognosis OS of liver cancer patients; Figure 10 Figure 7 is a graph of the analysis results of single-cell data in Example 4 of the present application; wherein A is the expression distribution of DRAP1 in GSE125449 data set, and B is the expression distribution of DRAP1 in GSE146409 data set; Figure 11 Figure 8 is a graph of the analysis results of DRAP1 and immunotherapy and immune escape in Example 5 of the present application; wherein A is the TIDE score distribution in different DRAP1 expression groups, and B is the EC_IPS and SC_IPS score distribution in different DRAP1 expression groups; Figure 12 Figure 6 is a result graph of the correlation analysis of DRAP1 and drug sensitivity in Example 6 of the present application; wherein, A is a correlation analysis graph of the estimated AUC value of the differential drug response analysis of DRAP1 expression and CTRP derivative compounds, B is a correlation analysis graph of the estimated AUC value of the differential drug response analysis of DRAP1 expression and PRISM derivative compounds in the GDSC database; Figure 13 Figure 7 is a result graph of the drug molecule docking of DRAP1 in Example 6 of the present application; wherein, A is the binding affinity of DRAP1 and Vemurafenib, B is the binding affinity of DRAP1 and Irinotecan, C is the binding affinity of DRAP1 and Topotecan; Figure 14 Figure 8 is a result graph of the clinical verification in Example 7 of the present application; wherein, A is the expression level of DRAP1 in 80 cases of liver cancer tissues and para-cancer tissues; B is the expression level of DRAP1 in the peripheral blood serum of 80 cases of liver cancer patients and the peripheral blood serum of normal controls; Figure 15 Figure 9 is a ROC curve graph of the expression amount of DRAP1 in serum samples in the diagnosis of liver cancer in Example 7 of the present application; Figure 16 Figure 10 is a result graph of the clinical verification in Example 7 of the present application; wherein, A is the relationship between the expression amount of DRAP1 in the peripheral blood sample and tumor metastasis, B is the relationship between the expression amount of DRAP1 in the peripheral blood sample and PVTT formation, C is the relationship between the expression amount of DRAP1 in the liver cancer tissue sample and TNM stage; Figure 17 Figure 11 is a result graph of the detection of the malignant biological behavior of the liver cancer cell line for knocking down DRAP1 in Example 8 of the present application; wherein, A is the migration, B is the invasion, and C is the self-renewal ability. DETAILED DESCRIPTION

[0036] The concept and technical effects of the present application will be described below in conjunction with the embodiments to make the purpose, features and effects of the present application clear. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0037] The reagents, methods and devices used in the present application are conventional reagents, methods and devices in the technical field, unless otherwise specified.

[0038] The TCGA-LIHC data used in the following examples comes from the TCGA database, which stands for The Cancer Genome Atlas Program. The LIHC data used in the examples contains a total of 371 tumor samples and 50 adjacent normal tissues.

[0039] The ICGC-LIRI-JP data used in the following examples comes from the ICGC database, which stands for International Cancer Genome Consortium. The ICGC-LIRI-JP data used in the examples contains a total of 212 liver cancer samples and 177 control samples.

[0040] The GSE76427 dataset used in the following examples comes from the GEO database and contains 115 liver cancer samples and 52 control samples.

[0041] The OEP000321 dataset used in the following examples comes from the NGDC database, which stands for National Genomics Data Center. The OEP000321 data used in the examples contains 158 liver cancer samples and 158 control samples.

[0042] Example 1: Expression of DRAP1 in hepatocellular carcinoma and its relationship with patient clinical characteristics and prognosis. 1. Expression of DRAP1 in hepatocellular carcinoma Analysis of DRAP1 expression in TCGA-LIHC data revealed high expression of DRAP1 in liver cancer. Figure 1 (A) Immunohistochemical results from HPA data (https: / / www.proteinatlas.org / ) also revealed differential expression of DRAP1 in large-sample hepatocellular carcinoma tissues, with DRAP1 showing high expression in hepatocellular carcinoma, such as... Figure 1 As shown in B in the figure; this obvious differential expression pattern suggests that DRAP1 is upregulated in liver cancer and may play an important role in tumor development and progression.

[0043] 2. Relationship between DRAP1 expression level and prognosis of hepatocellular carcinoma patients with different clinicopathological features This embodiment analyzed the differences in DRAP1 expression levels between tumor and normal samples based on TCGA-LIHC data, and the relationship between DRAP1 expression levels and prognosis in tumor patients with different T, N, M, AJCC stages and grades. The results are as follows: Figure 2 and Figure 3As shown in A~C; further, based on TCGA-LIHC data, the optimal cutoff value was selected and grouped using the R software survminer package, and the results were analyzed as follows. Figure 3 The Kaplan-Meier curve shown in D is shown in the figure.

[0044] Depend on Figure 2 and Figure 3 As shown in A~C, DRAP1 is highly expressed in liver cancer samples. Further analysis of 50 paired samples (i.e., 50 liver cancer cases corresponding to 50 adjacent non-cancerous tissues) revealed the same result. Figure 2 Further analysis revealed a positive correlation between DRAP1 expression and common tumor pathological and clinical staging: AJCC Stage, T Stage, N Stage, M Stage, and Grade Stage. Figure 2 C~D and Figure 3 (A~C in the table). Although some values ​​were not statistically significant, the overall trend showed a positive correlation, indicating that DRAP1 expression levels increased with the progression of liver cancer.

[0045] Depend on Figure 3 As indicated by D in the data, high expression of DRAP1 is associated with poor prognosis in patients. This suggests that DRAP1 is a specific target for liver cancer and has potential value in guiding clinical diagnosis and treatment.

[0046] Further analysis using Kaplan-Meier curves of DRAP1 expression in the large TCGA-LIHC sample revealed prognostic outcomes in PFS (Progression-Free Survival), DFS (Disease-Free Survival), and DSS (Disease-Specific Survival). The results are as follows: Figure 4 As shown in A~C. The results showed that patients with high expression of DRAP1 in liver cancer had a poor prognosis. Although the result was not statistically significant, the survival curves still clearly demonstrated that DRAP1 can be statistically considered a specific oncogene for liver cancer.

[0047] The prognostic results were further validated in three large-sample datasets (ICGC-JP: 212 samples; OEP000321: 158 samples; GSE76427: 115 samples), and the results are as follows: Figure 4 As shown in D~F. The results showed that patients with hepatocellular carcinoma who highly expressed DRAP1 had a poor prognosis, although this was not statistically significant. However, the survival curves of patients with high DRAP1 expression exhibited characteristics of a poor prognosis.

[0048] The above results based on different large sample data sets prove that DRAP1 is a pro-oncogene of liver cancer.

[0049] Example 2 Identification of DRAP1-related transcription factors and DRAP1 functional analysis 1. Identification of potential transcription factors of DRAP1 In order to comprehensively study the transcriptional regulation mechanism of DRAP1 gene expression, a multi-database integration analysis strategy was adopted, and four professional transcription factor prediction databases were used for systematic analysis. The above databases include: HTFtarget, a prediction platform based on histone modification and transcription factor binding sites; ChIP-Atlas, a public database integrating a large number of ChIP-seq experimental data; GTRD (Gene Transcription Regulation Database), a transcriptional regulation database that collects a large number of ChIP-seq data; ENCODE (Encyclopedia of DNA Elements), which provides comprehensive annotation of functional elements of human genome. Through cross-analysis of the four databases, key transcription factors that may regulate DRAP1 gene expression can be more accurately identified, thereby revealing its transcriptional regulation network.

[0050] Transcription factors are the key "switches" of gene expression, which activate or inhibit the transcription of a gene by binding to the promoter or enhancer region of the specific gene. In liver cancer, the functions of numerous transcription factors are abnormal, which together constitute a complex regulatory network, driving the occurrence, development, metastasis and drug resistance of liver cancer. By predicting the transcription factors related to DRAP1 through 4 transcription factor databases, it was found that 15 transcription factors appeared in the prediction results of the four databases at the same time (Fig. 1A). Further, analysis of the expression of these 15 transcription factors in the disease group and the normal group found that E2F6, GABPA, HCFC1, KDM5B, MAZ, BCOR, PHF8, CBFB, CHD1 showed an up-regulated trend in liver cancer (Fig. 1B). Finally, correlation analysis of these 9 significantly differentially expressed transcription factors and DRAP1 found that E2F6, HCFC1, KDM5B, MAZ had significant positive correlation with DRAP1 (Fig. 1C). Figure 5 Figure 5 Figure 5 ​​C). Previous studies have shown that E2F6 (PMID: 34339800), HCFC1 (PMID: 37283799), KDM5B (PMID: 26911146), MAZ (PMID: 40038747) are closely related to the occurrence of liver cancer. Because DRAP1 is closely related to the above transcription factors, these transcription factors closely related to the occurrence of liver cancer regulate the expression of DRAP1, promote the occurrence of liver cancer, and indirectly verify that DRAP1 is a specific biological target of liver cancer.

[0051] 2. Functional analysis of DRAP1 1) Correlation analysis: Based on the GSE76427 dataset, the correlation coefficient between all genes in the genome and the expression level of DRAP1 was calculated, and the correlation coefficient was statistically tested to determine the significantly correlated genes. This step mainly determines the genes that may be functionally related to DRAP1, providing a basis for subsequent analysis. In the significance test, genes with a correlation coefficient greater than 0.3 or less than -0.3 and a p-value less than 0.05 were retained, and finally 3056 genes were obtained. The expression heat map of the top 30 positively correlated genes is shown in Figure 6 A, and the expression heat map of the top 30 negatively correlated genes is shown in Figure 6 B.

[0052] 2) Differential expression analysis: According to the expression level of DRAP1, the samples were divided into high expression group and low expression group (using the median as the dividing point), and the limma package in R software was used for differential gene analysis. Limma is a powerful toolkit for analyzing gene expression microarray and RNA-seq data: it uses a linear model to fit expression data; applies the empirical Bayes method to adjust the variation between genes, improving the statistical performance in small sample situations; and can handle complex experimental design and batch effects. The differential gene screening uses a strict statistical threshold |log1.5 FC|>1 and adj. P. Val<0.05. Log1.5 FC>1 indicates that the gene is at least up-regulated by 1.5 times in the DRAP1 high expression group; Log1.5 FC<-1 indicates that the gene is at least down-regulated by 1.5 times in the DRAP1 high expression group; adj. P. Val<0.05 indicates that after multiple test correction, the difference is still statistically significant. The results are visualized by the volcano plot in R software, and the results are shown in Figure 6 C and D; a total of 1164 differential genes were identified, of which 847 genes were up-regulated in the high expression group and 371 were down-regulated.

[0053] 3) Gene enrichment analysis: To understand the biological significance of differential genes, GO and KEGG enrichment analysis were performed on the 1164 differentially co-expressed genes. GO enrichment analysis can evaluate the enrichment of differential genes in three main areas: biological process (BP), molecular function (MF), and cellular component (CC), which helps to understand the biological processes and functions involved in differential genes. KEGG enrichment analysis can evaluate the enrichment of differential genes in known biological pathways, which helps to identify key signaling pathways affected by DRAP1 expression. Using h.all.v2025.1.Hs.symbols.gmt as the reference gene set, the results are shown in A and B of Figure 7 The results show that DRAP1-related differentially expressed genes are mainly involved in mitotic core processes such as cell cycle, chromosome separation, and DNA replication, and their abnormalities can lead to chromosomal instability and genomic abnormalities, thereby driving the occurrence and development of liver cancer.

[0054] Finally, GSVA is a non-parametric, unsupervised method for evaluating the enrichment of gene sets in samples. Compared with traditional enrichment analysis, GSVA can calculate the gene set enrichment score of individual samples, which is more suitable for comparison between samples. Through GSEA analysis, it was found that the DRAP1 high expression group was mainly related to E2F_TARGETS, G2M_CHECKPOINT, and MITOTIC_SPINDLE pathways ( Figure 8 ). Previous articles have reported that E2F_TARGETS (PMID: 37198038), G2M_CHECKPOINT (PMID: 39966861), and MITOTIC_SPINDLE (PMID: 28360097) are closely related to the occurrence and development of liver cancer.

[0055] The above results show that DRAP1 is closely related to the occurrence and development of liver cancer, and DRAP1 interacts with related genes to jointly regulate gene expression in the occurrence and development of liver cancer, promoting tumor occurrence.

[0056] Example 3 Relationship between DRAP1 and methylation m6A methylation drives liver cancer proliferation, metastasis, and drug resistance by regulating the stability and translation of oncogenic and tumor suppressor mRNAs, and is a potential new therapeutic target. This example analyzes the relationship between DRAP1 and m6A-related methylation genes, and the results show that 18 m6A-related methylation genes show significant positive correlation, and the results are shown in Figure 9The expression of A shown in FIG. 1A specifically includes RBM15B, VIRMA, IGF2BP2, HNRNPA2B1, IGF2BP1, IGF2BP3, HNRNPC, RBM15, RBMX, METTL3, WTAP, YTHDF1, YTHDF2, ALKBH5 and DRAP1, and the expression of the m6A-related methylation genes is positively correlated.

[0057] Methylation is closely related to liver cancer. Methylation drives the transformation and progression of normal liver cells to cancer cells by abnormally changing the expression pattern of genes. This is an epigenetic change. MEXPRESS is an online tool designed specifically for visualizing and interpreting cancer genomic data, with a particular focus on the relationship between gene expression, DNA methylation, and clinical data. This tool integrates multi-omics data from the TCGA (The Cancer Genome Atlas) project, providing an intuitive and interactive data visualization interface that allows researchers to easily explore the expression patterns of individual genes in different cancer types and their association with clinical characteristics and epigenetic modifications. By analyzing the relationship between methylation cg sites related to DRAP1 and clinical characteristics in TCGA-LIHC samples through the online analysis website MEXPRESS (https: / / mexpress.ugent.be / ), a total of 15 methylation sites related to DRAP1 were finally found. Next, the distribution of beta values of these 15 methylation cg sites in liver cancer and normal tissues was analyzed, and finally 4 cg sites were found to have significant correlation (p<0.01), and the correlation analysis results are shown in FIG. 1B. Figure 9 Finally, the correlation of these 4 cg sites with DRAP1 expression was analyzed, and finally 4 cg sites were found to have significant correlation, of which cg16420888 and cg10467098 showed positive correlation (FIG. 1C); through prognosis KM curve analysis (median as grouping critical value), it was found that cg16420888 and cg10467098 were related to the prognosis of patients (FIG. 1D). Figure 9 Figure 9

[0058] The above results show that DRAP1 and m6A-related methylation genes are closely related to the occurrence of liver cancer, DRAP1 and m6A-related methylation genes interact to promote the occurrence of liver cancer, and DRAP1 is a specific target of liver cancer.

[0059] Example 4 Analysis of the role of DRAP1 in tumor microenvironment based on single cell sequencing ​​The occurrence and development of tumors cannot be separated from the immune system. The rise of immunotherapy is changing the paradigm of treatment. Understanding the interaction between tumor cells and the immune system and the changes in the tumor microenvironment is crucial for the development of new immunotherapies. In order to obtain information about DRAP1 at the single-cell level, single-cell data analysis was performed, and the single-cell data was derived from TISCH 2.0. TISCH 2.0 (Tumor Immune Single-cell Hub 2.0) is a comprehensive single-cell transcriptome database and analysis platform focusing on the characterization of immune cells in the tumor microenvironment.

[0060] The results obtained by analyzing two sets of single-cell data (GSE125449 and GSE146409) are shown in Figure 10

[0061] As shown in Figure 10 DRAP1 is expressed highest in Mono / Macro and Fibroblasts. Mono / Macro and Fibroblasts are closely related to the occurrence of liver cancer, and both are key stromal cells in the tumor microenvironment (TME) of liver cancer, which promote the occurrence, progression and immune escape of liver cancer by mediating chronic inflammation, immune suppression and tissue fibrosis. Mono / Macro promotes immune suppression: tumor-associated macrophages (TAMs) are usually polarized to the M2 phenotype that promotes tumors, and inhibit the function of killer immune cells such as T cells by expressing PD-L1, secreting immune suppressive factors (such as TGF-β, IL-10), etc., helping liver cancer cells to escape immune surveillance. Activated fibroblasts (i.e. cancer-associated fibroblasts, CAFs) are the main effector cells of liver fibrosis / cirrhosis, a precancerous lesion of liver cancer. They produce a large amount of extracellular matrix (ECM) such as collagen, form a physical barrier, promote cirrhosis and increase the risk of liver cancer.

[0062] The above results suggest that DRAP1 may be a target for regulating monocytes / macrophages and fibroblasts, and plays an important role in promoting liver cancer.

[0063] Example 5 Effect of DRAP1 on immune therapy response and immune escape ​Tumor Immune Dysfunction and Exclusion (TIDE) is an algorithm used to predict the response of cancer patients to immune checkpoint inhibitors (such as PD-1 / PD-L1 inhibitors). The algorithm is based on gene expression data in tumor samples, analyzing the correlation between each gene and the level of cytotoxic T lymphocyte (CTL) infiltration and its effect on patient prognosis. A higher TIDE score indicates significant immune suppression and T cell exclusion effect in the tumor microenvironment, suggesting that the immune therapy response may be poor.

[0064] The scores of the predicted immune phenotype (effector cells, suppressor cells) were calculated using the R software IOBR package deconvo_ips function. The TIDE score was analyzed from the TIDE database, and the data source was http: / / tide.dfci.harvard.edu / (December 2023). The immune evasion and immune dysfunction of the DRAP1 high and low expression groups in TCGA data were analyzed, and the results are shown in Figure Figure 11 A. The results showed that the TIDE score of the DRAP1 high expression group was significantly higher than that of the low expression group. The high expression of DRAP1 gene was closely related to the dysfunction of tumor immune microenvironment and immune cell exclusion, suggesting that this type of tumor may have a poor response to immunotherapy. At the same time, this feature also reflects that DRAP1 high expression hepatocellular carcinoma is more invasive and poses a greater challenge to clinical treatment.

[0065] Further, the immune function of effector cells (EC-IPS) and suppressor cells (SC-IPS) in DRAP1 high and low expression hepatocellular carcinoma was predicted using the R software IOBR package deconvo_ips function, and the results are shown in Figure Figure 11 B. The results showed that the suppressor cell (SC-IPS) score of the DRAP1 high expression group was significantly higher than that of the low expression group, and the effector cell (EC-IPS) score of the high expression group was significantly lower than that of the low expression group.

[0066] The above results indicate that DRAP1 high expression hepatocellular carcinoma has immune suppression and is not conducive to immune effector therapy, further indicating that DRAP1 is a specific biological target for hepatocellular carcinoma.

[0067] Example 6 Correlation analysis of DRAP1 expression and drug sensitivity 1) Relationship between DRAP1 expression level and small molecule drug IC50: To analyze the drug sensitivity of potential drug targeting target DRAP1, the present embodiment performed correlation analysis based on drug sensitivity data of cancer cell lines (CCLs) downloaded from Cancer Therapeutic Response Portal (CTRP v.2.0, https: / / portals.broadinstitute.org / ctrp / ) and Pan-Cancer Analysis of Solid Tumors (https: / / depmap.org / portal / ). First, compounds with more than 20% missing data were excluded. After merging, K-Nearest Neighbor (k-NN) merging method was used to merge the missing AUC values. Two different methods were determined according to the drug response spectrum obtained from CTRP and PRISM, respectively, to determine the candidate drugs with higher drug sensitivity in high-risk score patients.

[0068] Cancer Therapeutic Response Portal (CTRP) and Pan-Cancer Analysis of Solid Tumors (PRISM) datasets contain gene expression analysis and drug sensitivity analysis of hundreds of cancer cell lines (CCLs), which can be used to establish predictive models of drug response. Compounds with NA in more than 20% of samples were excluded. Finally, 354 compounds corresponding to 680 CCLs in the CTRP dataset and 1285 compounds corresponding to 480 CCLs in the PRISM dataset were used for subsequent analysis. To determine the potential therapeutic drugs for TCGA-LIHC patients, CTRP and PRISM datasets were used for analysis, respectively, and the results are shown in Figure 12 Irinotecan, Vemurafenib and Topotecan were finally screened out as three small molecule drugs related to liver cancer. Among them, Irinotecan is a topoisomerase I inhibitor; Vemurafenib is a kinase inhibitor targeting BRAF V600E mutation; Topotecan is a semi-synthetic camptothecin derivative and a topoisomerase I inhibitor.

[0069] 2) Molecular docking simulation: In the molecular docking part, the Pubchem database was searched to determine the name, molecular weight and 3D structure of the small molecule drug, and then the 3D structure corresponding to the DRAP1 protein was downloaded from the RCSB PDB database (http: / / www.rcsb.org). The AutoDock Vina software (http: / / vina.scripps.edu / ) was used to prepare the ligand and protein for molecular docking. For the DRAP1 protein, its crystal structure needs to be pre-processed, including removing water molecules, hydrogenation, modifying amino acids, optimizing energy, and adjusting force field parameters, so as to obtain the low-energy conformation of the ligand structure. Finally, the DRAP1 protein structure and small molecule drug structure were docked using Autodock1.5.7 and Vina software. The affinity (kcal / mol) value represents the binding ability of the two. The more stable the binding of the ligand and the receptor, the lower the affinity value. Finally, Pymol was used to visualize the results, and the results are shown in FIG. 6. Figure 13

[0070] The results showed that the binding affinity of DRAP1 and Irinotecan was -10.8 kcal / mol, the binding affinity of DRAP1 and Vemurafenib was -10.4 kcal / mol, and the binding affinity of DRAP1 and Topotecan was -9.4 kcal / mol. The above results show that liver cancer with high expression of DRAP1 can be treated with targeted drugs, which indirectly indicates that DRAP1 is a target for targeted therapy of liver cancer, and also suggests that DRAP1 is a specific biomarker for liver cancer.

[0071] Example 7 Verification of clinical samples In order to verify the prediction accuracy of DRAP1 as a biomarker in clinical practice, this embodiment collects 80 matched liver cancer tissue samples, adjacent normal liver tissue samples, liver cancer patient peripheral venous serum samples and 80 peripheral blood serum samples of healthy controls. The liver cancer patient samples are all taken from liver cancer patients diagnosed in Shenzhen People's Hospital; all patients enrolled meet the following criteria: 1) have not received any chemotherapy or radiotherapy; 2) have not been diagnosed with other cancers, autoimmune diseases, infectious diseases, etc.; all tissue samples are collected by biopsy or surgical resection, washed with normal saline and stored in liquid nitrogen for detection.

[0072] The gene expression level of DRAP1 in the above clinical tissue samples and serum samples was detected by qRT-PCR, and the nucleic acid extraction and detection method was as follows: ​Total RNA was extracted using a TriZol kit (Thermo Fisher Scientific). cDNA was obtained by reverse transcription of the total RNA using a Prime Script qRT-PCR kit (Bio-Rad). The expression level of DRAP1 was then detected by qRT-PCR using a Fast Start Universal SYBR Green Master system on an ABI 7500 real-time PCR system (Thermo Fisher). β-actin was used as an internal control for relative quantification. The sequences of the specific primers used are shown in Table 1. The qRT-PCR results are as follows: Figure 14 As shown in A in the diagram.

[0073] Table 1 Primer sequence information for qRT-PCR

[0074] Depend on Figure 14 As shown in A, the expression level of DRAP1 in hepatocellular carcinoma tissue and peripheral blood serum of hepatocellular carcinoma patients was significantly higher than that in adjacent tissue and peripheral blood serum of healthy controls, indicating that DRAP1 is a specific biological target of hepatocellular carcinoma.

[0075] Alpha-fetoprotein (AFP) is currently the most widely used biomarker for liver cancer in clinical practice. AFP is closely related to the occurrence, development, and progression of liver cancer. To further verify DRAP1 as a specific target for liver cancer, this embodiment performs a correlation analysis on the AFP detection level and DRAP1 expression level in liver cancer patients. The Pearson correlation coefficient between the expression levels of these two genes was directly calculated using statistical software R or a statistical language. The results are as follows: Figure 14 As shown in B in the figure. The results showed that AFP and DRAP1 were significantly positively correlated, indicating that DRAP1 is a specific target for liver cancer.

[0076] To evaluate the diagnostic efficacy of DRAP1 in hepatocellular carcinoma (HCC), ROC curves were plotted to assess the diagnostic efficacy of qRT-PCR in distinguishing HCC tissue from normal tissue. The relative expression level of the DRAP1 gene in HCC tissue measured by qRT-PCR was used as the diagnostic variable, and the histopathological diagnosis (HCC / normal) was used as the state variable. ROC curves were calculated and plotted, and the results are shown below. Figure 15 As shown in the figure. The results showed that AUC=76%, indicating that the expression level of the DRAP1 gene has good discriminative ability as a diagnostic indicator and its accuracy in the diagnosis of liver cancer is high.

[0077] The expression amount of DRAP1 in peripheral blood serum has been verified in the diagnosis of liver cancer. In order to further verify the accuracy of DRAP1 in clinical practice, 80 liver cancer samples, paracancer samples and peripheral blood samples were verified. Liver cancer metastasis and portal vein tumor thrombus (PVTT) formation are markers of liver cancer progression, indicating disease progression, limited treatment options and poor prognosis.

[0078] The expression amount of DRAP1 in liver cancer tissue of liver cancer patients with in situ liver cancer (59 cases) and metastatic liver cancer (21 cases), without PVTT (65 cases) and with PVTT (15 cases) was analyzed. It was found that the expression amount of DRAP1 in metastatic liver cancer was greater than that in in situ cancer (A in Figure 16 The expression amount of DRAP1 in metastatic liver cancer was greater than that in in situ cancer (A in Figure 16 The expression amount of DRAP1 in metastatic liver cancer was greater than that in in situ cancer (A in

[0079] The above 80 liver cancer patients were further classified according to TNM staging. The expression amount of DRAP1 in liver cancer tissue samples was counted according to different tumor stages, and the results are shown in C in Figure 16 The results showed that the expression amount of DRAP1 was positively correlated with the clinical stage of liver cancer. Although N and M staging did not have statistical significance, the expression was up-regulated with the progression of clinical staging. With the progression of the disease, DRAP1 was up-regulated. This result again supports DRAP1 as a clinically relevant liver cancer progression marker. Its expression is enhanced in the late stage of the disease, showing the potential as a prognostic indicator and therapeutic target.

[0080] Example 8 DRAP1 knockdown model verification To further verify the role of DRAP1 in liver cancer, the liver cancer cell line HuH-7 was used as a cell model, and shRNA for specific knockdown of DRAP1 was designed and transfected, and then compared with the negative control group (cells transfected with non-targeting scramble sequence). The change in malignant biological behavior of the cells was observed. The specific shRNA was obtained from Genechem, and the specific sequence of DRAP1 shRNA was: SS Sequence: CGAGCAAGAAGAAGAAGUACA (SEQ ID NO: 3); AS Sequence: UACUUCUUCUUCUUGCUCGGC (SEQ ID NO: 4).

[0081] For cell transfection, Lipofectamine 3000 from Invitrogen was used for transfection according to the manufacturer's instructions.

[0082] Regarding the cell migration experiment, the cells were cultured in cell culture plates until the entire bottom of the well was covered (100% confluence), and a sterile 200 μL gun head or a special scraper was used to make a uniform "scratch" in all the wells. The detached cells were washed off with PBS, and serum-free basal medium was added (to eliminate the interference of serum proliferation and mainly observe migration). After 48 hours of culture, the scratch width of the experimental and control groups was compared at the same position under a microscope. If the scratch closure rate of the knockdown group is significantly slower than that of the control group, it indicates that the knockdown of DRAP1 inhibits the migration ability of the cells. The experimental results are shown in Fig. A of Figure 17 , which shows that, compared with the control group, the scratch closure rate of the DRAP1 knockdown group is significantly slowed down, indicating that the absence of DRAP1 can inhibit the migration ability of the liver cancer cells.

[0083] Regarding the cell invasion experiment, a Transwell chamber was used, and a layer of Matrigel was coated on the polycarbonate membrane to simulate the extracellular matrix barrier. The cells with DRAP1 knocked down and the control cells were resuspended in serum-free medium and added to the upper chamber of the Transwell. Serum-containing medium was added to the lower chamber as a chemical attractant. After 24-48 hours of culture, the cells in the upper chamber that did not invade were gently wiped off with a cotton swab. The cells that penetrated the Matrigel and the membrane to reach the lower chamber were fixed and stained. The cells in the lower chamber were counted under a microscope or photographed and analyzed using image software, and the results are shown in Fig. B of Figure 17 . The results show that the number of cells that penetrated the membrane in the DRAP1 knockdown group is significantly reduced compared with the control group, proving that the DRAP1 gene plays a key role in promoting the invasion of liver cancer cells.

[0084] Regarding the cell stem cell property experiment, the cells in the knockdown group and the control group were inoculated at a low density (500-2000 cells per well for a 96-well plate) in an ultra-low adsorption culture plate and cultured in serum-free special medium for 1 week. ImageJ and other software were used to measure the diameter of the cell spheres or calculate their area, and the results are shown in Fig. C of Figure 17 . The results show that after DRAP1 is knocked down, the cell sphere-forming ability is significantly reduced, as shown by the decrease in the diameter of the spheres and the number of spheres. This result suggests that DRAP1 is an important molecule for maintaining the self-renewal and stem cell properties of liver cancer cells.

[0085] In summary, the present application proves through multiple analyses and experiments that DRAP1 can be used as a biomarker for the diagnosis and prognosis prediction of liver cancer, and DRAP1 plays a key role in the occurrence and development of liver cancer, and can affect the malignant biological behavior of tumor cells, promote tumor metastasis and immune escape.

[0086] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a reagent for detecting DRAP1 in the preparation of a product for diagnosing liver cancer.

2. Use according to claim 1, characterized in that, The DRAP1 is up-regulated in expression in a liver cancer patient.

3. Use according to claim 1, characterized in that, The product detects the expression level of DRAP1 by at least one of RT-PCR, real-time fluorescent quantitative PCR, in situ hybridization, northern blotting, chip and high-throughput sequencing platform.

4. Use according to claim 3, characterized in that, The reagent for detecting DRAP1 comprises a primer pair for amplifying DRAP1.

5. Use according to claim 4, characterized in that, The primer pair comprises a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO:

2.

6. Use of DRAP1 as a biomarker in the risk assessment of prognosis of a liver cancer patient.

7. Use of a substance for inhibiting the expression of DRAP1 in the preparation of a drug for treating and / or preventing liver cancer.

8. Use according to claim 7, characterized in that, The substance for inhibiting the expression of DRAP1 comprises any one of antisense oligonucleotide, siRNA, shRNA, miRNA, CRSIPR system, TALEN system and ZFN system of DRAP1.

9. Use according to claim 8, characterized in that, The shRNA sequence is as shown in SEQ ID NO: 3 and / or SEQ ID NO:

4.

10. A kit characterized in that, The kit comprises a reagent for detecting DRAP1, a nucleic acid extraction reagent and a reverse transcription reagent.

Images