Molecular marker related to rabbit fur weight, detection method and application of molecular marker

Abstract

The invention relates to a molecular marker related to rabbit fur weight, a detection method and application thereof, and belongs to the technical field of rabbit molecular marker breeding. The molecular marker is SNP (Single Nucleotide Polymorphism) and is located at 1222295bp of a chromosome 1 of a reference genome of a Kangbig meat rabbit, the polymorphism of the molecular marker is A / T, and the weight of fur of an individual rabbit with the genotype of AA is maximum. According to the SNP site and the detection method provided by the invention, a molecular marker-assisted breeding technology for rabbit fur characters can be established, and the molecular marker-assisted breeding technology is applied to genetic improvement of the fur weight and quality of rabbits and improvement of rabbit fur value and breeding benefits.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular marker breeding of domestic rabbits, and particularly relates to a molecular marker related to rabbit fur weight, a detection method and application thereof. BACKGROUND

[0002] Rabbit fur is an important economic product, and its quality and yield directly affect the profitability and competitiveness of rabbit breeding. High-quality rabbit fur usually has a larger area and weight, thus having a significant sales advantage in the fur market and effectively improving the economic benefits of rabbit breeding. In actual production, it is found that rabbits with thick fur usually have stronger disease resistance and environmental adaptability, and grow faster. However, the existing technology can only analyze and select rabbits according to their phenotypes, and the fur quality is difficult to accurately determine on the live body, and the determination after rabbit slaughter cannot be used for selection, so the breeding of this trait has been limited.

[0003] Modern molecular breeding technology can use molecular markers closely related to rabbit fur traits to breed fur performance. Rabbit fur weight can reflect the thickness, area and thickness of fur, and is an important selection trait for breeding. However, the fur weight trait is controlled by many genes, and the effect of most molecular markers is small, which lacks application value. Therefore, it is of particular importance to use molecular markers with large genetic effects and high breeding value for molecular breeding to improve rabbit fur weight. SUMMARY

[0004] The present application provides a molecular marker related to rabbit fur weight, a detection method and application thereof to overcome the shortcomings of the prior art, To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: In a first aspect, the present application provides a SNP site related to rabbit fur weight, which is located at base position 1222295 of chromosome 1 of the Kangda meat rabbit reference genome. The polymorphism of the SNP site base is A / T. The Kangda meat rabbit reference genome has a project number of PRJNA1020055 in the NCBI BioProject database.

[0005] In a second aspect, the present application provides a SNP molecular marker related to rabbit fur weight, and the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO: 1. The SNP molecular marker is located at base position 285 of the nucleotide sequence shown in SEQ ID NO: 1, and the genotype of this site has A / T mutation, including TT, TA and AA genotypes.

[0006] In a third aspect, the present application provides a primer set for detecting the SNP molecular marker of the second aspect, wherein the primer set comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3.

[0007] In a fourth aspect, the present application provides a detection reagent for detecting the SNP molecular marker of the second aspect, comprising the primer set of the third aspect.

[0008] In a fifth aspect, the present application provides use of the SNP molecular marker of the second aspect, the primer set of the third aspect or the detection reagent of the fourth aspect in identifying a rabbit individual with superior fur weight.

[0009] In a sixth aspect, the present application provides use of the SNP molecular marker of the second aspect, the primer set of the third aspect or the detection reagent of the fourth aspect in breeding a rabbit individual with superior fur weight.

[0010] In a seventh aspect, the present application provides a method for identifying a rabbit individual with superior fur weight, comprising the following steps: (1) using the primer set of the third aspect to perform PCR amplification on a template of genomic DNA of a rabbit to be tested; (2) sequencing the amplification product and determining the genotype of the SNP site according to the sequencing result; (3) an individual with a genotype of AA has a significantly higher fur weight than individuals with a genotype of TT or TA, and the individual with a genotype of AA is taken as a rabbit individual with superior fur weight.

[0011] In an eighth aspect, the present application provides a method for breeding a rabbit individual with superior fur weight, comprising the following steps: (1) using the primer set of the third aspect to perform PCR amplification on the nucleotide sequence containing the SNP molecular marker of the second aspect; (2) performing genotyping on the amplification product to screen out an individual with a genotype of AA at the 285th position of the nucleotide sequence of the second aspect; (3) breeding the individual with a genotype of AA in step (2) as a breeding rabbit.

[0012] As a preferred embodiment of the present application, the reaction system of the PCR amplification is as follows: 1 μL of DNA template, 0.5 μL of each of the upstream and downstream primers, and 10 μL of PCR Mix.

[0013] As a preferred embodiment of the present application, the reaction procedure of the PCR amplification is: 94℃, 3min; 94℃, 25s, 56-60℃, 20s, 72℃, 10s, 28 cycles; 72℃, 5min; 4℃, ∞.

[0014] Compared with the prior art, the present application has the following beneficial effects: The application discloses a molecular marker associated with a rabbit fur weight-related gene or genotype, verifies the influence effect of the molecular marker on a rabbit fur weight trait, and establishes an efficient and accurate molecular marker-assisted breeding technology, which is applied to genetic improvement of a rabbit fur weight trait. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A gel electrophoresis map of the DNA segment of the screened molecular marker (M lane represents a 2000bp Marker molecular weight standard, and 2000bp Marker molecular weight bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom).

[0016] Figure 2 A gene sequencing peak map of a PCR amplification product of the screened molecular marker. DETAILED DESCRIPTION

[0017] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with specific examples.

[0018] Example 1: Screening of SNP sites and analysis of association with phenotypes I. Experimental method 1. Test sample collection The test rabbit group is composed of 1512 V-line meat rabbits from Qingdao Kangda Rabbit Company Limited, and the rabbit group environment and feeding conditions are consistent. Ear tissue samples of all test rabbits are collected and stored in 75% ethanol for extraction of rabbit genomic DNA (the specific method is described in the instruction manual of a blood / cell / tissue genomic DNA extraction kit produced by Beijing Tiangen Biochemical Technology Co., Ltd.).

[0019] 2. Rabbit fur weight determination All rabbits in this experiment were raised in single cages, and were slaughtered at 70 days of age according to the unified feeding standards. The rabbit skins were stripped from the third tail vertebra, the upper end of the radius bone, and the middle segment of the tarsal bone, and did not include the rabbit head. The weight of the rabbit skin was recorded, and the data was processed and the abnormal values were removed.

[0020] 3. Extraction and detection of rabbit genomic DNA The blood / cell / tissue genomic DNA extraction kit (TIANamp Genomic DNA Kit) produced by Beijing Tiangen Biochemical Technology Co., Ltd. was used to extract rabbit genomic DNA from rabbit ear tissue, and the specific operation steps were as follows: 1) The sample taken from the rabbit ear tissue was crushed into a cell suspension with an ophthalmic surgical scissors (cleaned with alcohol before use), centrifuged at 10,000 rpm for 1 min, and the supernatant was poured out. Add 200 μL buffer GA and shake until completely suspended.

[0021] 2) Add 20 μL of proteinase K solution, mix well, and digest overnight at 56°C in a water bath until the tissue is dissolved.

[0022] 3) Add 200 μL of buffer GB, mix well by inverting, and place at 70°C for 10 minutes. The solution should be clear, and centrifuge at 2000 rpm for 3 seconds to remove water droplets from the inner wall of the cap.

[0023] 4) Add 200 μL of anhydrous ethanol, mix well by shaking for 15 seconds. At this time, a flocculent precipitate may appear. Centrifuge at 2000 rpm for 3 seconds to remove water droplets from the inner wall of the cap.

[0024] 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid. Place the adsorption column CB3 back into the collection tube.

[0025] 6) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid. Place the adsorption column CB3 into the collection tube.

[0026] 7) Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid. Place the adsorption column CB3 into the collection tube.

[0027] 8) Repeat step 7.

[0028] 9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for a few minutes to completely dry the residual rinse solution in the adsorption material.

[0029] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0030] 11) Mix 2 μL of the DNA solution obtained in the previous step with 1 μL of loading buffer, load the mixture onto a 1% agarose gel, and perform electrophoresis at 120V for approximately 20 minutes. Observe the electrophoresis results under UV light and take photographs to determine the integrity of the DNA. Use a NanoDrop 2000 nucleic acid and protein analyzer (Thermo Fisher Scientific, USA) to perform quality testing on the extracted DNA. An A260 / A280 ratio between 1.7 and 2.1, and an A260 / A230 ratio between 1.8 and 2.2 are considered acceptable. Take 50–100 ng of the extracted DNA for 1% agarose gel electrophoresis. Observe the results under an imaging system; concentrated and bright bands indicate good extraction results.

[0031] 4. Genotype determination and quality control of genotype data Genomic DNA samples extracted from ear specimens of 1512 rabbits were analyzed for SNP loci using low-depth resequencing. The raw genotype data of all individuals were subjected to quality control using PLINK software, with SNP callrate >90%, minimum allele frequency (MAF) >0.01, and a p-value <10 for the Hardy-Weinberg equilibrium (HWE) test. -6 The standard is based on indicators such as a sample call rate > 90%.

[0032] 5. Data processing and analysis 1) Phenotypic data analysis Descriptive statistical analysis was performed on the rabbit fur weight measurements using R statistical analysis software, including calculating the mean, standard deviation, maximum and minimum values ​​of this trait.

[0033] 2) Genome-wide association analysis GWAS analysis was performed using GMAT 2.0 software. The applicant used the following mixed model to analyze the data. The model is as follows:

[0034] where y is the vector of phenotypic traits; X represents the vector of covariates (PCA principal components obtained from population deconstruction analysis); β represents the vector of corresponding coefficients, including the intercept term; Z represents the vector of marker genotypes; α represents the effect size of the marker; Wμ represents the vector of random polygenic effects, and e is the vector of random residuals.

[0035] 3) Test the significance of SNP-trait association.

[0036] When a SNP meets the condition of P < 2.47 x 10 -6 , we consider that the SNP reaches the genome-wide level of significance.

[0037] 4) SNP annotation In the self-constructed Kangda meat rabbit reference genome (NCBI BioProject database project number PRJNA1020055) gene annotation database, a self-written Python script is used to annotate the SNP, that is, to determine the chromosome where the SNP site is located and its physical position on the chromosome.

[0038] II. Experimental results After annotating the screened SNP site, it is found that the SNP site is located at the 1222295 base position of chromosome 1 of the Kangda meat rabbit reference genome, showing A / T polymorphism, and the gene fragment containing the SNP site is shown in SEQ ID NO: 1.

[0039] 5'-GCCTCTTGGACCAGACTCCTTAACAGATCATCTTATTAGGGCCTAGGGGTAGAGCTGAAACTCTGCATATTTGTGTTTGATTATTTTCCACCTGTAAGTTTGCTGTGTAACGACTGGAAGTTCCGTCTTCTCTCCGCTCCGCTGACTGCCCCCACCCTCTCCCCAGTTCACTAGTGCAGTTCCACCTTGTTTTTCCCTGGCAGACCCGCATCCTGGTGTGATGCTTGTGTGGCCACACCAGCCCCACCGCCCCCTGACCCCCTGACCCCAGGGAGGCGTCCCAC NGAGACCCTGTGTGAACTGGAAGCTGAGTTTGTCCCATCAGAGCTGGCCCCGTTCTCAAAGAAGGGCCAACCTGGCTTGGGCAGACCCAGCAGAACCGTCCCCAGGGCCAGCGGGGCAGCCCAGTGGGGTGACCTCCCGGCTCCTCGGTGGGGCTGGCTGTGTGTGGGGTAGTGATGTCCTTCCC-3' (SEQ ID NO: 1, wherein "N" at the 285th bp of the sequence is a SNP site, N represents A or T) The following Table 1 shows the effect of A / T polymorphism of the 1222295bp variation site of rabbit chromosome 1 (or the 285th site of the sequence shown in SEQ ID NO: 1) on the fur weight of the Kangda V line meat rabbit population; the greater the fur weight value, the better, wherein * indicates significant difference, P < 0.05; ** indicates extremely significant difference P < 0.01; the trait value in the table is the average ± standard error. The analysis results of fur weight of different genotypes are shown in Table 1.

[0040] Table 1: Comparison of genotype distribution and fur weight of Kangda V line meat rabbit population

[0041] As can be seen from Table 1, the differences in fur weight among the three genotypes are extremely significant, among which the fur weight of the individual with genotype AA is the largest, the fur weight of the individual with genotype TT is the smallest, and the fur weight of the individual with genotype TA is in the middle. For rabbit fur weight, the A gene is a positive gene, and the T gene is a negative gene. Further statistics show that the additive effect of the A gene is 67.81g, and the dominant effect between A / T genes is -7.17g.

[0042] Example 2 Verification of the correlation between SNP site genotype and rabbit fur weight 1. Experimental method (1) Detection of rabbit fur weight: A verification population of V line meat rabbits was used to verify the correlation between SNP site genotype and rabbit fur weight, all verification rabbits were free to eat and drink, and were raised in cages according to the unified feeding standard. At 70 days of age, the rabbits were slaughtered, and the rabbit fur was stripped from the distal end of the 3rd tail vertebra, the upper end of the ulna bone, and the middle segment of the tarsal bone, excluding the rabbit head part, and the rabbit fur weight was recorded; and the data was arranged and processed, and abnormal values were removed.

[0043] (2) Amplification of the SNP site: The primer for amplifying the gene fragment (i.e., SEQ ID NO: 1) containing the SNP site was designed according to the SNP site information obtained by screening in Example 1 by Primer Premier 5.0 software, and was synthesized by Shanghai Bioengineering Technology Co., Ltd. The primer pair sequence is as follows: Upstream primer (SEQ ID NO: 2): 5'-GCCTCTTGGACCAGACTC-3'; Downstream primer (SEQ ID NO: 3): 5'-GGGAAGGACATCACTACC-3'.

[0044] The extracted DNA was used as a template, and PCR amplification was performed according to the designed primer: The ear tissue samples of all the verification rabbits were collected and stored in 75% ethanol, and the rabbit genomic DNA was extracted, and PCR amplification was performed according to the designed primer: 1 μL of DNA template, 0.5 μL of each primer shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 10 μL of PCR Mix reagent (2xM5 Taq HiFi PCR Mix, Mei5bio); the PCR amplification system was set as follows: 94°C, 3 min; 28 cycles (94°C, 25 s; 56-60°C, 20 s; 72°C, 10 s); 72°C, 5 min; 4°C, ∞.

[0045] 2. Experimental results: (1) After the completion of PCR amplification, the PCR product was detected by electrophoresis in 1% agarose gel, and the results are shown in Figure 1 The amplified target fragment was about 469 bp in size.

[0046] The sequencing of the amplification product was performed, and the genotype of the SNP site was determined according to the sequencing results, and the results are shown in Figure 2 Through sequence alignment, it was found that the base T at position 285 in the nucleotide sequence shown in SEQ ID NO: 1 was mutated to A, or by using peak chart to screen mutation point, different peaks appeared at the target sequence site, indicating that base mutation occurred at this site.

[0047] (2) The genotype of the SNP site in the verification population and the distribution of the fur weight are shown in Table 2.

[0048] Table 2. Genotype and fur weight distribution in the verification rabbit population

[0049] As shown in Table 2, the individual with AA genotype has the highest fur weight, the individual with TT genotype has the smallest fur weight, and the individual with TA genotype has the middle fur weight in the validation rabbit group, which is consistent with the result of Example 1.

[0050] Therefore, in the above rabbit group, the individual with AA genotype of the mutation site at 1222295bp on chromosome 1 (or the 285th site of the sequence shown in SEQ ID NO: 1) can genetically improve the fur weight of the rabbit group, achieve the purpose of breeding meat rabbit breeds with excellent fur weight, obtain high-quality rabbit fur, and improve the economic benefits of rabbit breeding.

[0051] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, but not to limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. A SNP locus associated with rabbit coat weight, characterized in that, The SNP site is located at base 1222295 of chromosome 1 of Kangda meat rabbit reference genome; the polymorphism of the SNP site base is A / T; the Kangda meat rabbit reference genome is PRJNA1020055 in the NCBI BioProject database.

2. A SNP molecular marker associated with rabbit coat weight, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown as SEQ ID NO:

1. The SNP molecular marker is located at base 285 of the nucleotide sequence shown in SEQ ID NO:1, and the genotype of the site has A / T mutation, including TT, TA and AA genotypes.

3. A primer set for detecting the SNP molecular marker of claim 2, characterized in that, The primer set includes an upstream primer with a nucleotide sequence shown as SEQ ID NO:2 and a downstream primer with a nucleotide sequence shown as SEQ ID NO:

3.

4. A detection reagent for detecting the SNP molecular marker according to claim 2, characterized by, The primer set of claim 3.

5. The SNP molecular marker of claim 2, the primer set of claim 3 or the detection reagent of claim 4 is applied to identifying rabbit fur weight advantage individuals.

6. The SNP molecular marker of claim 2, the primer set of claim 3 or the detection reagent of claim 4 is applied to breeding rabbit fur weight advantage individuals.

7. A method for identifying a rabbit fur weight advantage individual, characterized in that, The method comprises the following steps: (1) using the primer set of claim 3 to perform PCR amplification on the template with the genomic DNA of the rabbit to be tested as the template; (2) sequencing the amplification product, and judging the genotype of the SNP site of claim 2 according to the sequencing result; (3) the individual with genotype AA has significantly higher fur weight than the individuals with genotype TT and genotype TA; the individual with genotype AA is used as the rabbit fur weight advantage individual.

8. A method of breeding a rabbit fur weight advantage individual, characterized by, The method comprises the following steps: (1) using the amplification primer set of claim 3 to perform PCR amplification on the nucleotide sequence containing the SNP molecular marker of claim 2; (2) genotyping the amplification product to screen out the individual with genotype AA at base 285 of the nucleotide sequence of claim 2; (3) keeping the individual with genotype AA in step (2) as a breeding rabbit.

9. The method of claim 7 or 8, wherein, The reaction system of the PCR amplification is: DNA template 1 μL, upstream and downstream primers each 0.5 μL, PCR Mix 10 μL.

10. The method of claim 7 or 8, wherein, The reaction program of the PCR amplification is: 94℃, 3min; 94℃, 25s, 56-60℃, 20s, 72℃, 10s, 28 cycles; 72℃, 5min; 4℃, ∞.

Images