Molecular marker for high-throughput identification of wheat scab site Qfhb7EL and application thereof

Abstract

The invention discloses a molecular marker for high-throughput identification of a wheat scab site Qfhb7EL and application of the molecular marker. The nucleotide sequences of primers of the molecular marker are as shown in SEQ ID No. 1 to SEQ ID No. 5. A primer is designed by using a specific sequence M7EL-13 on a diploid agropyron elongatum 7EL chromosome, the primer and an Actin gene of wheat form a primer pair, population typing is realized under recognition of different fluorescence, and the reliability of the marker is verified through a molecular experiment. Results show that the identification of the wheat scab-resistant site Qfhb7EL in the wheat background can be quickly and accurately realized in a high-throughput manner, and the method has a very high application value for auxiliary selection of new wheat scab-resistant varieties.

Description

[0001] This application claims priority to the Chinese patent application No. 2024119263977, filed on December 25, 2024, entitled “Molecular marker for high-throughput identification of wheat scab locus Qfhb7EL and application thereof”, the entire content of which is incorporated herein by reference. TECHNICAL FIELD

[0002] The present application belongs to the technical field of wheat genetic breeding, and specifically relates to a molecular marker for high-throughput identification of wheat scab locus Qfhb7EL and application thereof. Qfhb7EL BACKGROUND

[0003] Scab (FHB) is a kind of fungal disease, which can cause yield reduction of crops such as wheat, corn and barley, and can also contaminate food and feed products, causing great hidden dangers to food safety. The resistance of wheat scab is controlled by multiple genes. More than 600 QTLs related to scab resistance have been located in wheat and its relatives. Through Meta-QTL analysis, 77 QTLs with high confidence have been obtained, but most of them have weak effects. Only 8 QTLs have been officially named internationally. Fhb1 Fhb8 However, only Qfhb7EL has been widely used in wheat scab resistance breeding. Fhb1

[0004] Thinopyrum elongatum has high scab resistance and is an important genetic resource for improving wheat scab resistance. Many studies have shown that there is a major scab resistance locus on the 7th homoeologous group of Thinopyrum elongatum. For example, Professor Kong Lingjia's team from Shandong Agricultural University cloned the GST encoded by the 7th homoeologous group of Thinopyrum elongatum, which can catalyze the formation of GSH-DON conjugates from DON and GSH, thereby reducing the toxicity of DON and improving the scab resistance of wheat. In addition, introducing the 7el2L chromosome fragment carrying Qfhb7EL into wheat can improve the scab resistance of wheat, indicating that the 7el2L chromosome fragment carrying Qfhb7EL has potential value in scab resistance breeding. In addition, it has also been found that the 7EL chromosome from diploid Thinopyrum elongatum also carries genes for scab resistance in wheat, and introducing the 7EL chromosome fragment into common wheat can also provide scab resistance, indicating that the 7EL chromosome fragment from diploid Thinopyrum elongatum also has potential value in scab resistance breeding. Fhb7 Fhb7

[0005] ​​​​​The previous identification of 7EL adopts the marker of agarose electrophoresis, which is an electrophoresis technique commonly used in molecular biology research, and the principle thereof is mainly to separate and identify DNA by using the moving speed difference of charged molecules under the action of an electric field. Although the operation of agarose gel electrophoresis is simple, it is particularly time-consuming when thousands of materials are identified. Therefore, it is of great significance to develop a method capable of rapidly and high-throughput identifying target genes for the identification of 7EL. SUMMARY

[0006] In view of the problems of time-consuming and labor-consuming in identifying the wheat 7EL chromosome fragment by the above-mentioned agarose electrophoresis method, the present application provides a molecular marker for high-throughput identification of wheat scab site Qfhb7EL and application thereof, which can rapidly and high-throughput identify the 7EL chromosome fragment, provides a new tool for molecular detection of practical value for breeding high-yield and high-quality wheat varieties, and speeds up the breeding process.

[0007] In order to achieve the above-mentioned purpose, in one aspect, the present application provides a molecular marker primer for high-throughput identification of wheat scab site Qfhb7EL , and the nucleotide sequence of the molecular marker primer is shown in SEQ ID No. 1-SEQ ID No. 5.

[0008] SEQ ID No. 1 (PARMS-Actin-HEX): GAAGGTCGGAGTCAACGGATTCAACTTGGCCTGACCTCATGT SEQ ID No. 2 (PARMS-Actin-Common): GGCTACCTAACGATCAATCAGC SEQ ID No. 3 (PARMS-M7EL-13-FAM): GAAGGTGACCAAGTTCATGCTACCCTAGCCTGTTAGGTTTGAG SEQ ID No. 4 (PARMS-M7EL-13-Common): TGAAAAGCAATCCAGCAAACAC.

[0009] The application utilizes a specific sequence M7EL-13 on the 7EL chromosome in diploid long ear wild out to design a specific primer, the nucleotide sequence of which is shown as SEQ ID No.5, and a primer pair is formed with the Actin gene of wheat, population typing is realized under the recognition of different fluorescence, and the reliability of the marker is verified through a molecular experiment. Qfhb7EL The method proposed in the application can quickly, accurately and high-throughput realize the identification of the wheat scab resistance site in the wheat background, and has high application value for assisting the selection of new wheat varieties resistant to wheat scab.

[0010] SEQ ID No.5: CCGCGAGGAGTTCAAGCAGAAGAACCCCAAGAACAAGTCCGTCGCCGCCGTAAGTTCCTTCCAACAAAAATCCCCACTCCCGATTTCTTCTGTATACCAGCATGTAGTAGAAATTAATCTGCCAGGCGCTGTAGATAGGATCATGATCCGGGAACTGATTAGTTGCTTCCGCTGTAATTTCTTTTTATTCAGGTCGGCAAAGCAGCCGGTGAGAGGTGGAAGAGCTTGAGCGAATCGGTAAGCTTTTGTTGCTGACCCGGCTTCCGATTAACCCTAGCCTGTTAGGTTTGAGTAATACGCTGCTTTGTTGAAGCTTGCCTGACATGTGTTTGCTGGATTGCTTTTCA.

[0011] The second aspect of the application provides a molecular marker for high-throughput identification of a wheat scab site Qfhb7EL , which is formed by amplification of the above-mentioned molecular marker primer.

[0012] The molecular marker is closely linked to the functional site, has the advantages of high resolution and accurate typing, and is very suitable for the high-efficiency detection demand of large-scale genetic lines of excellent genotypes in breeding practice, and can also assist in realizing the aggregation of multiple sites / gene types resistant to scab and other excellent traits, and accelerating the breeding of new wheat varieties with excellent comprehensive traits.

[0013] The third aspect of the application provides the application of the above-mentioned molecular marker in wheat breeding resistant to scab.

[0014] The fourth aspect of the application provides a molecular marker for high-throughput identification of a diploid long ear wild out site resistant to wheat scab Qfhb7ELThe method is that the DNA of the wheat material to be tested is amplified by PCR using the primer pair, if the DNA extracted from the wheat material to be tested contains the anti-scab site Qfhb7EL ; if the DNA extracted from the wheat material to be tested contains the anti-scab site Qfhb7EL .

[0015] Specifically, the signal value of the DNA extracted from the wheat material to be tested containing the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer group and not containing the fluorescent group signal of the forward competitive primer PARMS-M7EL-13-FAM is aggregated near the Y axis and displayed in green; the signal value of the DNA extracted from the wheat material to be tested containing the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer group and the fluorescent group signal of the forward competitive primer PARMS-M7EL-13-FAM is aggregated at the diagonal line near the X axis and the Y axis and displayed in red.

[0016] Specifically, the PCR amplification reaction system comprises 5 μL of 2×PARMS master mix, 0.15 μL of primer PARMS-M7EL-13-FAM with a concentration of 10 μM, 0.2 μL of primer PARMS-M7EL-13-Common with a concentration of 10 μM, 0.15 μL of primer PARMS-Actin-HEX with a concentration of 10 μM, 0.2 μL of primer PARMS-Actin-Common with a concentration of 10 μM, 10-100 ng of genomic DNA, and finally ddH2O is added to 10 μL.

[0017] Specifically, the PCR amplification procedure comprises 94℃ hot activation for 20 min, 94℃ denaturation for 20 s, 65-57℃ annealing and extension for 1 min, 10 touch-down cycles, each cycle decreasing by 0.8℃, 94℃ denaturation for 20 s, 57℃ recombination for 1 min, and 32 cycles.

[0018] By the technical solution, the following beneficial effects are achieved: The anti-scab site provided by the application Qfhb7ELThe end of diploid Elytrigia elongata 7EL chromosome, the site is introduced into wheat can significantly improve the resistance of wheat to scab, using the site of Elytrigia elongata specific sequence M7EL-13 to develop a marker suitable for PARM system, for identifying resistant scab sites Qfhb7EL The developed marker has the characteristics of stable amplification, convenient and fast detection, accurate and reliable results, and can be used for assisted breeding of wheat resistance to scab, meets the needs of large-scale genetic line excellent genotype detection in breeding practice, and is not limited by the growth and development cycle of crops, saves breeding cost, and improves breeding efficiency. At the same time, it can also be used for the aggregation of multiple sites / genes of scab resistance, and accelerate the breeding of new varieties resistant to wheat scab. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Physical mapping of the scab resistance site in Example 1, wherein A: Qfhb7EL Physical mapping of the A: Qfhb7EL site, B: Qfhb7EL Molecular markers present in the B: Figure 2 Analysis of molecular marker M7EL-13 and wheat scab resistance in Example 1; Figure 3 Analysis of the sequence of the amplified fragment of molecular marker M7EL-13 and the wheat reference genome in Example 2; Figure 4 Genotyping map of the PARM primer set in Example 4, wherein A: Yangmai 24 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map, wherein B: Yangmai 25 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map, wherein C: Yangmai 29 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map, wherein D: Yangmai 30 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map, wherein E: Yangmai 158 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map, wherein F: Ningmai 13 / Yangnongmai 158 hybrid F3 generation PARM primer set genotyping map; Figure 5is the electrophoresis result of the primer identified by Yangmai 24 / Yangnongmai 158 M7EL-13 in Example 4, wherein M: Marker; 1: 22-1; 2: 22-2; 3: 22-3; 4: 22-4; 5: 22-5; 6: 22-6; 7: 22-7; 8: 22-8; 9: 22-9; 10: 22-10; 11: 22-11; 12: 22-12; 13: 22-13; 14: 22-14; 15: 22-15; 16: 22-16; 17: 22-17; 18: 22-18; 19: 22-19; 20: Yangmai 24; 21: Yangnongmai 158; Figure 6 is the scab resistance analysis of the F3 generation of Yangnongmai 158 hybrid in Example 4, wherein A: statistical analysis of the scabby spike rate of the F3 generation of Yangmai 24 / Yangnongmai 158 hybrid; B: spike disease phenotype of the F3 generation of Yangmai 24 / Yangnongmai 158 hybrid; C: statistical analysis of the scabby spike rate of the F3 generation of Yangmai 25 / Yangnongmai 158 hybrid; D: spike disease phenotype of the F3 generation of Yangmai 25 / Yangnongmai 158 hybrid; E: statistical analysis of the scabby spike rate of the F3 generation of Yangmai 29 / Yangnongmai 158 hybrid; F: spike disease phenotype of the F3 generation of Yangmai 29 / Yangnongmai 158 hybrid; G: statistical analysis of the scabby spike rate of the F3 generation of Yangmai 30 / Yangnongmai 158 hybrid; H: spike disease phenotype of the F3 generation of Yangmai 30 / Yangnongmai 158 hybrid; I: statistical analysis of the scabby spike rate of the F3 generation of Yangmai 158 / Yangnongmai 158 hybrid; J: spike disease phenotype of the F3 generation of Yangmai 158 / Yangnongmai 158 hybrid; K: statistical analysis of the scabby spike rate of the F3 generation of Ningmai 13 / Yangnongmai 158 hybrid; L: spike disease phenotype of the F3 generation of Ningmai 13 / Yangnongmai 158 hybrid. DETAILED DESCRIPTION

[0020] The specific embodiments of the present application are described in detail below. It should be understood that the specific embodiments described herein are merely illustrative and explanatory of the present application and are not intended to limit the present application.

[0021] Example 1 Anti-wheat scab site Qfhb7EL positioning The applicant identified the scab resistance of the created small fragment translocation line carrying the diploid Elytrigia repens 7EL chromosome, and combined the specific molecular markers of the 7EL chromosome developed by the research group to physically locate the anti-scab site. The results showed that there was an anti-scab site Qfhb7EL ( Figure 1 ) at the end of the 7EL chromosome. In order to clarify the scab resistance effect of Qfhb7EL , the applicant introduced the Qfhb7EL site into different wheat backgrounds, and used molecular markers to Qfhb7ELSite identification revealed that different wheat backgrounds carried... Qfhb7EL The diseased spikelet rate of the material at the locus was significantly lower than that of the non-carrier material. Qfhb7EL The material of the site ( Figure 2 Furthermore, the marker M7EL-13 showed a significant negative correlation with the incidence of diseased spikelets in Fusarium head blight (r = -0.42, P < 0.001). ANOVA analysis revealed that the average incidence of diseased spikelets in materials carrying the M7EL-13 marker was 10.94%, while the average incidence in materials without the M7EL-13 marker was 43.91%, with a highly significant difference between the two groups (F = 359.362, P < 0.001). The phenotypic variation explained by this marker was R² = 0.81, indicating that the marker can effectively distinguish between resistant and susceptible families and is closely associated with Fusarium head blight resistance loci (Table 1).

[0022] Table 1. Regression analysis of molecular marker M7EL-13 and resistance to Fusarium head blight

[0023] a. Predictor variables: (constant), M7EL b. Dependent variable: PSD% Example 2 Amplification of the M7EL-13 sequence DNA was extracted from the translocation line Yangnongmai 158, which carries the 7EL chromosome fragment of diploid *Thinopyrum longicornis*. After passing the tests, the M7EL-13 sequence was cloned from the DNA using the high-fidelity enzyme 2×Phanta Master Mix (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China). Sequencing and alignment revealed that the amplified sequence was a chromosome-specific sequence of *Thinopyrum longicornis* 7EL. Figure 3 ).

[0024] Example 3: Primer design and identification in PARMS To amplify the M7EL-13 sequence and the stably expressed Actin gene sequence in wheat, multiple sets of amplification primers were designed using Primer Premier5, with PCR product size controlled at approximately 100 bp. The quality of the designed primers was evaluated using DNAMAN, and primer specificity was further detected using the Ensembl Plants wheat genome database. Finally, primer sequences that specifically bound and met the requirements of PCR amplification were selected, and the 5' ends of these primers were augmented with the fluorophores FAM and HEX. These primers were named PARMS-M7EL-13-FAM / Common and PARMS-Actin-HEX / Common.

[0025] Example 4: Identification of the 7EL chromosome fragment Utilizing sites carrying resistance to Fusarium head blight Qfhb7ELWheat-diploid Thinopyrum elongatum 7EL small fragment translocation line Yangnong wheat 158 was crossed with different genetic background common wheat Yangmai 24, Yangmai 25, Yangmai 29, Yangmai 30, Yangmai 159 and Ningmai 13 to prepare hybrid combinations and construct segregation populations. In 2021, F1 seeds of each combination were mixed and harvested. In 2022, 100 ears were randomly selected from the F2 generation of each combination, and were sown in the fall of 2022, with 1 row per ear, 1 meter in length, and 0.3 meters in row spacing. After germination, sampling was performed, with 12 single plants per row, 1200 single plants per combination, and a total of 7200 single plants. Leaves with a length and width of about 1 cm were placed in deep well plates (96-well 1.2 mL); 100 μL of 0.3 M sodium hydroxide was added, and complete grinding was performed on a tissue grinder; after grinding, 3000 rpm centrifugation was performed for 1 min, and a boiling water bath was used for 2 min; after adding 200 μL of 0.2 M Tris-HCl (pH 6.8-7.0) and mixing, a boiling water bath was used again for 2 min; after the water bath, 3000 rpm centrifugation was performed for 1 min, and the supernatant was diluted 20-fold and used as a template for subsequent PCR amplification.

[0026] The PCR amplification reaction system was configured as required, and the ratio of each reagent was as follows: the total reaction volume was 10 μL, including: 5 μL of 2×PARMS master mix, 0.15 μL of primer PARMS-M7EL-13-FAM with a concentration of 10 μM, 0.2 μL of primer PARMS-M7EL-13-Common with a concentration of 10 μM, 0.15 μL of primer PARMS-Actin-HEX with a concentration of 10 μM, 0.2 μL of primer PARMS-Actin-Common with a concentration of 10 μM, 10-100 ng of genomic DNA, and finally ddH2O was added to 10 μL. The prepared PCR system was placed in a PCR instrument for amplification, and the specific program was as follows: 94°C heat activation for 20 min; 94°C denaturation for 20 s, 65-57°C annealing and extension for 1 min (10 touch-down cycles, each cycle decreasing by 0.8°C); 94°C denaturation for 20 s, 57°C recombination for 1 min, 32 cycles. After PCR was completed, the fluorescence signal was read using a TECAN infinite M1000 enzyme marker, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain clear and intuitive typing charts, and the genotype results were output according to the different colors.

[0027] If the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set appears in the wheat material to be tested (the fluorescence signal value is aggregated near the Y axis, and the sample shows green), and the fluorescent group signal of the forward competitive primer PARMS-M7EL-13-FAM does not appear, it is considered that the DNA extracted from the wheat material to be tested is of good quality, and the wheat material to be tested does not contain the site resistant to scab Qfhb7EL If the fluorescent group signal of the forward competitive primer PARMS-Actin-HEX of the PARMS primer set appears in the wheat material to be tested, and the fluorescent group signal of the forward competitive primer PARMS-M7EL-13-FAM also appears (the fluorescence signal value is aggregated near the diagonal line of the X axis and the Y axis, and the sample shows red), it is considered that the DNA extracted from the wheat material to be tested is of good quality, and the wheat material to be tested contains the site resistant to scab Qfhb7EL Figure 4 .

[0028] In order to determine the accuracy of the developed PARMS primer set, 10 materials were randomly selected from all samples, and the published M7EL-13 molecular marker was used for identification. The results show that the results of agarose gel electrophoresis identification are consistent with the results of the developed PARMS primer set (Table 1 and Table 2), thereby further proving the accuracy of the PARMS primer set, and the wheat background has no effect on the accuracy of the PARMS primer set. Figure 5

[0029] Table 2: Statistics of the results of the PARMS primer set and the M7EL-13 molecular marker

[0030] In order to determine the identification of the scab resistance of the materials, the single flower dripping method was used to identify the scab resistance of the sampled materials. The results are shown in Table 3. Figure 6 Under different wheat genetic backgrounds, the wheat material carrying the site resistant to scab Qfhb7EL has a significantly lower disease spike rate than the wheat material not carrying the site resistant to scab Qfhb7EL and the parent variety. It is proved that the developed PARMS primer set has the characteristics of stable amplification, convenient, fast, high-throughput, accurate and reliable results, and is not affected by the wheat genetic background, and can be used for assisted breeding of wheat resistant to scab.

[0031] The preferred embodiments of the present application are described in detail above, but the present application is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.

[0032] ​​It should be noted that various technical features described in the above detailed description are capable of being combined in any suitable manner, and that the application is not limited to the specific combinations described in the above detailed description, which are provided for illustrative purposes only.

[0033] Furthermore, the various embodiments of the application can also be combined with each other, as long as it does not violate the spirit of the application, it should also be considered as disclosed by the present application.

Claims

1. A method for high-throughput identification of wheat Fusarium head blight sites Qfhb7EL Molecular marker primers, characterized in that, The nucleotide sequences are shown in SEQ ID No. 1-SEQ ID No.

5.

2. A method for high-throughput identification of wheat scab sites Qfhb7EL Molecular markers, characterized by, It is formed by amplification using the molecular marker primers described in claim 1.

3. The application of the molecular marker described in claim 2 in wheat scab resistance breeding.

4. High-throughput identification of resistance loci in diploid long-spike wheatgrass to wheat scab. Qfhb7EL The method is characterized by, include: Using the primers described in claim 1, PCR amplification is performed on the DNA of the wheat material to be tested. If the fluorescent group signal value of the wheat material to be tested aggregates near the Y-axis and shows green, it is considered that the DNA extracted from the wheat material to be tested does not contain sites of resistance to Fusarium head blight. Qfhb7EL If the fluorescent signal values ​​of the wheat material being tested aggregate near the diagonal lines of the X and Y axes and appear red, then the DNA extracted from the wheat material is considered to contain sites of resistance to Fusarium head blight. Qfhb7EL .

5. The method according to claim 4, characterized in that, The PCR amplification reaction system included: 5 μL of 2×PARMS master mix, 0.15 μL of 10 μM primer PARMS-M7EL-13-FAM, 0.2 μL of 10 μM primer PARMS-M7EL-13-Common, 0.15 μL of 10 μM primer PARMS-Actin-HEX, 0.2 μL of 10 μM primer PARMS-Actin-Common, 10-100 ng of genomic DNA, and finally, ddH2O to a final volume of 10 μL.

6. The method according to claim 4, characterized in that, The PCR amplification program included: 94℃ heat activation for 20 min; 94℃ denaturation for 20 s, annealing and extension at 65-57℃ for 1 min, 10 touch-down cycles, with the temperature decreasing by 0.8℃ per cycle; 94℃ denaturation for 20 s, 57℃ annealing for 1 min, 32 cycles.

Images