Camellia sinensis scr0319t2 and application thereof

By screening and identifying the Camellia sinensis SCR0319T2 strain, the stability and yield issues of the Enoki mushroom strain during the subculturing process were solved, achieving efficient mycelial growth and fruiting body production with high vitamin B1 and niacin content, suitable for food and industrial applications.

CN121406464BActive Publication Date: 2026-03-17GUANGDONG XIANGQIN BIOLOGICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing enoki mushroom strains are prone to problems such as mycelial aging, uneven fruiting, and reduced yield during subculturing. Furthermore, cultivated varieties have weakened disease resistance and reduced genetic diversity.

Method used

A strain of Camellia filiformis, SCR0319T2, was screened and identified as Flammulina filiformis through molecular biology. Subculture revealed that it exhibits excellent stability and high levels of vitamin B1 and niacin. A specific compound culture medium was used to maintain stable mycelial growth and high yield.

Benefits of technology

Camellia oleifera SCR0319T2 can still grow stably after more than 30 generations. It has a fast mycelial growth rate, high fruiting body yield, and high content of vitamin B1 and niacin, making it suitable for large-scale industrial production and food applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121406464B_ABST
    Figure CN121406464B_ABST
Patent Text Reader

Abstract

The application discloses a Camellia japonica SCR0319T2 strain and application thereof. The Camellia japonica SCR0319T2 strain is collected and screened from the wild, and is identified by molecular biology to belong to Flammulina filiformis After subculture, it is found that the Camellia japonica SCR0319T2 strain has excellent stability, can stably grow after more than 30 generations, has a low elimination rate, can be used as an industrial large-scale production strain, and has a fast spawn production speed and a short production cycle. After detection, it is found that the fruiting body has higher contents of vitamin B1 and nicotinic acid than common varieties, is resistant to storage, and has a good taste.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fungal strains, and particularly to a Camellia sinensis strain SCR0319T2 and its applications. Background Technology

[0002] Enoki mushrooms are an important wood-rotting edible fungus, widely favored for their rich nutrition and delicious taste. However, during long-term subculturing, their strains are prone to degeneration, including mycelial aging, uneven fruiting, and decreased yield. This is mainly due to multiple factors such as gene mutations, karyotype changes, viral infections, and nutritional stress. To maintain strain stability, current research focuses on genetic variation and phenotypic changes during subculturing. For example, subculturing on sawdust media can significantly slow down mycelial degeneration, and phenotypic traits (mycelial growth rate, fruiting body yield, etc.) remain stable after six consecutive generations. However, genomic analysis shows that genetic differences reach 7.92% by the fifth generation, indicating an asynchronous relationship between phenotypic stability and genetic variation.

[0003] At the genetic level, cultivated *Flammulina velutipes* exhibits characteristics such as smaller genome size, reduced genetic diversity, and loss of disease-resistant genes compared to wild species. For example, the loss of genes involved in the degradation of β-lactam antibiotics and genes in the MAPK signaling pathway during domestication leads to weakened resistance of cultivated varieties to pathogens. Population genome studies divided *Flammulina velutipes* into four subgroups, with significantly reduced heterozygosity in cultivated strains. Furthermore, pan-genome association analysis (PAV-GWAS) identified key genes (such as FfB and FfD) regulating cap color and stipe length, providing molecular targets for targeted breeding.

[0004] In terms of technological applications, optimization strategies for subculture of fungal strains include culture medium improvement and hybridization breeding. Sawdust culture, containing nutrients such as lignocellulose, enhances the activity of extracellular enzymes in mycelia, increasing mycelial growth rate and fruiting body yield in 8 out of 11 tested strains, and improving agronomic traits (such as cap dryness and stipe hardness). Liquid spawn technology shortens the cultivation cycle, reduces contamination rates, and enhances strain viability through intelligent control. Future research needs to further elucidate the regulatory mechanisms of genetic drift during subculture and integrate genomic technologies to optimize disease resistance and quality traits. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a Camellia velvet plant SCR0319T2.

[0006] Another object of the present invention is to provide the application of the above-mentioned Camellia umbellatus SCR0319T2.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A Camellia velvet plant, SCR0319T2, was collected from Yunnan Province and obtained through manual selection. Its name is... Flammulina filiformis Camellia velvet SCR0319T2.

[0009] The Camellia umbellatus SCR0319T2 specimen, with accession number GDMCC No:66720, was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0010] The nucleotide sequence of the ITS sequence of the Camellia oleifera SCR0319T2 is shown in SEQ ID NO.1.

[0011] The nucleotide sequence of the 18S rDNA sequence of Camellia umbellatus SCR0319T2 is shown in SEQ ID NO.2.

[0012] The Camellia umbellatus SCR0319T2 exhibits excellent subculturing stability. After being subcultured more than 30 times on plates, its mycelium can still grow stably, and the fruiting bodies grow normally, resulting in stable yield.

[0013] The fruiting body of the Camellia arborescens SCR0319T2 has a high content of vitamin B1 and niacin.

[0014] The application of Camellia umbellatus SCR0319T2 in the production of Camellia umbellatus fruiting bodies.

[0015] The application of the aforementioned Camellia Root SCR0319T2 in the production of foods rich in vitamin B1 and niacin.

[0016] A method for culturing Camellia oleifera SCR0319T2 includes the following steps:

[0017] Camellia sinensis SCR0319T2 was inoculated onto a mother culture plate to obtain the mother culture. Then, it was inoculated onto a compound culture medium and cultured until the mycelium was fully grown. The fruiting bodies were scratched to produce fruiting bodies, which were then harvested after they matured.

[0018] The compound culture medium is formulated as follows: 35.5% corn cob, 2.9% rice bran, 12.8% wheat bran, 4.8% cottonseed hulls, 4% beet pulp, 10% corn flour, 5% soybean hulls, 5% brewer's grains, 1.7% shell powder, and 0.6% quicklime, all by weight percentage. Water is added and stirred to control the final moisture content at 66 wt%, and the pH is adjusted to 6.4.

[0019] The present invention has the following advantages and effects compared with the prior art:

[0020] This invention screened a Camellia sinensis plant, SCR0319T2, collected from the wild, and identified it as belonging to the [genus name missing] by molecular biology. Flammulina filiformis Through subculturing, it was found to have excellent stability, maintaining stable growth even after more than 30 subcultures with a low attrition rate, making it suitable for large-scale industrial production. Furthermore, its mycelial growth rate is rapid, resulting in a short production cycle. Testing of the fruiting bodies revealed higher levels of vitamin B1 and niacin compared to common varieties, and the mushrooms are also more durable and have a better taste. Attached Figure Description

[0021] Figure 1 These are comparative images of the fruiting bodies of Camellia japonica SCR0319T2 and Enoki mushroom XHJ0124B in Example 1; the left image is Camellia japonica SCR0319T2 and the right image is Enoki mushroom XHJ0124B.

[0022] Figure 2 This is a phylogenetic tree analysis result of Camellia sinensis SCR0319T2 and Enoki mushroom XHJ0124B in Example 1;

[0023] Figure 3 These are microscopic comparison images of the mycelial morphology of Camellia japonica SCR0319T2 and Enoki mushroom XHJ0124B in Example 1; the left image is Camellia japonica SCR0319T2 and the right image is Enoki mushroom XHJ0124B.

[0024] Figure 4 This is a comparison of mycelial growth of Camellia sinensis SCR0319T2 and Enoki mushroom XHJ0124B on the surface of the culture bottle in Example 2; where the left image is Camellia sinensis SCR0319T2 and the right image is Enoki mushroom XHJ0124B.

[0025] Figure 5 This is a comparison chart of the growth of Camellia japonica SCR0319T2 and Enoki mushroom XHJ0124B from the 1st to the 15th generation in Example 2;

[0026] Figure 6 This is a comparison chart of the growth of Camellia japonica SCR0319T2 and Enoki mushroom XHJ0124B during the 20th to 30th generations in Example 2. Detailed Implementation

[0027] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0028] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0029] Example 1: Hybridization, purification, and identification of the strain

[0030] 1.1 Isolation and hybridization of strains

[0031] (1) Collect wild strains from Yunnan, isolate and label fruiting body tissues;

[0032] (2) Disinfect the surface of the above-mentioned fruiting bodies. On the ultra-clean workbench, use a sterile scalpel to pick out the tissue block at the center of the fruiting body, at the junction of the stipe and cap.

[0033] (3) The above tissue blocks were placed in PDA solid medium for culture to obtain multiple mycelia;

[0034] (4) Select strains with uniform and stable growth, dense and neat mycelium and few powdery spores, and conduct fruiting tests on them respectively;

[0035] (5) Count the fruiting time and observe the morphology of the fruiting body. Select strains with excellent traits as parents and perform single-spore hybridization. The offspring are then tested in steps (3) to (4).

[0036] (6) Repeat the above steps multiple times to select a strain with excellent growth performance. After 30 generations, it still maintains strong mycelial growth, neat colony morphology, and dense white, uniform mycelium without pollen spores and can produce fruit normally. It is named SCR0319T2.

[0037] 1.2 Molecular biological identification

[0038] Strain SCR0319T2 was sent to the Guangdong Provincial Microbial Culture Collection Center for molecular biological identification. Sequencing was performed using 18S rDNA and ITS primers. After comparison with the NCBI database, this strain was found to be similar to... Flammulina velutipes The homology was 99.41%, and it was consistent with... Flammulina filiformis The homology was 99.27%, and the strain SCR0319T2 was preliminarily identified as... Flammulina filiformis The bacterium was deposited at the Guangdong Provincial Microbial Culture Collection Center on July 21, 2025, and named... Flammulina filiformis Camellia velvet SCR0319T2, with accession number GDMCC NO.66720, is located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0039] ITS sequencing results:

[0040] TTGAGGTCAATGGTCAATAGTTTTTCCACCAGGGGGACGGTTAGAAGCGGAATAGCCCGCGCACTCGCGCCACAGGTATCTCTCGTGAGAGAGAAGGCAAAGGGAAGCACCAACTAAGGCGAAACCACTTCAGAGACGAGACGAGCGCTACAACACAGTCAGCCCAGCCATAGCCGTAGATAATTATCACAGCTGCAGCGCGCCAAAAGGTAACGGTTTCTGCTAATGCATTTCAGGGGAGCTGAACCCAAAGATAAGGTCCAGCAAGCCCCCACGTCCAATCCGCCAGCTCACAACAAAGTGAGGGAGGTTGAGAAGTTACTGACACTCAAACAGGCATGCCCTTCGGAGTACCAAAGGGCGCAAGGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTTAGTTTAAAGGACAGTGAAGTCCAATAATCAATGACATTCGTTACATACTATAGTGTTTGTAAGACATAGGCCTGGAAGGCAAAGGGAGCGCAAAAAGCGCACCCTTCCAATGGGGTATCCAGACCTACAGAGTGTGCACAGGTGGACGAAGAAAGCTGCAACCCCAGACGTGCACGTACGAAGAACCCGTGAGGGTCCTC;

[0041] 18S rDNA sequencing results:

[0042] AATTTGTACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTATTTGATGATACCTTGCTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCATTAAAGCCCCGACTTCTGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCGGCTCGCCGCTCGTTTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGCATCATTCAAATATCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACAGGGAGGTAGTGACAATAAATAACAATATAGGGCTCTTTTGGGTCTTATAATTGGAATGAGTACAATTTAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTCAGGCTCGGTCGGGCGGTCCGCCTCACGGCGTGTACTGTCTGACTGGGTCTTACCTCTTGGTGAGCCAGCGTGGCCTTTATTGGTTGCGTTGGGGAACCAGGACTTTTACCTTGAGAAAATTAGAGTGTTCAAAGCAGGCCTATGTCTGAATACATTAGCATGGAATAATAGAATAGGACGTGCGATCCTATTTTGTTGGTTTCTAGAGTCGCCGTAATGATTAATAGGGATAGTTGGGGGCATTGGTATTGAGTCGCTAGAGGTGAAATTCTTGGATTGACTCAAGACCAACTATTGCGAAAGCATTTGCCAAGGATGTTT。

[0043] 1.3 Control setting

[0044] To conduct a control experiment, a production strain of *Flammulina velutipes* closely related to SCR0319T2 was screened from laboratory-preserved strains for comparison (hereinafter referred to as *Flammulina velutipes* XHJ0124B, which is deposited at the Guangdong Provincial Microbial Culture Collection Center). The results of molecular biological identification (ITS sequencing) of this strain at the Guangdong Provincial Microbial Culture Collection Center showed that it was similar to... Flammulina filiformis The homology was 99.44%, and it is very close to SCR0319T2 in taxonomy. The phylogenetic analysis results are as follows: Figure 2 As shown.

[0045] 1.4 Morphological observation

[0046] The fruiting body morphology of strain SCR0319T2 after fruiting is as follows: Figure 1 As shown, this strain is similar to the yellow enoki mushroom XHJ0124B in the early fruiting stage, with both the cap and stem being yellow. After growing to about 3 cm, the cap gradually turns dark reddish-brown, the cap opens flat, the surface is smooth and the edges are slightly curled. The stem is generally 3-7 cm long, thicker and darker in color than the yellow enoki mushroom XHJ0124B.

[0047] The hyphae of the two strains were observed under a microscope, such as... Figure 3 As shown, the clamp connections of *Enoki mushroom XHJ0124B* are relatively less than those of *Camellia sinensis*.

[0048] Example 2: Subculture experiment of the strain

[0049] 2.1 Preparation of experimental materials

[0050] 2.1.1 Preparation of the mother culture

[0051] Camellia sinensis SCR0319T2 and Enoki mushroom XHJ0124B were selected as mother cultures to verify their transgeneration stability. The strains were transferred to PDA solid medium (formula: 200g potato peeling and boiling extract, 20.0g glucose, 16g agar, 0.5g anhydrous MgSO4, 1.0g K2HPO4, 1g bacteriological peptone, 2g soybean meal, and distilled water to a final volume of 1000mL, pH at natural) for activation to obtain the mother cultures.

[0052] 2.1.2 Preparation of Mother Culture Test Tubes

[0053] While heating and stirring the PDA solid culture medium until it is completely dissolved, add 5 ml to each test tube, plug each tube with cotton plugs, bundle 7 tubes together, wrap them in kraft paper, tie them tightly with rubber bands, and put them into an autoclave for high temperature and high pressure sterilization (121℃, 20 minutes). After sterilization, take them out and wait until they are no longer too hot to handle before placing them on a slant. After placing them, cover the surface of the test tubes with gauze to reduce condensation.

[0054] 2.1.3 Preparation of Mother Culture Plates

[0055] While heating and stirring the PDA solid culture medium until it is completely dissolved, use a syringe to draw 20 ml of the prepared culture medium into test tubes, plug each tube with cotton plugs, bundle 7 tubes together, wrap them in kraft paper, tie them tightly with rubber bands, and put them into an autoclave for high temperature and high pressure sterilization (121℃, 20 minutes). After sterilization, take them out and wait until they are not too hot to handle before pouring them into agar plates. After pouring, take an Erlenmeyer flask, fill it with warm water, and place it on the agar plate to reduce condensation.

[0056] 2.1.4 Preparation of liquid culture in Erlenmeyer flasks

[0057] Weigh out the following ingredients: 180g white sugar, 5.1g anhydrous magnesium sulfate, 5.1g dipotassium hydrogen phosphate, 5.1g bacteriological peptone, and 24g soybean flour.

[0058] Preparation method: Take a large bucket, fill it with 4L of tap water, and then use a measuring cup to take 2L of tap water and pour it into an induction cooker pot for heating. Immediately pour in the culture medium while stirring until the culture medium is completely dissolved. Turn off the heat, pour the dissolved culture medium into the large bucket, stir well, and dispense it into 1000ML Erlenmeyer flasks, each containing 600ML. Then, use a dropper to add 2-3 drops of defoaming agent to each Erlenmeyer flask. Wipe the bottle mouth clean with a towel, cover it with cotton plugs, cover it with kraft paper, and tie it with rubber bands. Place it in an autoclave for sterilization at 124℃ for 25 minutes, then remove and cool.

[0059] 2.1.5 Preparation of fermentation tank culture medium

[0060] The experiment used a 720L fermenter, with two sets of three bacterial filters connected in series and then in parallel to the air inlet pipe. Raw materials: 14 kg of edible white sugar, 3.2 kg of soybean meal powder (sieved through a 140-mesh sieve), 470 g of anhydrous magnesium sulfate, 470 g of dipotassium hydrogen phosphate, and 60 ml of defoamer. The raw materials were dissolved in water and added to the cleaned fermenter. The fermenter was then covered and placed in an autoclave at 121°C for 60 minutes for sterilization.

[0061] 2.2 Subculture Experiment Procedure

[0062] 2.2.1 Subculture of Mother Culture Plates

[0063] Remove the mother culture from the incubator, sterilize it, and place it in a clean bench. Disinfect the hands and arms that touch the sterile area before inoculating onto plates. Soak the inoculation equipment (inoculation needle, hole punch, sterilizing knife) in 75% alcohol solution. Flame the inoculation needle, hole punch, and sterilizing knife over the outer flame of a gas torch. Cool. Remove the sealing film from the mother culture plate and slightly flame the periphery of the plate. Scrape off any aerial mycelia on the surface of the mother culture medium with the sterilizing knife. Make 5mm holes in the culture medium, circling the plate 3cm from the original inoculation block. Transfer the mother culture block to the plate to be inoculated using the inoculation needle (the inoculation point should be 1cm from the edge of the plate). Seal the inoculated plate with sealing film, record the results, and incubate at the specified temperature in an incubator. Subculture 6 plates per time, incubating at 18℃ with a temperature deviation not exceeding 0.5℃.

[0064] After 12 days of cultivation, remove the inoculated plates, observe the mycelial growth, record and photograph the observations, and select the mycelial growth that is in good condition (dense white and uniform, with few conidia) as the mother culture for the next generation. Repeat the above steps for generation.

[0065] 2.2.2 Inoculation of liquid culture in Erlenmeyer flasks

[0066] (1) Perform the pre-operation disinfection procedure according to the method in 2.2.1, place the triangular bottle to be used, remove the rubber band, and attach the label.

[0067] (2) Take the mother culture out of the incubator, select the plate to be inoculated, wipe the surface with 75% alcohol for disinfection, place it on the clean bench, and light the alcohol lamp.

[0068] (3) Disinfect hands with alcohol, remove the sealing film of the mother culture plate, slightly burn the periphery of the plate, open the top cover of the plate, and scrape off the aerial hyphae on the surface of the mother culture medium with a sterilizing knife around the inoculation block in a semi-circle (do not scrape the hyphae about 2cm away from the inoculation block). You can take points from the hyphae about 1.5cm away from the tip of the hyphae and about 2cm away from the inoculation block. Use a hole punch to make 4mm-sized inoculum blocks (there are more inoculum blocks used for inoculating Erlenmeyer flasks, generally 13 holes per row, 4-5 rows). Place the plate.

[0069] (4) Remove the kraft paper from the triangular flask, pull out the stopper, and hold it in your hand. Briefly heat the surface of the stopper with the flame of the alcohol lamp. The surface of the stopper must not touch anything.

[0070] (5) Use an inoculation needle to pick up 5 pieces of inoculum (generally one piece per row) and tap them into the shake flask.

[0071] (6) Burn the cotton plug with an alcohol lamp, put the bottle stopper on, cover with kraft paper, and after inoculation, tie it tightly with a rubber band. Place it in a shaker at 18-19℃ and 138-148r / min for 8 days to obtain a full bottle of liquid bacterial culture in an Erlenmeyer flask.

[0072] 2.2.3 Fermentation tank inoculation and scale-up culture

[0073] Once the fermenter temperature has cooled to below 20°C, it is pushed into the fermenter inoculation chamber for inoculation. Under aseptic conditions, 600 ml of the cultured liquid culture from an Erlenmeyer flask is transferred into the fermenter through the inoculation port. After the fermenter pressure stabilizes, it is pushed into the fermenter culture chamber, and sterile, oil-free compressed air is introduced. The pressure is adjusted to 0.12 MPa, and the culture temperature is 18°C. The exhaust carbon dioxide concentration and mycelial morphology are monitored daily. The highest carbon dioxide concentration is observed after 6 days, indicating a full tank of flocculent mycelial liquid culture suitable for inoculation.

[0074] 2.2.4 Fruiting Experiment

[0075] (1) The culture medium formula is: 35.5% corn cob, 2.9% rice bran, 12.8% wheat bran, 4.8% cottonseed hull, 4% beet pulp, 10% corn flour, 5% soybean hull, 5% brewer's grains, 1.7% shell powder, and 0.6% quicklime. Add water and stir to control the final moisture content at about 66 wt%. Adjust the pH to 6.4, then bottle it and sterilize it at 121℃ for 50 minutes for later use.

[0076] (2) Inoculation: Inoculate 36 mL of liquid inoculum onto the surface of the culture medium in each bottle;

[0077] (3) Cultivation: The temperature is controlled at 20-25℃ and the relative humidity is 60-70%. Cultivate in a well-ventilated and shaded environment to promote the growth of mycelium. According to observation and statistics, it takes about 20 days for Camellia oleifera SCR0319T2 to grow full mycelium, while the yellow enoki mushroom XHJ0124B used for comparison takes about 22 days.

[0078] (4) Scratching to promote fruiting: After the mycelium has fully grown in the culture bottle, use a sterilized hand rake to scratch the mycelium film at the mouth of the culture bottle. After 3 days, the substrate surface will recover. Lower the temperature to 10-15℃ to promote fruiting. The fruiting bodies will form after about 6 days, and then they can be harvested.

[0079] 2.3 Experimental Results

[0080] Experimental results are as follows Figures 4-6 As shown in Tables 1 and 2, it can be seen that the transgeneration stability of the yellow enoki mushroom XHJ0124B used for comparison is far inferior to that of Camellia oleifera SCR0319T2. When the number of transgenerations exceeds 10, the mycelial growth rate and stability decrease significantly, and the elimination rate and fruiting rate also begin to decline. In contrast, Camellia oleifera SCR0319T2 still maintains good mycelial activity and fruiting rate even after more than 30 transgenerations.

[0081] After subculturing the Camellia sinensis SCR0319T2 sample from T20, the radius of the mycelium on the plate was measured daily during the culture period to assess its growth rate. The growth rate was approximately 2.0-2.5 cm at 5 days, about 3.5 cm at 7 days, about 4.0 cm at 8 days, about 4.5 cm at 9 days, about 5.0 cm at 10 days, about 5.5 cm at 11 days, and about 6.0 cm at 12 days, basically covering the plate. The deviation in growth rate from one generation did not exceed 0.5 cm.

[0082] In comparison, the growth rate of yellow enoki mushrooms (Flammulina velutipes) measured on plate XHJ0124B of T20 was approximately 1.5–1.8 cm at 5 days, about 2.5 cm at 7 days, about 2.8–3.0 cm at 8 days, about 3.3 cm at 9 days, about 3.8 cm at 10 days, about 4.2 cm at 11 days, and about 4.7 cm at 12 days. The deviation in growth rate per generation did not exceed 0.5 cm.

[0083] Furthermore, microscopic examination of the mycelia of samples T1 and T20 revealed that the Camellia japonica SCR0319T2 had smaller mycelial balls, more and finer flagella, denser hyphae, and more clamp connections, and showed no deterioration after multiple subcultures. During cultivation, it was observed that the cultivation of Camellia japonica lowered the pH of the culture medium. On plate media, the medium was softer compared to that of Enoki mushrooms during subculture. In the later stages of liquid culture, the pH of Enoki mushrooms was around 6.3, while that of Camellia japonica was around 5.5.

[0084] Table 1. Growth status of mycelium on plates at different generations in the subgeneration experiment.

[0085]

[0086] Table 2. Fruiting rate and subculture rejection rate of mycelium at different generations in the subculture experiment.

[0087]

[0088] Note: The fruiting rate is based on the yield per unit of the first generation (T1), and the proportion of the yield per unit of the subsequent generation strains compared with the first generation; the elimination rate is the proportion of plates that do not meet the requirements for continued generation during the plate generation process.

[0089] Example 3 Nutrient Analysis and Identification

[0090] In Example 2, after harvesting the fruiting bodies of *Enoki mushroom* strain SCR0319T2 (transmission number T30) in the fruiting experiment, samples were sent to Shandong Xinjiaxiang Testing Technology Co., Ltd. for nutrient composition analysis. The results are shown in Table 3. Compared with the nutrient information of *Mushroom.enoki* published in the USDA database, the fruiting bodies of *Enoki mushroom* strain SCR0319T2 not only contain more vitamin B1 and niacin, but also have significantly higher contents of trace elements such as iron, selenium, and zinc. The results indicate that this strain not only has better growth performance, but also improves the nutritional composition of its fruiting bodies compared to existing common *Enoki mushrooms*, demonstrating a clear advantage in the industrial production of *Enoki mushrooms*.

[0091] Table 3. Results of Nutrient Composition Detection in Fruiting Bodies

[0092]

[0093] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A strain of Campanella acutispora SCR0319T2, characterized in that: The name is Camellia velvet ( Flammulina filiformis SCR0319T2, with accession number GDMCC No:66720, was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province. 2.The Campanella acutispora SCR0319T2 according to claim 1, characterized in that: the nucleotide sequence of the ITS sequence of the Campanella acutispora SCR0319T2 is shown as SEQ ID NO.

1. 3.The Campanella acutispora SCR0319T2 according to claim 1, characterized in that: the nucleotide sequence of the 18S rDNA sequence of the Campanella acutispora SCR0319T2 is shown as SEQ ID NO.

2. 4.The Campanella acutispora SCR0319T2 according to claim 1, characterized in that: the Campanella acutispora SCR0319T2 has excellent stability in subculture, and the mycelium can still grow stably after more than 30 times of subculture on a plate, and the fruiting body grows normally and the yield is stable; the Campanella acutispora SCR0319T2 has high contents of vitamin B1 and nicotinic acid in the fruiting body. 5.The Campanella acutispora SCR0319T2 according to any one of claims 1 to 4 is used in the production of Campanella acutispora fruiting bodies. 6.The Campanella acutispora SCR0319T2 according to any one of claims 1 to 4 is used in the production of foods rich in vitamin B1 and nicotinic acid.

7. A culture method of Camellia japonica SCR0319T2, characterized by comprising the following steps: inoculating the Campanella acutispora SCR0319T2 according to claim 1 on a mother plate to obtain a mother culture, and then inoculating the compound culture medium until the mycelium is full, scratching the mycelium to grow the fruiting body, and harvesting the fruiting body after maturation.

Citation Information

Patent Citations

  • Creamy yellow flammulina velutipes strain and cultivation method

    CN117778198A

  • High-resistance and high-brittleness yellow flammulina velutipes ZJJZG002 and InDel marker and application thereof

    CN120966650A