Construction method of streptomyces diastatochromogenes strain overexpressing asnO gene and argD gene and application of streptomyces diastatochromogenes strain in production of epsilon-polylysine
By overexpressing the asnO and argD genes in ε-polylysine-producing Streptomyces, a high-yield ε-polylysine engineered strain was constructed, solving the problem of low fermentation level of ε-polylysine and achieving a reduction in production cost and an improvement in fermentation level.
Patent Information
- Application Number
- CN202511906644.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-17
- Publication Date
- 2026-01-27
AI Technical Summary
The existing ε-polylysine producing strains have low fermentation levels, resulting in high production costs and limiting the release of their application potential.
By using genetic engineering techniques, the asparagine synthase gene asnO and the N-succinyldiaminopimelacetate aminotransferase gene argD were simultaneously overexpressed in the ε-polylysine-producing Streptomyces diastatochromogenes asnO-argD strain, thus constructing a high-yield ε-polylysine engineered strain.
It significantly improved the fermentation level and production intensity of ε-polylysine, reduced production costs, and provided an excellent strain for the industrial production of ε-polylysine.
Smart Images

Figure CN121406554A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular, it relates to the construction of an overexpression of an asparagine synthase gene. asnO and N-succinyldiaminopimecrolate aminotransferase gene argD amylase-producing Streptomyces ( Streptomyces diastatochromogenes The strain was used to ferment and produce ε-poly-L-lysine (ε-PL). Background Technology
[0002] ε-Polylysine is a natural cationic homopolymer composed of lysine residues linked by amide bonds between α-carboxyl and ε-amino groups. With its broad antibacterial spectrum, excellent thermal stability, high water solubility, and high biocompatibility, its applications have expanded from traditional food preservation to medical antibacterial applications, antimicrobial resistance treatment, and biomaterial preparation, demonstrating enormous market potential. However, existing production strains have low fermentation levels and high production costs, which are the core bottlenecks limiting its application potential. Therefore, this invention aims to precisely modify the metabolic pathways of strains using genetic engineering technology to construct high-yield ε-polylysine engineered strains, providing excellent industrial production strains to reduce production costs.
[0003] The search revealed the following published documents related to this invention's patent application: 1. A method and application for constructing a genetically engineered amylase-producing Streptomyces and increasing ε-polylysine production (CN111621454 A) discloses a genetically engineered high-yield ε-polylysine strain of amylase-producing Streptomyces, wherein the amylase-producing Streptomyces increases the yield of ε-polylysine through the construction of a genetically engineered high-yield ε-polylysine strain of amylase-producing Streptomyces. sdhB Lysine / ornithine decarboxylase gene dcdA or asparagine synthase gene asnO exist Streptomyces diastatochromogenes The ε-polylysine production of the three genetically engineered strains was obtained by overexpression in TUST, compared with that of the original chassis strain. S. diastatochromogenes Compared to TUST, each strain has been improved to varying degrees, among which... S. diastatochromogenes The yield of SDHB in shake flasks was 0.39487 g / L, an increase of 10.08% compared to the original chassis strain's yield of 0.35871 g / L in shake flasks. S. diastatochromogenes The ε-polylysine production of asnO was increased by 12.04% compared with the original chassis strain TUST, and the production of DCDA by strain DCDA was increased by 15.95% compared with the original chassis strain.
[0004] 2. Pei Zefeng selected the 4-hydroxy-tetrahydrodipyridinecarboxylate reductase gene, a key gene with high transcriptional levels in the DAP pathway. dapB ), 2,3,4,5-tetrahydropyridine-2-carboxylic acid N-succinylate transferase gene ( dapD ), N-succinyldiaminopimecrolate aminotransferase gene ( argD Molecular modification was carried out, and high-yielding strains were developed. S.diastatochromogenes An engineered strain was constructed using dapF-lysA as the chassis cell. S.diastatochromogenes A-dapB、 S.diastatochromogenes A-dapD、 S.diastatochromogenes A-argD、 S.diastatochromogenes Aco-dapB-dapD and S. diastatochromogenes Aco-dapB-dapD-argD. After batch fermentation of five engineered strains in a 5 L fermenter, the yields of ε-polylysine reached 37.8 g / L, 39.2 g / L, 40.9 g / L, 39.8 g / L, and 42.0 g / L, respectively, compared to the starting strain. S.diastatochromogenes The dapF-lysA levels increased by 6.2%, 10.1%, 14.9%, 11.8%, and 17.9%, respectively (Pei Zefeng, Master's Thesis, Tianjin University of Science and Technology, 2023).
[0005] Although there are reports of using genetic engineering technology to modify ε-polylysine producing strains, the overexpression effect of some genes is not ideal. Therefore, how to further improve the production level of ε-polylysine and its hydrochloride by strains through genetic engineering modification remains a key technical problem that urgently needs to be solved.
[0006] By comparison, the present invention patent application is fundamentally different from the aforementioned patent publications. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the prior art by genetically engineering a Streptomyces spp. strain that produces ε-polylysine, and simultaneously overexpressing the asparagine synthase gene that affects ε-polylysine synthesis. asnO ) and N-succinyldiaminopimecrolate aminotransferase gene ( argD We obtained a high-yield ε-polylysine-producing Streptomyces strain and used the high-yield strain to ferment and produce ε-polylysine and its hydrochloride.
[0008] The technical solution adopted by this invention to solve the technical problem is: The engineered Streptomyces strain provided by this invention uses α-polylysine-producing Streptomyces as the chassis strain and is modified as follows: Simultaneous overexpression of the asparagine synthase gene in the diaminopimelic acid pathway (DAP) that affects ε-polylysine synthesis ( asnO ) and N-succinyldiaminopimecrolate aminotransferase gene ( argD ).
[0009] The chassis strain can be an α-polylysine-producing Streptomyces strain, specifically an amylase-producing Streptomyces. Streptomyces diastatochromogenes 6#-7. Streptomyces diastatochromogenes 6#-7 have been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 22261, on May 17, 2021, at the Institute of Microbiology, Chinese Academy of Sciences.
[0010] This invention does not impose any particular restrictions on the method of obtaining the gene; it can be obtained through PCR amplification or direct synthesis.
[0011] In some specific embodiments, chassis strains are used. Streptomyces diastatochromogenes 6#-7 simultaneously overexpress asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD High-yield engineered strain named S. diastatochromogenes asnO-argD.
[0012] Furthermore, the overexpression vector plasmid used to construct the high-yield engineered strain was pIMEP.
[0013] Furthermore, the overexpressed asparagine synthase gene asnO The nucleotide sequence is SEQ ID No. 1.
[0014] Furthermore, the overexpressed N-succinyldiaminopimecrolate aminotransferase gene argD The nucleotide sequence is SEQ ID No. 2.
[0015] Furthermore, overexpression of the erythromycin strong promoter N-succinyldiaminopimecrolate aminotransferase gene argD The nucleotide sequence is SEQ ID No. 3.
[0016] Furthermore, in some specific embodiments, the construction steps of the high-yield α-polylysine engineered strain are as follows: (1) Obtaining the target gene fragment: Extract using kits or conventional methods S.diastatochromogenes Using the genome of 6#-7 (accession number CGMCC No. 22261) as a template, based on the asparagine synthase gene... asnODesign upstream and downstream primers asnO-F and asnO-R (primer sequences are shown in Table 1), and PCR amplify primers containing homologous arms. asnO The gene is 1869 bp in length and has no homologous arms. asnO The gene nucleotide sequence (1827 bp) is shown in SEQ ID No. 1.
[0017] Extract using kits or conventional methods S.diastatochromogenes Using the genome of 6#-7 (accession number CGMCC No. 22261) as a template, based on the N-succinyldiaminopimelacetate aminotransferase gene... argD Design upstream and downstream primers argD-F and argD-R (primer sequences are shown in Table 1), and PCR amplify the sample containing homologous arms. argD The gene is 1293 bp in length and has no homologous arms. argD The gene nucleotide sequence (1251 bp) is shown in the sequence listing SEQ ID No. 2.
[0018] Using pIMEP-argD plasmid extracted by kits or conventional methods as a template, upstream and downstream primers ermE-argD-F and ermE-argD-R were designed (primer sequences are shown in Table 1). PCR amplification was performed using plasmids with homologous arms and... ermE argD The gene is 1520 bp in length and has no homologous arms. ermE-argD The gene nucleotide sequence (1479 bp) is shown in the sequence listing SEQ ID No. 3.
[0019] The gene sequence and the primer sequences used are as follows: Table 1 S. diastatochromogenes Endogenous asparagine synthase genes 6#-7 asnO The nucleotide sequence is SEQ ID No. 1; S. diastatochromogenes N-succinyldiaminopimecrolate aminotransferase gene 6#-7 argD The nucleotide sequence is SEQ ID No. 2; on the pIMEP-argD plasmid. ermE-argD The gene sequence is SEQ ID No. 3.
[0021] (2) Construction of recombinant plasmids: PCR amplification asnO Gene fragments with strong erythromycin promoters The linear plasmid pIMEP of (SEQ ID No. 4) was ligated to obtain the ligation product recombinant plasmid pIMEP-asnO; the PCR-amplified... argD Gene fragments with strong erythromycin promoters The linear plasmid pIMEP was ligated to obtain the ligation product, recombinant plasmid pIMEP-argD; the PCR-amplified... ermE-argD The gene fragment was homologously recombinated with the linear plasmid recombinant plasmid pIMEP-asnO to obtain the recombinant plasmid pIMEP-asnO-argD. The constructed recombinant plasmid pIMEP-asnO-argD was transformed into Escherichia coli DH5α competent cells using a chemical method. Escherichia coli DH5α positive transformants were screened by apramycin resistance plates. Escherichia coli DH5α positive transformants were cultured in liquid culture, and the recombinant plasmid pIMEP-asnO-argD was extracted from the transformants for later use.
[0022] (3) Construction of engineered strains The recombinant plasmid pIMEP-asnO-argD was transformed into *E. coli* ET12567 (pUZ8002) and plated on LB agar plates containing 25 μg / mL kanamycin, 50 μg / mL apramycin, and 25 μg / mL chloramphenicol. Positive transformants of *E. coli* ET12567 (pUZ8002) were selected and cultured in LB liquid medium containing the same concentrations of kanamycin, apramycin, and chloramphenicol at 37 °C with shaking until OD. 600 The bacterial cells were collected by centrifugation at a concentration of 0.4–0.6, washed with fresh LB liquid medium to remove residual antibiotics, and resuspended in LB liquid medium on ice for later use. The bacterial cells were then transferred to a tray cultured on Bennett medium. S.diastatochromogenes Add pH 8.0 TES buffer to plates #6-7, scrape off spores, pour them into a container containing glass beads, shake at 30 ℃ and 180 r / min to break the spore chains, filter to remove hyphae, collect the spore suspension, heat shock in a 50 ℃ water bath for 10 min, immediately cool the spore suspension to room temperature, add M3G medium, and culture at 37 ℃ with shaking for 2-3 h to allow spores to germinate. Centrifuge at 5000 r / min for 5 min to collect the germinated spores, and resuspend the germinated spores in TES buffer for later use. The prepared E. coli ET12567 (pUZ8002) positive transformant cells and germinating cells were respectively... S.diastatochromogenesSpores #6 and #7 were mixed at a volume ratio of 1:1 and repeatedly blown and aspirated to mix thoroughly. The mixture was then evenly spread on SFM medium containing 5 mM MgCl2 and incubated upside down at 30 ℃ for 14–18 h. The plate surface was then evenly covered with 1 ml of sterile water containing 25–50 μL naridinone acid (25 mg / mL) and 25–50 μL apramycin (50 mg / mL). After drying the plate, it was incubated upside down for another 3–5 days. Single clones of positive conjugates were selected to obtain the engineered strain of Streptomyces α-polylysine.
[0023] Furthermore, each 1 L of M3G culture medium comprises: 10 g of (NH4)2SO4, 1.36 g of KH2PO4, 0.8 g of K2HPO4, and 5 g of yeast extract were prepared. The pH was adjusted to 7.2 with ammonia water, and the volume was brought up to 900 mL with distilled water. The mixture was then sterilized separately at 121 °C for 20 min. 10 mL of 10× glucose stock solution was added to every 100 mL of M3G medium before use.
[0024] 10× Glucose stock solution: Weigh 100 g of glucose, add 2 mL of 20 g / L ZnSO4·7H2O, 2 mL of 10 g / L MgSO4·7H2O and 1 mL of 20 g / L FeSO4·7H2O, bring the volume to 100 mL with distilled water, and then sterilize separately at 115 °C for 30 min.
[0025] Alternatively, each 1 L of Benate medium consists of: Add 10 g glucose, 2 g peptone, 1 g yeast powder, 1 g beef extract, and 15-20 g agar to a final volume of 1 L of water. Adjust the pH to 7.7 with NaOH.
[0026] Alternatively, the composition of the 1 L SFM culture medium is as follows: Add 30 g of water-soluble soybean meal powder, 20 g of mannitol, and 20 g of agar powder to water to make up to 1 L, and adjust the pH to 7.2-7.4 with NaOH.
[0027] Furthermore, the present invention also provides the application of the aforementioned high-yield ε-polylysine-producing *Streptomyces* strain in the fermentation production of ε-polylysine, wherein the fermentation production method is as follows: High-yielding ε-polylysine-producing Streptomyces strains S. diastatochromogenesasnO-argD was inoculated onto Benate medium plates and cultured at 30 °C until spores were produced. Then, the spores were inoculated into shake flasks containing glucose M3G medium and cultured at 28-30 °C and 180 r / min for 30 h. The cultured seed culture was then transferred to glucose-containing M3G medium for fed-batch fermentation in a fermenter to obtain a fermentation broth containing ε-polylysine. This broth can then be further purified by centrifugation, adsorption, elution, decolorization, and drying to obtain ε-polylysine or ε-polylysine hydrochloride.
[0028] The advantages and positive effects of this invention are as follows: This invention focuses on the modification of several key genes, specifically by overexpressing the asparagine synthase gene, a key enzyme in the DAP pathway. asnO and N-succinyldiaminopimecrolate aminotransferase gene argD High-yield ε-polylysine engineered strains were obtained. S. diastatochromogenes asnO-argD, a feed-by-batch fermentation strain in a fermenter, produces ε-polylysine, achieving a yield of 55.51 g / L over 240 hours. It is a substrate strain. S. diastatochromogenes The yield of strain 6#-7 (28.26 g / L) was 196.42%; the production intensity (g / L·h) was the highest among the strains originating from the chassis. S. diastatochromogenes The ε-polylysine / glucose consumption conversion rate (g / g) of strains 6#-7 was 166.40%; the conversion rate of ε-polylysine / glucose consumption at 240 h was 0.213, which is higher than that of the chassis strains. S. diastatochromogenes The conversion rate of strain 6#-7 (0.184) was 115.76%. This is a high-yield ε-polylysine engineered strain. S. diastatochromogenes Compared with the chassis strain, asnO-argD significantly improved fermentation level and production intensity, reduced production costs, and provided an excellent strain for the industrial production of ε-polylysine. Attached Figure Description
[0029] Figure 1 This is a flowchart illustrating the construction of the pIMEP-asnO-argD recombinant plasmid based on the pIMEP plasmid in this invention.
[0030] Figure 2 The genetically engineered strain in this invention S. diastatochromogenes asnO-argD validation diagram; where lane M: 5 Kb marker; lane 1: control chassis strain. S. diastatochromogenes No corresponding values found in 6#-7 asnO- argD Gene amplification fragment; Lane 2: High-yield ε-polylysine engineered strain S. diastatochromogenes Integrated in asnO-argD asnO-argD Gene amplification fragment.
[0031] Figure 3 chassis strain S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes Comparison of ε-polylysine yields during shake-flask fermentation using asnO-argD.
[0032] Figure 4 chassis strain S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes Comparison of biomass during shake-flask fermentation of asnO-argD.
[0033] Figure 5 chassis strain S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes Comparison of ε-polylysine yield in a batch-fed fermentation tank using asnO-argD 5L fermenter.
[0034] Figure 6 chassis strain S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes Comparison of relative yields of ε-polylysine produced by batch-fed fermentation in an asnO-argD5L fermenter.
[0035] Figure 7 For chassis strains S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes Comparison of relative production intensity of ε-polylysine production by batch-fed fermentation in an asnO-argD 5 L fermenter.
[0036] Figure 8 chassis strain S. diastatochromogenes 6#-7 and high-yield ε-polylysine engineered strains S. diastatochromogenes A comparison chart of ε-polylysine / glucose conversion rates (g / g) in batch fed-batch fermentation of ε-polylysine in an asnO-argD 5 L fermenter. Detailed Implementation
[0037] The following embodiments and accompanying drawings are merely illustrative of specific implementation schemes for carrying out the present invention. These schemes and drawings should not be construed as limiting the present invention. Any changes made without departing from the principles and essence of the present invention shall fall within the protection scope of the present invention.
[0038] Unless otherwise specified, all raw materials used in this invention are conventional commercially available products. Unless otherwise specified, all methods used in this invention are conventional methods in the field. All substances used in this invention are of conventional quality.
[0039] Specifically, the relevant preparation and testing methods are as follows: A genetically engineered high-yield α-polylysine-producing strain of *Streptomyces amylase* S. diastatochromogenes asnO-argD and its construction method. This involves constructing an overexpression of the asparagine synthase gene. asnO and N-succinyldiaminopimecrolate aminotransferase gene argD The multi-gene recombinant plasmid pIMEP-asnO-argD was transformed into the chassis strain. S. diastatochromogenes High-yield α-polylysine-producing genetically engineered strains were obtained from strains 6#-7. S. diastatochromogenes asnO-argD, including the asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD The gene sequences are SEQ ID No. 1 and SEQ ID No. 2, respectively.
[0040] The chassis strain S. diastatochromogenes The strain preservation number for 6#-7 is CGMCC No.22261.
[0041] Since the same amino acid can be determined by several different codons, the same amino acid can correspond to different nucleotide sequences. Therefore, the nucleotide sequences in this application include nucleotide sequences with codon synonymous mutations obtained by substituting one or more nucleotides into the nucleotide sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2. Those skilled in the art can obtain the nucleotide sequences disclosed in this application using existing molecular biology techniques, such as PCR, gene synthesis, or other suitable methods. asnO and argD Genes, therefore, encode the above asnO and argD The nucleotide sequence of a gene is not limited to the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2. If the encoded protein... asnO and argD Proteins encoded by genes that do not show significant functional differences are also included within the scope of this invention.
[0042] The present invention will be described in more detail below with reference to the embodiments: Example 1: Chassis strain of amylase-producing Streptomyces S. diastatochromogenesGenomic DNA extraction from 6#-7 Genomic DNA was extracted using the TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0. S. diastatochromogenes Genomic DNA of 6#-7: (1) The chassis strain S. diastatochromogenes 6#-7 spores were inoculated into M3G liquid medium and cultured at 30℃ with shaking at 180 r / min for 30 h; (2) Collect 1 mL of culture medium in a 1.5 mL centrifuge tube, centrifuge at 12000 r / min for 2 min, and discard the supernatant; add 500 μL of Buffer BS to resuspend the cells, add 50 μL of Lysozyme (20 mg / mL), mix thoroughly by aspiration, and incubate at 37 ℃ for 60 min; centrifuge at 12000 r / min for 5 min, and discard the supernatant; add 180 μL of Buffer GL, 20 μL of Proteinase K (20 mg / mL) and 10 μL of RNase A (10 mg / mL), mix thoroughly by aspiration, and incubate at 56 ℃ for 10 min; add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly; install the Spin Column on the Collection Tube, transfer the mixed solution to the Spin Column, centrifuge at 12000 r / min for 2 min, and discard the filtrate; add 500 μL of Buffer WA Add the solution to the Spin Column, centrifuge at 12000 r / min for 1 min, and discard the filtrate. Add 700 μL of Buffer WB to the Spin Column, centrifuge at 12000 r / min for 1 min, discard the filtrate, and repeat the washing with Buffer WB once. Place the Spin Column on a Collection Tube and centrifuge at 12000 r / min for 2 min. Place the Spin Column on a new 1.5 mL centrifuge tube, add 50–200 μL of sterile water or Elution Buffer to the center of the Spin Column membrane, incubate at room temperature for 5 min, and centrifuge at 12000 r / min for 2 min to elute genomic DNA.
[0043] (3) The concentration of the extracted genomic DNA was determined by agarose gel electrophoresis or by measuring absorbance.
[0044] Example 2: Co-expression of asparagine synthase gene asnOand N-succinyldiaminopimecrolate aminotransferase gene argD Cloning and construction of recombinant plasmid pIMEP-asnO-argD (1) Co-expression of asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD Cloning Based on asparagine synthase gene asnO Design upstream and downstream primer sequences asnO-F and asnO-R (primer sequences are shown in Table 1). Add nucleic acid sequence to the 5' end of the asnO-F primer. Bam The H I restriction site and the 15-20 bp complementary nucleotides at the 5' end of the pIMEP front end form a homologous fragment. Adding nucleotides to the 5' end of the asnO-R primer sequence... Bam The HI restriction site and the 5' end of pIMEP are complementary for 15-20 bp, forming a homologous fragment. Genomic DNA extracted in Example 1 was used as a template for PCR to amplify fragments containing homologous arms. asnO The gene is 1869 bp in length. (Details...) asnO The gene sequence is shown in the sequence listing SEQ ID No. 1.
[0045] According to N-succinyldiaminopimelot aminotransferase argD Gene design upstream and downstream primer sequences argD-F and argD-R (primer sequences are shown in Table 1), and add nucleic acid sequences to the 5' end of the argD-F primer. kpn The restriction enzyme site of I and the 5' end of pIMEP are complementary for 15-20 bp, forming a homologous fragment. Genomic DNA extracted in Example 1 was used as a template for PCR to amplify fragments containing homologous arms. argD The gene is 1293 bp in length. (Details...) argD The gene sequence is shown in the sequence listing SEQ ID No. 2.
[0046] according to ermE Gene position design on pIMEP ermE argD The upstream and downstream primer sequences ermE-argD-F and ermE-argD-R (primer sequences are shown in Table 1) were used. A 15-20 bp complementary base to the 5' end of the pIMEP-argD gene of the linear plasmid digested with kpn I was added to the 5' end of the ermE-argD-F primer to form a homologous arm. A 15-20 bp complementary base to the 5' end of the ermE-argD-R primer was added. EcoRI. The 15-20 bp complementary bases at the 5' end of the pIMEP-argD gene of the linear plasmid after enzyme digestion form a homologous arm.
[0047] PCR reaction system: 25 µL of 2×phanta max Master Mix (Dye Pius), 1 µL of template (20 μg / mL), 2 µL each of forward and reverse primers (10 μM), 1 µL of DMSO, and ultrapure water to 50 µL.
[0048] PCR reaction conditions: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s, 55~65 ℃ annealing for 15 s, 72 ℃ extension for 30~60 s, for a total of 25~35 cycles, 72 ℃ complete extension for 5 min, and 4 ℃ to end the reaction.
[0049] (2) Construction of recombinant plasmid pIMEP-asnO.
[0050] PCR amplification of homologous arms asnO Genes and Process BamH I single enzyme digestion integrates with a strong promoter, erythromycin promoter. The linear plasmid pIMEP was ligated using a homologous recombinase to obtain the ligation product, recombinant plasmid pIMEP-asnO.
[0051] The homologous recombination system consisted of: linearized vector pIMEP 50-200 ng, and insertion... argD Gene fragment 50~200ng, 2×Basic Assembly Mix 5 µL, add ultrapure water to 10 µL.
[0052] Homologous recombination conditions: react at 50 ℃ for 15 min, then cool to 4 ℃.
[0053] (3) Construction of recombinant plasmid pIMEP-argD.
[0054] PCR amplification of homologous arms argD Genes and Process BamH I single enzyme digestion integrates with a strong promoter, erythromycin promoter. The linear plasmid pIMEP was ligated using homologous recombinase to obtain the ligation product, recombinant plasmid pIMEP-argD.
[0055] The homologous recombination system consisted of: linearized vector pIMEP 50-200 ng, and insertion... argD Gene fragment 50~200ng, 2×Basic Assembly Mix 5µL, add ultrapure water to 10µL.
[0056] Homologous recombination conditions: react at 50 ℃ for 15 min, then cool to 4 ℃.
[0057] (4) asnO and argD Construction of the gene co-expression recombinant plasmid pIMEP-asnO-argD PCR amplification of homologous arms ermE-argD Gene fragments and processes kpn I. The linear plasmid pIMEP-asnO, which was digested by a single enzyme, was ligated using a homologous recombinase to obtain the ligation product, the recombinant plasmid pIMEP-asnO-argD.
[0058] The homologous recombination system consisted of: 50–200 ng of linearized pIMEP-asnO vector plasmid, inserted... ermE-argD Gene fragment 50~200 ng, 2×Basic Assembly Mix 5 µL, add ultrapure water to 10 µL.
[0059] Homologous recombination conditions: react at 50 ℃ for 15 min, then cool to 4 ℃.
[0060] (5) Transformation and validation of recombinant plasmid pIMEP-asnO-argD Add 10 µL of the ligation product, recombinant plasmid pIMEP-asnO-argD, to a centrifuge tube containing 100 µL of *E. coli* DH5α competent cells in an ice bath. Mix slowly by pipetting, then gently tap the tube wall every 15 min in an ice bath to ensure thorough mixing. Incubate on ice for 30 min, then heat in a 42 °C metal bath for 80 s, followed by another 5 min on ice. After the ice bath, add 1 mL of preheated LB medium (37 °C) to the centrifuge tube in a clean bench, gently tapping the tube wall to mix thoroughly. Transfer the sample to a shaker at 37 °C and 200 rpm for 50–80 min. After shaking, centrifuge at 5000 rpm for 10 min and discard approximately 800 μL of supernatant. Mix the remaining liquid by pipetting. Finally, based on the resistance concentration and quantity, take an appropriate amount of 150 μL of mixed bacterial solution and spread it evenly on the surface of LB solid plates containing apramycin (25 μg / mL) resistance. Incubate the spread LB plates upside down in a 37 ℃ incubator for 14-18 h until single colonies are clearly observed. Pick single colonies of transformants and transfer them to LB liquid medium containing 25-50 μg / mL apramycin, and incubate overnight at 37 ℃ with shaking at 180-200 r / min. Extract the pIMEP-asnO-argD plasmid from the transformants using a plasmid extraction kit (MiniBEST Plasmid Purification Kit Ver. 4.0) or conventional alkaline lysis method. Then, process the extracted pIMEP-asnO-argD plasmid... Eco R-I restriction enzyme digestion verification. The correctly verified recombinant plasmid pIMEP-asnO-argD and the E. coli DH5α-positive transformants were preserved.
[0061] The construction process of plasmid pIMEP-asnO-argD is as follows: Figure 1 As shown.
[0062] Example 3: High-yield α-polylysine engineered strain S. diastatochromogenes Construction of asnO-argD The recombinant plasmid pIMEP-asnO-argD was integrated into the substrate strain using a conjugation transfer method. S.diastatochromogenes In genomes 6#-7.
[0063] (1) First, Escherichia coli DH5α positive transformants containing pIMEP-asnO-argD plasmid were cultured overnight at 37 ℃ in LB liquid medium containing 50 μg / mL apramycin. The pIMEP-asnO-argD recombinant plasmid was extracted from the Escherichia coli DH5α positive transformants using a plasmid extraction kit (MiniBEST Plasmid Purification Kit Ver.4.0). The recombinant plasmid was chemically transformed into helper strain Escherichia coli ET12567 (pUZ8002). The transformants were plated on LB plates containing 25 μg / mL kanamycin, 50 μg / mL apramycin and 25 μg / mL chloramphenicol. After incubation at 37 ℃ for 24 h, positive transformants of Escherichia coli ET12567 (pUZ8002) were obtained.
[0064] (2) Select single colonies of positive transformants of Escherichia coli ET12567 (pUZ8002) containing the recombinant plasmid pIMEP-asnO-argD and culture them in 5 mL LB medium (containing three antibiotics at the same concentration as in the previous step) and shake overnight at 37 °C. Then, transfer them to 50 mL fresh LB liquid medium containing three antibiotics (antibiotic concentration as in the previous step) at an inoculation rate of 1% and culture at 37 °C with shaking at 180 r / min until OD. 600 The concentration was 0.4–0.6. Centrifuge 40 mL of bacterial culture at 8000 r / min for 5 min, discard the supernatant, and wash the cells 2–3 times with fresh LB liquid medium to remove residual antibiotics. Resuspend the cells in 4 mL of LB liquid medium to obtain a suspension of treated *E. coli* ET12567 (pUZ8002) positive transformant cells, and store on ice for later use. S. diastatochromogenes Add 10 mL of pH 8.0 TES buffer to SFM plates with well-grown spores (6#-7). Spores are scraped off using a sterile inoculation loop and poured into a 250 mL Erlenmeyer flask containing glass beads. Incubate at 30 °C with shaking at 180 rpm for 2 h to break the spore chain. Filter the flask with sterile absorbent cotton to remove hyphae and collect the spore suspension. Heat shock the spore suspension at 50 °C for 10 min and immediately cool to room temperature. Add 10 mL of M3G liquid medium and incubate at 37 °C with shaking for 2–3 h to allow spore germination. Collect the spores by centrifugation at 5000 rpm for 5 min and resuspend the germinated spores in 1 mL of pH 8.0 TES buffer. S. diastatochromogenes Prepare spore suspensions of 6#-7# for later use.
[0065] (3) The prepared Escherichia coli ET12567 (pUZ8002) positive transformant cell suspension and germinating cells were mixed together. S. diastatochromogenesEqual volumes of spore suspensions #6 and #7 were mixed and evenly spread onto SFM solid medium containing 5 mM MgCl2. After incubation at 30 ℃ for 14–18 h, the plates were covered with 1 mL of sterile water containing 25–50 μL of naphthiocarboxylic acid (25 mg / mL) and 25–50 μL of apramycin (25 mg / mL). After drying the plates, incubation was continued at 30 ℃ for 3–5 days to obtain a high-yielding α-polylysine engineered strain. S. diastatochromogenes asnO-argD.
[0066] High-yielding α-polylysine-producing engineered strains were amplified by PCR using the universal primers pIMEP-F and pIMEP-R (see Table 1). S. diastatochromogenes asnO-argD and chassis strains S. diastatochromogenes 6#-7 asnO-argD Gene (3744 bp), results as follows Figure 2 As shown: Lane M: 5 Kb marker; Lane 1: control. S. diastatochromogenes No corresponding values found in 6#-7 asnO-argD Gene fragment; Lane 2: S. diastatochromogenes Integrated in asnO-argD asnO-argD Gene fragment amplification diagram; the diagram shows the constructed high-yield engineered strain. S. diastatochromogenes Successfully integrated into the expression in asnO-argD asnO-argD Gene fragments.
[0067] Example 4 S. diastatochromogenes Production of α-polylysine by shake-flask fermentation of asnO-argD strain Using the high-yield α-polylysine engineered strain constructed in Example 3 S. diastatochromogenes The specific steps for producing α-polylysine by shake-flask fermentation of asnO-argD are as follows: High-yield α-polylysine engineered strains S. diastatochromogenes asnO-argD and chassis strains S. diastatochromogenesTransferred strains 6# and 7# to Benat plates and cultured at 30 ℃ for 5-7 days until spores were produced. Then, a loopful of fresh spores was scraped from each strain and inoculated into a 500 mL shake flask containing 100 mL of M3G medium, and cultured at 30 ℃ with shaking at 180-220 r / min for 30 h. The seed culture was then inoculated at a rate of 6.4% (v / v) into a 500 mL volumetric shake flask containing 100 mL of M3G medium, and cultured at 30 ℃ with shaking at 180-220 r / min until the ε-polylysine yield reached its maximum. A 5 mL sample was taken every 24 h to determine the pH, residual sugar, cell dry weight, and ε-polylysine yield of the fermentation broth. Each strain was inoculated in triplicate, and the average of the three replicates was taken.
[0068] pH Measurement: The pH electrode, immersed in 3 mol / L KCl solution, was calibrated using a two-point calibration method. For each batch of samples, a standard buffer solution (pH 6.86) was used as a quality control sample. The electrode was rinsed with deionized water, and residual droplets were blotted dry with filter paper. The electrode was then immersed in the test solution, ensuring the liquid completely covered the glass membrane. After the reading stabilized, the final pH value was recorded (accurate to 0.01). The electrode was rinsed repeatedly after each measurement to prevent cross-contamination.
[0069] Glucose concentration determination: Take 6.0 mL of fermentation broth (accurately measured) and place it in a 10 mL centrifuge tube. Centrifuge at 8000 r / min for 5 min at 4 ℃. Carefully aspirate the supernatant, avoiding disturbing the bottom precipitate. Determine the glucose concentration using a biosensor analyzer. Set up 3 technical replicates for each batch of samples.
[0070] Biomass determination: Numbered and weighed centrifuge tubes were dried in an oven until constant weight. Centrifugation was performed at 4 ℃, 8000 r / min for 5 min using a high-speed refrigerated centrifuge. After centrifugation, the supernatant was carefully discarded, and the precipitate was retained. The centrifuge tubes were repeatedly washed with deionized water. The tubes were dried until constant weight, and the dry weight of the cells was calculated. Three technical replicates were performed for each sample.
[0071] Plotting the standard curve using the ε-polylysine colorimetric method: (1) Dilution of ε-polylysine standard solution: Dilute 0.10 g / L of ε-polylysine standard solution with phosphate buffer at pH 6.6 according to the specified ratio to obtain a series of standard concentrations of ε-polylysine of 0.01 g / L, 0.02 g / L, 0.03 g / L, 0.04 g / L, 0.05 g / L, 0.06 g / L, 0.07 g / L, 0.08 g / L, 0.09 g / L, and 0.10 g / L; (2) Reaction: Take 2 mL of each of the prepared ε-polylysine standard series concentrations, add 2 mL of 1 mM methyl orange solution, mix, and shake in a 30 ℃ water bath at 140 r / min for 30 min; (3) Centrifugation and dilution: Transfer the ε-polylysine and methyl orange mixture after the reaction is completed to a centrifuge, centrifuge at 4000 r / min for 15 min, and take the supernatant and dilute it 50 times with pH 6.6 phosphate buffer; (4) Spectrophotometer determination of OD 465 The absorbance of the above-mentioned assay solution diluted 50 times was measured at 465 nm, using phosphate buffer solution at pH 6.6 as a blank. The OD values of ε-polylysine solutions at various concentrations were recorded. 465 value; (5) OD of the 50-fold diluted solution 465 The x-axis represents the value and the y-axis represents the corresponding ε-polylysine standard concentration. A standard curve is plotted to obtain the linear regression equation.
[0072] Y = -1.293X + 0.2987 R 2 = 0.9991 (6) Determination of ε-polylysine content: Centrifuge the fermentation broth at 8000 r / min for 5 min to remove cells. Dilute the supernatant appropriately with pH 6.6 sodium phosphate buffer to obtain the sample. Mix 2 mL of the sample with an equal volume of 1 mM methyl orange solution and react at 30 ℃ and 140 r / min for 30 min with shaking. After the reaction, centrifuge at 5000 r / min for 15 min and discard the precipitate. Place the diluted sample in a quartz cuvette and perform baseline calibration using an equal volume of buffer as a blank reference. Measure the OD. 465 The absorbance values were measured three times, and the arithmetic mean was taken. The results were then substituted into the standard curve equation for quantitative calculation to obtain the ε-PL sample concentration value.
[0073] High-yield ε-polylysine engineered strain S. diastatochromogenes After 96 h of shake-flask fermentation with asnO-argD, the yield of ε-polylysine was 1.26 ± 0.03 g / L. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) S. diastatochromogenes After 120 h of shake-flask fermentation in flasks #6-7, the yield of ε-polylysine was 0.99 ± 0.02 g / L. (See attached table). Figure 3 . S. diastatochromogenes The biomass of asnO-argD strain after 120 h of shake-flask fermentation was 16.12 ± 0.90 g / L. The biomass of the substrate strain *S. diastatochromogenes* 6#-7 after 144 h of shake-flask fermentation was 11.24 ± 0.40 g / L. Results are shown in […]. Figure 4 .
[0074] Example 5 Engineered strain S. diastatochromogenes asnO-argD 5 L fermenter for batch-fed fermentation production of ε-polylysine Using high-yield ε-polylysine engineered strains S. diastatochromogenes The production of ε-polylysine via fed-batch fermentation of asnO-argD in a 5 L fermenter is as follows: High-yield ε-polylysine engineered strains S. diastatochromogenes asnO-argD and chassis strains S. diastatochromogenes Transfer 6#-7 to Benat culture plates and incubate at 30 ℃ for about 5-7 days until spores are produced; then, scrape a loop of fresh spores and inoculate them into 500 mL shake flasks containing 100 mL M3G medium and incubate at 30 ℃ with shaking at 180-220 r / min for 28-32 h. The seed culture was inoculated at a rate of 10% (v / v) into 5 L fermenters containing 3 L of fermentation medium, with an initial pH of 6.8. The fermentation was controlled in two stages: In Stage I, the pH was maintained at 6.0 to promote cell proliferation; in Stage II, when the glucose concentration in the fermentation broth dropped to 10 g / L, the pH was allowed to drop naturally to 4.0, and then 25% ammonia was automatically added to maintain the pH at approximately 4.0. Simultaneously, a mixture of glucose (800 g / L) and ammonium sulfate (80 g / L) was added to maintain the glucose concentration at approximately 12 g / L to promote product formation. During fermentation, the temperature was maintained at 30 °C, the aeration ratio was maintained at 1–2 vvm, and the stirring speed was controlled in relation to dissolved oxygen levels, keeping dissolved oxygen at 30%. The ε-polylysine yield, pH, residual sugar concentration in the fermentation broth, and biomass of the two strains were measured during fermentation.
[0075] engineered strains S. diastatochromogenes The asnO-argD fed-batch fermentation method produced ε-polylysine, with a maximum yield of 55.51 g / L at 240 h. (Disk strain) S. diastatochromogenes The highest yield of ε-polylysine from strain 6#-7 reached 28.26 g / L after 204 h. S. diastatochromogenes The ε-polylysine yield of asnO-argD is determined by the chassis strain. S. diastatochromogenes The yield of 6#-7 was 196.42%, as shown in the following results. Figure 5 , Figure 6 . strain S. diastatochromogenes The asnO-argD production intensity was 0.231 g / L·h, which is the starting chassis strain. S. diastatochromogenes 166.40% of 6#-7 (0.139 g / L·h) Figure 7 ). strainS. diastatochromogenes The ε-polylysine glucose consumption conversion rate of asnO-argD was 0.213 at 240 h, which is typical for chassis strains. S. diastatochromogenes The conversion rate of 6#-7 (0.184, 204 h) was 115.76% ( Figure 8 ). (Using strains) S. diastatochromogenes The fermentation of asnO-argD for the production of ε-polylysine significantly reduces production costs and provides an excellent strain for the industrial production of ε-polylysine.
[0076] Comparative Example Asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD The effects of single-gene overexpression and multi-gene co-expression on the yield of ε-polylysine are shown in Table 2.
[0077] Table 2 shows the asparagine synthase gene. asnO Overexpression increased yield by 26.55% compared to the chassis strain, and the N-succinyldiaminopimecrolate aminotransferase gene was expressed. argD After overexpression, the yield increased by 14.9% compared to the chassis strain, while the yield increased by 96.42% after simultaneous overexpression of both genes in this invention. This demonstrates that simultaneous overexpression... asnO and argD Genetically engineered strains S.diastatochromogenes The ε-polylysine production of asnO-argD was significantly higher than that of overexpression alone. asnO or argD The engineered strains of the gene showed a significant increase in yield, achieving unexpected results.
[0078] Table 2
[0079] The relevant gene sequences used in this invention are as follows: 1. SEQ ID No.1 Asparagine synthase gene ( asnO ) 2. SEQ ID No. 2 N-succinyldiaminopimecrolate aminotransferase gene ( argD ) 3. SEQ ID No. 3 Strong promoter with erythromycin N-succinyldiaminopimecrolate aminotransferase gene argD nucleotide sequence gene ( ermE-argD ) 4. SEQ ID No.4 Erythromycin promoter ermE
[0080] GCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGGGCTGCAGGTCGACTCTAGGGCACAATCGTGCCGGTTGGTAGGATCTAGCGGAACGGA
Claims
1. A multi-gene overexpression engineered strain that produces high levels of ε-polylysine, characterized in that: Simultaneous overexpression of asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD .
2. The engineered strain for high-yield ε-polylysine production with multiple gene overexpression according to claim 1, characterized in that: The asparagine synthase gene asnO and N-succinyldiaminopimecrolate aminotransferase gene argD The nucleotide sequences are SEQ No.1 and SEQ No.2, respectively.
3. The engineered strain that produces high levels of ε-polylysine through multi-gene overexpression according to claim 1, characterized in that: The chassis strain used in the high-ε-polylysine-producing multi-gene overexpression engineered strain was *Streptomyces chromogenicis*. Streptomyces.diastatochromogenes 6#-7, strain preservation number is CGMCC No.22261.
4. The method for constructing a high-yield ε-polylysine-producing multi-gene overexpression engineered strain according to any one of claims 1 to 3, characterized in that: The construction steps are as follows: (1) Extraction E. coli The recombinant plasmid pIMEP-asnO-argD from the DH5α-positive transformant was transformed into methylation-deficient Escherichia coli. E. coli ET12567 / PUZ8002; Positive transformants were obtained through antibiotic screening. The positive transformants were cultured in liquid culture medium to the logarithmic growth phase, and the cells were collected by centrifugation, washed to remove antibiotics, and resuspended for later use. (2) Collection S. diastatochromogenes Fresh spores of strains 6#-7 were prepared into spore suspensions; the spore suspensions were subjected to heat shock treatment, followed by the addition of germination-promoting medium to induce spore germination; the germinated spores were collected by centrifugation and resuspended for later use. (3) The material prepared in step (1) E. coli ET12567 / PUZ8002 positive rotor bacterial suspension and the strain prepared in step (2) S. diastatochromogenes The germination spores from strains #6 and #7 were mixed 1:1 and spread onto conjugation transfer medium for culture. Resistance selection was performed by covering the plates with a solution containing nalidixic acid and apramycin. Culture continued until single colonies appeared, and positive conjugates were selected to obtain the high-yield α-polylysine-producing genetically engineered strain. S. diastatochromogenes asnO-argD.
5. The *Escherichia coli* according to claim 5 E. coli DH5α positive transformant, characterized by: The E. coli E. coli The steps for constructing DH5α positive transformants are as follows: (1) with S. diastatochromogene Using genomic DNA from s6#-7 as a template, PCR amplification was performed using specific primers to obtain... asnO Gene fragment (SEQ ID No. 1) and argD Gene fragment (SEQ ID No. 2); further amplification to obtain a gene fragment with a promoter. ermE ; (2) Using the homologous recombination method, the... asnO The gene fragment was ligated into the enzyme-digested linearized pIMEP plasmid vector to construct the recombinant plasmid pIMEP-asnO. (3) Using the homologous recombination method, the... ermE-argD The gene fragment was ligated into the enzyme-digested and linearized recombinant plasmid pIMEP-asnO to construct the co-expression recombinant plasmid pIMEP-asnO-argD. (4) The recombinant plasmid pIMEP-asnO-argD was transformed into... E. coli In DH5α competent cells, cells containing the recombinant plasmid pIMEP-asnO-argD were obtained through apramycin resistance screening. E. coli DH5α positive transformant.
6. The application of the high-yield ε-polylysine multi-gene overexpression engineered strain as described in any one of claims 1 to 3 in the fermentation production of ε-polylysine, characterized in that: The fermentation production method is as follows: The strain used was a genetically engineered strain. S. diastatochromogenes The asnO-argD method involves inoculating the genetically engineered strain onto Benat medium plates and culturing at 30 °C until gray conidia are produced. The conidia are then inoculated into shake flasks containing glucose in M3G medium and cultured at 30 °C and 200 r / min for 28–32 h. The resulting seed culture is then transferred to a fermenter containing M3G medium, and a mixed carbon and nitrogen source is added simultaneously for fermentation for 220–240 h to obtain a fermentation broth containing ε-polylysine.
Citation Information
Patent Citations
Genetically-engineered high-producing strain streptomyces diastatochromogenes, production method of epsilon-polylysine and application
CN111621454A