Application and method of NtZFP26 gene in promotion of nicotine synthesis

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application and a method of an NtZFP26 gene in promoting nicotine synthesis. The invention finds and verifies that the tobacco C2H2 type zinc finger protein transcription factor NtZFP26 can be specifically combined with a promoter of a nicotine synthesis key gene NtQPT2, and activates the transcription expression of the nicotine synthesis key gene NtQPT2, thereby positively regulating the biosynthesis of nicotine. Experiments prove that the NtZFP26 gene specifically expressed at the root of tobacco is regulated by topping and hormones such as NAA, ABA and MeJA; knockout of the NtZFP26 gene can lead to significant reduction of tobacco nicotine content and synthesis key gene expression quantity. The invention provides a key gene target and a new technical approach for directionally regulating and controlling the nicotine content of tobacco through a genetic engineering means.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically involving NtZFP26 Applications and methods of genes in promoting nicotine synthesis. Background Technology

[0002] Nicotine, the most abundant alkaloid in tobacco, accounts for 90%-95% of the total alkaloid content. Its synthesis and accumulation are not only a core characteristic of tobacco quality formation but also play a crucial role in plant defense responses against diseases and pests. Therefore, the regulation of nicotine synthesis has always been a research focus in the fields of tobacco molecular biology and metabolic engineering. Existing research has clarified that nicotine is mainly synthesized in the root tip cortex, epidermal cells, and parenchyma cells around the vascular bundles of tobacco. After synthesis, it is transported to the aboveground parts through vascular tissue and finally stored in the vacuoles of tobacco leaf cells. Its biosynthetic pathway has also been basically elucidated at the molecular level, involving the combination of pyrrole and pyridine rings through multiple enzymatic reactions. Key enzyme genes such as putrescine N-methyltransferase (PMT), quinolinate phosphoribosyltransferase (QPT), isoflavone reductase-like protein (A622), and berberine bridging enzyme-like protein (BBL) directly determine the rate and total amount of nicotine synthesis.

[0003] Nicotine biosynthesis is a complex process regulated at multiple levels. Besides the direct action of key enzyme genes, the regulation at the transcriptional level by transcription factors is particularly crucial. Currently, the regulatory mechanisms of transcription factor families such as ERF (ethylene response factor) and bHLH (basic helix-loop-helix) in nicotine synthesis have been thoroughly elucidated. For example, members of the ERF family, such as NtERF168 and NtERF189, can bind to promoters of key genes like PMT and regulate nicotine synthesis in response to jasmonic acid signals. Members of the bHLH family, such as NbbHLH1 / 2 and NtMYC2a / b, can precisely regulate downstream gene expression by binding to G-box elements of PMT gene promoters. However, whether the C2H2-type zinc finger protein (C2H2-ZFP) transcription factor family, which is the most widely distributed and functionally diverse in plants, participates in the regulation of tobacco nicotine synthesis has not yet been reported.

[0004] Members of the C2H2-ZFP family form stable zinc finger structures through coordination of two cysteine ​​(Cys) and two histidine (His) residues in their conserved domains with zinc ions. These structures can specifically bind to cis-acting elements of target gene promoters, playing a crucial role in plant growth and development, stress response, and hormone signal transduction. More importantly, increasing research confirms that C2H2-ZFPs can participate in the regulation of plant secondary metabolic synthesis: for example, Aquilaria sinensis AsZFP9 can activate the rate-limiting enzyme gene for sesquiterpene synthesis, increasing sesquiterpene yield; Artemisia annua AaZFP1 can positively regulate the expression of key genes involved in artemisinin synthesis; and soybean GmZFP7 and apple MdZAT5 also regulate isoflavone and anthocyanin accumulation, respectively. However, no research has yet clearly defined the regulatory value of tobacco C2H2-ZFP family members in nicotine synthesis, especially lacking C2H2-ZFP gene resources that can directionally promote nicotine synthesis. This results in an incomplete transcriptional regulatory network for nicotine synthesis, limiting the development of technologies for improving tobacco nicotine content through precise genetic engineering.

[0005] Therefore, developing a new C2H2-ZFP gene that effectively promotes nicotine synthesis provides a new key gene target for the targeted enhancement of tobacco nicotine content through genetic engineering, which is of great significance for improving the nicotine synthesis regulation technology system and promoting targeted breeding of tobacco quality. Summary of the Invention

[0006] To address the above shortcomings, this invention provides a member of the tobacco C2H2-ZFP family. NtZFP26 The gene was identified, and its expression pattern in tobacco roots was clarified, showing an initial increase followed by a decrease in expression levels with topping time and regulation by hormones such as NAA / ABA / MeJA. Yeast one-hybrid and dual-luciferase experiments confirmed that it can specifically bind to and activate the promoter of NtQPT2, a key gene for nicotine synthesis. The loss of function of the ntzfp26 mutant constructed using CRISPR / Cas9 was verified to lead to a significant decrease in nicotine content and expression of key genes for nicotine synthesis. This provides a new gene resource for targeted promotion of nicotine synthesis and related functional verification and genetic manipulation methods.

[0007] The technical solution of this invention is as follows: On the one hand, the present invention provides NtZFP26 The application of genes in promoting nicotine synthesis.

[0008] Specifically, the NtZFP26 The gene-encoded protein can specifically bind to and activate the promoter of NtQPT2, a key gene in nicotine synthesis.

[0009] Specifically, the NtZFP26 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0010] In another aspect, the present invention provides a method for increasing the nicotine content of plants, the method comprising the step of increasing the expression and / or activity of the NtZFP26 gene in plants.

[0011] Specifically, the increase NtZFP26 Gene expression and / or activity are achieved by including the above-mentioned gene expression and / or activity. NtZFP26 Gene expression vectors are used to introduce genes into plant cells or tissues.

[0012] Specifically, the expression vector conversion method is to convert the expression vector containing NtZFP26 The recombinant vector of the gene is introduced into plant cells or tissues, and positive plants are obtained through screening. The transformation method is Agrobacterium-mediated leaf disc method.

[0013] Specifically, the expression vector contains a constitutive promoter, a tissue-specific promoter, or an inducible promoter to drive the expression vector. NtZFP26 Gene expression.

[0014] Preferably, the expression vector comprises NtQPT2 Promoter.

[0015] Preferably, the expression vector is selected from recombinant vectors constructed based on pGreenII series vectors or pORE series vectors.

[0016] Specifically, the plant in question is a member of the genus *Nicotiana*.

[0017] Preferably, the tobacco plant includes common tobacco variety K326 or Nicotiana benthamiana.

[0018] In another aspect, the present invention provides a method for identifying or screening plants with the potential to promote nicotine synthesis, the method comprising detecting in the plant... NtZFP26 Steps for determining gene expression levels and / or activity.

[0019] Specifically, the NtZFP26 Gene expression levels can be detected using qRT-PCR technology, with the NtGAPDH gene as an internal control. The target fragment is amplified using specific primers, and 2... -ΔΔCt The relative expression level is calculated using this method.

[0020] Specifically, the activity of the NtZFP26 protein can be detected by verifying its binding ability to the NtQPT2 promoter through a yeast one-hybrid assay, or by detecting its transcriptional activation efficiency to the NtQPT2 promoter through a dual-luciferase assay.

[0021] Specifically, the screening method can be used in tobacco breeding to preferentially select... NtZFP26 Plants with high gene expression levels and strong activity were used as parents, or plants that had undergone gene editing were directly selected. NtZFP26Mutants that enhance gene function.

[0022] Specifically, the method can also be combined with nicotine content detection results for joint screening, when the plant contains... NtZFP26 When the gene expression level is significantly higher than that of the control, the nicotine content usually has a higher potential, and the amount of nicotine accumulation can be quantitatively verified by GC-MS technology.

[0023] The beneficial effects of this invention are as follows: (1) This invention clarifies the regulatory role of NtZFP26, a member of the C2H2 type zinc finger protein transcription factor family, in nicotine synthesis in tobacco, enriches the transcriptional regulatory network of nicotine synthesis, and provides key theoretical support for a comprehensive analysis of the molecular mechanism of nicotine synthesis.

[0024] (2) The NtZFP26 gene can serve as a core gene target for targeted regulation of nicotine content, providing a novel tool for improving tobacco nicotine content through genetic engineering. Compared with traditional breeding methods, molecular breeding techniques based on this gene are more targeted, enabling precise regulation of tobacco nicotine content and promoting the process of targeted breeding for tobacco quality.

[0025] (3) This invention elucidates the molecular mechanism by which NtZFP26 positively regulates nicotine synthesis by specifically binding to the promoter of NtQPT2, a key gene in nicotine synthesis, activating its transcriptional expression. The revelation of this mechanism provides a reference paradigm for the study of the synthesis regulation of other plant secondary metabolites and lays the foundation for the subsequent development of biotechnology products related to nicotine synthesis regulation.

[0026] (4) The expression of NtZFP26 is regulated by multiple plant hormones such as NAA, ABA, and MeJA, and it is specifically expressed in tobacco roots and changes dynamically with the time of topping. This characteristic enables the gene to respond to environmental and physiological signals during the growth and development of tobacco, providing more possibilities for flexibly regulating nicotine synthesis through exogenous hormone regulation or agronomic measures combined with genetic engineering. Attached Figure Description

[0027] Figure 1 For tobacco NtZFP26 The expression is as follows: where 'a' represents the root value at different time periods. NtZFP26 Relative gene expression levels; b represents the relative expression level of the NtZFP26 gene under different hormone treatments; data are expressed as mean ± standard deviation (n = 3), bars marked with different letters indicate significant differences at the p < 0.05 level, and asterisks indicate significant differences compared to the control (*). p <0.05,** p <0.05, *** p <0.001).

[0028] Figure 2 For tobacco NtZFP26 Yeast one-hybrid assays for interaction with the NtQPT2 promoter. In the figures, a represents AbA concentration screening to inhibit promoter self-activation; b represents interaction verification; and c represents TLC verification.

[0029] Figure 3 For tobacco NtZFP26 Regulation of transcriptional activity of the NtQPT2 promoter. In the figure, a represents chemiluminescence imaging; b represents the relative fluorescence intensity of LUC. Data are expressed as mean ± standard deviation (n = 3), and asterisks indicate significant differences compared to wild type (*). p <0.05), ns indicates that the difference is not significant.

[0030] Figure 4 for NtZFP26 Genes regulate nicotine synthesis in tobacco. Here, a represents the nicotine content in wild-type and the mutant ntzfp26; b represents the relative expression levels of key genes involved in nicotine synthesis in wild-type and the mutant ntzfp26. Data are expressed as mean ± standard deviation (n = 3), and asterisks indicate significant differences compared to the wild type (*). p <0.05,** p <0.05, *** p <0.001). Detailed Implementation

[0031] The present invention will be further clearly and completely illustrated below through embodiments. These embodiments are only some examples of the present invention and are not intended to limit the present invention, but are only for illustrating the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional experiments, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0032] Example 1 NtZFP26 The basic information of the gene is as follows: This gene is a member of the tobacco C2H2 type zinc finger protein transcription factor family, with the systematic nomenclature number Nitab4.5_0000486g0080, located on tobacco chromosome 23. The encoded protein consists of 228 amino acids, with a predicted molecular weight of 25.78 kDa and a theoretical isoelectric point of 9.56, classifying it as a basic protein. Subcellular localization analysis shows that the NtZFP26 protein is mainly located in the cell nucleus, consistent with its function as a transcription factor regulating gene expression. Structurally, NtZFP26 It contains 2 exons and 1 intron.

[0033] NtZFP26 The nucleotide sequence of the gene (SEQ ID NO: 1): ATGGTAACCCTCAAAAGAGATGTACATTTACACCCCAAAGGTGGTCAAGACGTTCTTTCTTCTTCTTCGTCTTCGTCTTGTCAAGATGAAAGAAACTATCGTAAACAAGAAGAAGATCATCAGAATGCCACAGAAGATATCAGACTCCGTGGGAAAAGCAGTGGCGATGGCGATGGAGATGAGTCGGACCATAGAAAGAATCCGGAACTGAATCTGCTTGAACGTTTAAACACAAATAATAGTCCAATATGTAATGAAAATGATCCAACATCAGATGGTGCAGAGCCAAGAGTATTCTCGTGCAACTATTGTCAAAGGAAATTCTACAGTTCACAAGCATTAGGAGGACATCAAAATGCACATAAGAGAGAAAGAACACTTGCCAAAAGAGCTGGTCAGAGACCAATTGGACATCACCTTTTCAATTTTACCCCAACAGCTGCTGCTGCTGCTTTTGGCCATCATCCATATCTAAGAGTACAGCATCAGAATAACTATAATTTTGTTAGCAGTATGTCTACCCTGCCTCTAAATGGTGCAAATTATCAGAACAATTCTCTGGAAATTCAGGCACATTCTATGATTCATAAAGCAACAAATAGTAGTGGAAATTGGTCAAACAGGCAATTCATCAAACACCAACCAGGTGTAGGAAAACTGTCTATGATTCCTAAAGGAAATATTCACTTCATTCCCCAAGAAGAGAACAAAAGTGACTTGCAAAAGATTGATCTTTCTCTCAAGCTCTAG。

[0034] 1.1 Materials and Methods 1.1.1 Experimental Materials and Treatments Common tobacco varieties K326 (Nicotiana tabacum) and Nicotiana benthamiana were used as materials and cultivated in a greenhouse at the Beijing Institute of Life Sciences. The cultivation conditions were 75% relative humidity, 16 hours of light / 8 hours of darkness, and 28℃. Roots of common tobacco K326 were collected 1 day, 3 days, 5 days, and 7 days after topping for NtZFP26 gene expression level analysis. Three weeks after sowing K326 tobacco seeds, seedlings with uniform growth were selected and transferred to different solutions (10 μM each) for 6 h, including 1-naphthaleneacetic acid (NAA), abscisic acid (ABA), 6-benzyladenine (6-BA), GR-24, gibberellic acid (GA3), salicylic acid (SA), and methyl jasmonate (MeJA), with ddH2O as a control. Roots and middle leaves during the vigorous growth stage were collected to determine nicotine content, and RNA was extracted from root and shoot apical tissues for gene expression level detection. Each experiment was performed in triplicate.

[0035] 1.1.2 Analysis of the expression pattern of tobacco NtZFP gene Total RNA was extracted from tobacco using the GenePure Polysaccharide and Polyphenol Plant RNA Rapid Extraction Kit (Catalog No.: RE120-02) (Beijing Codon Biotechnology Co., Ltd.), and the RNA was reverse transcribed into cDNA using the PrimeScript™ RTreagent Kit (Perfect RealTime) Kit (Catalog No.: RR036A) (Baori Biotechnology (Beijing) Co., Ltd.). Analysis was performed using qRT-PCR (Real-Time Quantitative PCR). NtZFP26 The expression levels of genes in tobacco roots at different growth stages and under different hormone treatments, with tobacco as the main component. NtGAPDH Genes were used as internal controls, and each sample included three replicates. Two [references were used]. -ΔΔCt The relative expression levels of genes were calculated using Microsoft Excel. Significance analysis and visualization were performed using Graphpad Pism 9.5 and SPSS Statistics 27.0.

[0036] 1.1.3 Expression vector construction and genetic transformation Will NtZFP26The gene sequence was imported into the CRISPR Multi Targeter website (http: / / www.multicrispr.net / index.html), and gene editing primers for synthesizing sgRNA were designed and ligated into the pORE-Cas9 vector (vector source: [1] Chen Yudong, Li Bingyu, Xu Li, et al. Expression pattern of tobacco NtPYL6 and its regulatory function on rutin synthesis [J]. Tobacco Science and Technology, 2025, 58(02):29-40.DOI:10.16135 / j.issn1002-0861.2024.0444). Tobacco transformation was carried out by Agrobacterium-mediated leaf disc method, and positive seedlings were obtained. Gene-edited seedlings were sequenced for identification. Primers for identification and sequencing of gene-edited plants are shown in Table 1.

[0037] Table 1 Primer sequences

[0038] 1.1.4 Yeast One-Hybrid (YIH) Experiment Will NtZFP26 The coding sequence was cloned into the pGADT7 vector (catalog number: 630442, Baori Biotechnology (Beijing) Co., Ltd.) via homologous recombination, and then... NtQPT2 The promoter sequence 1212 bp upstream of the gene was cloned into the pAbAi vector (Catalog No.: 630491, Baori Biotechnology (Beijing) Co., Ltd.).

[0039] NtQPT2 The promoter sequence 1212 bp upstream of the gene (SEQ ID NO: 2):

[0040] pAbAi- NtQPT2 After linearization, the plasmid was transformed into the Y1HGold yeast strain. Positive clones were obtained through selection on SD / -Ura medium and verified by PCR. Subsequently, to determine the minimum inhibitory concentration of AbA for subsequent interaction screening, the verified Y1HGold [pAbAi- NtQPT2 The strain was plated on SD / -Ura plates containing a gradient concentration of AbA from 0 to 900 ng / mL. Based on colony growth, the final screening concentration was selected for subsequent interaction validation experiments. During interaction validation, pGADT7- NtZFP26 The plasmid was transformed into the Y1HGold strain containing the reporter vector and plated on SD / -Leu medium containing the determined concentration of AbA. Simultaneously, a positive control pAbAi-53+pGADT7-Rec- was prepared. 53 negative pAbAi- 53 +pGADT as a control. pAbAi-53 (Catalog No.: 630491, Baori Biotechnology (Beijing) Co., Ltd.); pGADT7-Rec (Catalog No.: 630491, Baori Biotechnology (Beijing) Co., Ltd.).

[0041] 1.7 Dual-luciferase signal detection Using homologous recombination NtQPT2 promoter sequence and NtZFP26 The sequences were constructed into pGreenⅡ0800-LUC and pGreenⅡ62-SK vectors respectively (vector source: [1] Chen Yudong, Li Bingyu, Xu Li, et al. Expression pattern of tobacco NtPYL6 and its function in regulating the synthesis of rutin [J]. Tobacco Science and Technology, 2025, 58(02):29-40.DOI:10.16135 / j.issn1002-0861.2024.0444). The recombinant vector and the empty vector were transformed into Agrobacterium GV3101 (product number: ZC141-2, Beijing Zhuangmeng International Biotechnology Co., Ltd.) competent cells by freeze-thaw method, and positive clones were selected and cultured into OD. 600The value was 0.9. The bacterial cells were resuspended in infection solution (10 mM MgCl2, 150 μM acetylsalicylic acid, 10 mM MES) and induced in the dark for 2 h. Promoters and transcription factors were injected into tobacco at a 1:1 ratio, cultured in the dark for 12 h, followed by 36 h of normal photoperiod culture. Then, 1 mM D-luciferin potassium salt was sprayed onto the underside of tobacco leaves, and after 5 min of dark treatment, the leaves were photographed using a chemiluminescence imaging system. After photographing, samples were taken using a 0.5 cm punch, and the relative intensity of the LUC signal was detected using a glow-type dual-luciferase reporter gene assay kit (catalog number: 11405ES60, Yisheng Biotechnology (Shanghai) Co., Ltd.) according to its instructions.

[0042] 1.1.5 Dual-luciferase signal detection Using homologous recombination NtQPT2 promoter sequence and NtZFP26 The sequences were constructed into pGreenⅡ0800-LUC and pGreenⅡ62-SK vectors, respectively (vector source: [1] Chen Yudong, Li Bingyu, Xu Li, et al. Expression pattern of tobacco NtPYL6 and its function in regulating the synthesis of rutin [J]. Tobacco Science and Technology, 2025, 58(02):29-40.DOI:10.16135 / j.issn1002-0861.2024.0444). The recombinant vector and the empty vector were transformed into Agrobacterium GV3101 competent cells by freeze-thaw method, and positive clones were selected and cultured into OD. 600 The value was 0.9. The bacterial cells were resuspended in infection solution (10 mM MgCl2, 150 μM acetylsalicylic acid, 10 mM MES) and induced in the dark for 2 h. Promoters and transcription factors were injected into tobacco at a 1:1 ratio, and the cells were cultured in the dark for 12 h, followed by 36 h of normal photoperiod culture. Then, 1 mM D-luciferin potassium salt was sprayed onto the underside of tobacco leaves, and after 5 min of dark treatment, the leaves were photographed using a chemiluminescence imaging system. After photographing, samples were taken using a 0.5 cm punch, and the relative intensity of the LUC signal was detected using a glow-type dual-luciferase reporter gene assay kit (catalog number: 11405ES60, Yisheng Biotechnology (Shanghai) Co., Ltd.) according to its instructions.

[0043] 1.1.6 Nicotine content detection Plant root and leaf samples were immediately flash-frozen in liquid nitrogen and then freeze-dried under vacuum for 72 h. 50 mg of sample was accurately weighed and placed in a 15 mL centrifuge tube, and 2 mL of 5% (w / v) sodium hydroxide solution was added. The tube was shaken to ensure thorough wetting. After standing for 15 min, 10 mL of methyl tert-butyl ether (MTBE) solution containing 0.0361 mg / mL 2-methylquinoline (internal standard) was added, and the tube was ultrasonically extracted for 15 min. After standing overnight, the tube was centrifuged at 5000 r / min for 5 min. 2 mL of the supernatant organic phase was filtered through a sterile filter containing anhydrous sodium sulfate (4 g), and the filtrate was collected in a 2 mL chromatographic vial. Finally, the nicotine content in tobacco was precisely quantified using an Agilent 8890-5977C gas chromatography-mass spectrometry (GC-MS) system equipped with a DB-WAX column. Instrument conditions: DB-WAX (60 m × 0.25 mm × 0.25 μm) column; carrier gas: He, 99.999%; flow rate: 1.0 mL / min; injection port temperature: 250℃; injection: split injection, split ratio: 10:1; injection volume: 1 μL; temperature program: initial temperature 100℃, initial time 3 min, increasing to 250℃ at a rate of 8℃ / min, holding for 10 min; solvent delay: 5 min; transfer line temperature: 250℃; ion source: EI; electron energy: 70 eV; ion source temperature: 230℃; quadrupole temperature: 150℃; scan mode: SIM.

[0044] 1.2 Results and Analysis 1.2.1 Expression of NtZFP26 in tobacco To further clarify the expression dynamics of NtZFP26 in roots, qRT-PCR was used to detect its expression level at different stages of tobacco root development. Figure 1 (a) Analysis showed that the expression level of NtZFP26 exhibited a trend of first increasing and then decreasing with the time of topping. The expression level gradually increased after topping, reaching a peak at day 5, and then decreased at day 7. Further examination of the expression level of NtZFP26 under different hormone treatments revealed that NAA, ABA, and MeJA significantly induced NtZFP26 expression, while 6-BA, GA3, and SA significantly inhibited its expression. Figure 1 (b) This indicates that NtZFP26 is specifically expressed in tobacco roots, and its expression level first increases and then decreases with the time of topping, while its expression level is significantly regulated by multiple plant hormones such as ABA and MeJA.

[0045] 1.2.2 Tobacco NtZFP26 and NtQPT2 Promoter Interaction Analysis Investigating through yeast one-hybrid experiments NtZFP26 Key functional genes in the nicotine biosynthesis pathway NtQPT2 The interaction relationship was analyzed, and the results showed that the promoter self-activation detection revealed that Y1HGold[pAbAi-pro] NtQPT2 The +pGADT7 strain did not form colonies on SD / -Leu plates containing 100 ng / mL AbA, indicating that this AbA concentration can be used for subsequent interaction verification. Figure 2 (a) The interaction verification results show that Y1HGold[pAbAi-pro] NtQPT2 +pGADT7- NtZFP26 The strain can form colonies on SD / -Leu plates containing 100 ng / mL AbA, indicating that... NtZFP26 and NtQPT2 Promoters have interaction relationships ( Figure 2 (b) Further single clones were selected and inoculated onto SD / -Leu plates and SD / -Leu plates containing 100 ng / mL AbA. The results were consistent with the previous interaction verification. All experimental groups and control groups grew normally on SD / -Leu plates; the positive control (Y1HGold[pGADT7-Rec- 53 +pAbAi- 53 The strain (Y1HGold[pGADT7+pAbAi-)) grew normally on SD / -Leu plates containing 100 ng / mL AbA, while the negative control (Y1HGold[pGADT7+pAbAi-)) did not. 53 The strain [ ] could not grow. The above results demonstrate that this experimental system is reliable. Figure 2 (c) In summary, the NtZFP26 protein can interact with the nicotine synthesis pathway. NtQPT2 Gene promoters bind specifically to the gene, which may then regulate the gene's structure. NtQPT2 Gene expression.

[0046] The effects of NtZFP26 protein on the dual-luciferase assay were analyzed. NtQPT2 The transcriptional regulatory role of the promoter was investigated, and the results showed that the experimental group (pGreenII0800-LUC-pro) NtQPT2 +pGreenII62-SK- NtZFP26 The fluorescence intensity of pGreenII0800-LUC-pro was significantly higher than that of the control group. NtQPT2 +pGreenII62-SK)( Figure 3 (a and b in the text). This indicates that the NtZFP26 protein can activate... NtQPT2 Promoter, thereby promoting NtQPT2 Transcriptional expression of genes.

[0047] Yeast one-hybrid assays and dual-luciferase assays confirmed that NtZFP26 Capable of directly binding to key genes in nicotine biosynthesis NtQPT2 The promoter is activated, and its transcriptional activity is activated. NtQPT2 It is a key rate-limiting enzyme gene in the nicotine synthesis pathway, and its encoded quinolinate phosphoribosyltransferase can catalyze the key steps in nicotine synthesis.

[0048] 1.2.3 NtZFP26 Participating in the regulation of nicotine biosynthesis Nicotine content was determined in leaf and root tissues of WT and ntzfp26 mutant tobacco. The results showed that, compared with WT, the nicotine content in the roots of the ntzfp26 mutant showed a significant decreasing trend, and the nicotine content in the leaf tissue was also significantly reduced. Figure 4 (a) indicates that NtZFP26 Loss of gene function significantly affects the synthesis or accumulation of nicotine in tobacco. Further analysis of the expression levels of key genes involved in nicotine synthesis in the roots of WT and ntzfp26 mutants revealed crucial synthetic genes. NtPMT1 , NtBBL , NtA622 and NtQPT2 The expression levels of both were significantly lower than those of WT ( Figure 4 (b) in the text is a prompt. NtZFP26 It may participate in the synthesis and metabolism of tobacco nicotine by positively regulating the expression of core genes in the nicotine synthesis pathway.

[0049] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. NtZFP26 The application of genes in promoting nicotine synthesis.

2. The application according to claim 1, characterized in that, The NtZFP26 The gene-encoded protein can specifically bind to and activate the promoter of NtQPT2, a key gene in nicotine synthesis.

3. The application according to claim 1 or 2, characterized in that, The NtZFP26 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. A method for increasing the nicotine content of plants, characterized in that, The method includes the steps of increasing the expression and / or activity of the NtZFP26 gene in plants.

5. The method according to claim 4, characterized in that, The increase NtZFP26 Gene expression and / or activity are achieved by including the above-mentioned gene expression and / or activity. NtZFP26 Gene expression vectors are used to introduce genes into plant cells or tissues.

6. The method according to claim 5, characterized in that, The expression vector contains a constitutive promoter, a tissue-specific promoter, or an inducible promoter to drive the expression vector. NtZFP26 Gene expression.

7. The method according to claim 6, characterized in that, The expression vector is selected from recombinant vectors constructed based on pGreenⅡ series vectors or pORE series vectors.

8. The method according to any one of claims 4-7, characterized in that, The plant in question is a member of the genus *Nicotiana*.

9. The method according to claim 8, characterized in that, The tobacco plants mentioned include common tobacco variety K326 or Nicotiana benthamiana.

10. A method for identifying or screening plants with the potential to promote nicotine synthesis, characterized in that, The method includes detecting in the plant NtZFP26 Steps for determining gene expression levels and / or activity.

Images