Use of a kasp molecular marker in identifying melon fruit skin color trait

Abstract

The application discloses application of a KASP molecular marker in identification of a melon fruit peel color character and belongs to the technical field of molecular markers. The application aims to use molecular marker assisted selection breeding in the melon fruit peel color character so as to promote gene positioning and the molecular assisted breeding process. The KASP molecular marker is a KASP marker RW4, and the KASP marker RW4 is designed according to a SNP site at Chr04:537543. The application uses the KASP molecular marker RW4 to genotype red fruit peel melons and white fruit peel melons, and only needs to amplify the target plant DNA through one-time PCR, and the whole detection process is simple, and complex steps such as enzyme cutting, electrophoresis and sequencing are not needed. Through a high-throughput genotyping system, a genotyping map and a typing value can be rapidly obtained, so that the rapid identification of the genotype of the target plant can be realized. The KASP molecular marker RW4 in the application can be more efficiently applied to the breeding of melon fruit peel color germplasm.

Description

Technical Field

[0001] This application belongs to the field of molecular marker technology, specifically relating to the application of a KASP molecular marker in identifying the color traits of melon peel. Background Technology

[0002] Muskmelon (Cucumis melo L.) is an annual herbaceous plant belonging to the genus Cucumis in the family Cucurbitaceae. It is also one of the important economic crops of the Cucurbitaceae family and has a long history of cultivation in my country. To further promote the development of the muskmelon industry, cultivating high-quality and distinctive varieties is an important direction in the current muskmelon breeding field.

[0003] Peel color is an important commercial trait of melons, and understanding its regulatory mechanism is of great significance for variety improvement, market segmentation, and germplasm resource utilization. Currently, the breeding of melon peel colors, especially red peels, mainly relies on traditional phenotypic observation, which suffers from problems such as long cycles and low efficiency. Summary of the Invention

[0004] The purpose of this application is to provide an application of KASP molecular markers in identifying the trait of melon peel color. The aim is to use KASP molecular markers to identify melon seedlings, thereby distinguishing between red and white peel traits, improving the breeding efficiency of melons with target traits, and further shortening the breeding cycle.

[0005] To achieve the above objectives, this application provides an application of the KASP molecular marker in identifying the color trait of melon peel, wherein the identification of the color trait of melon peel includes the following steps:

[0006] Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was then performed based on primer pairs containing the KASP molecular marker RW4 to obtain the gene type of the target melon. Based on the detected gene type, the traits of the target melon were determined.

[0007] The KASP molecular marker RW4 was designed based on the SNP site located at chromosome 537543 in the DHL92 v4 genome of melon.

[0008] As some optional embodiments of this application, the nucleotide sequence of the SNP site is shown in SEQ ID NO.1.

[0009] As some alternative embodiments of this application, the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1.

[0010] As some optional embodiments of this application, the polymorphism of the KASP molecular marker is G or T, the GG genotype is homozygous erythrodermic, the TT genotype is homozygous albinistic, and the GT genotype is heterozygous erythrodermic.

[0011] As some optional embodiments of this application, the PCR amplification includes:

[0012] Pre-denaturation at 94℃ for 15 min;

[0013] Denaturation at 94℃ for 20 seconds

[0014] Annealing at 65℃-57℃ for 45 seconds.

[0015] 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle;

[0016] 94℃ denaturation for 20s, 57℃ annealing and extension for 60s, 30 cycles.

[0017] As some optional embodiments of this application, the gene type is obtained based on the following reaction system: 10 μL KASP 2×reaction mix, 0.02 μL each of primers F1 and F2 at a concentration of 100 μM, 0.06 μL primer R, and 1 μL DNA.

[0018] As some optional embodiments of this application, the primer pair of the KASP molecular marker RW4 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers, respectively.

[0019] As some optional embodiments of this application, the two forward primers include RW4-F1 as shown in SEQ ID NO.2 and RW4-F2 as shown in SEQ ID NO.3, and the reverse primer is RW4-R as shown in SEQ ID NO.4.

[0020] As some optional embodiments of this application, the primer pair of the KASP molecular marker RW4 can be used to prepare a kit for identifying KASP molecular markers for the color traits of melon peel.

[0021] As some optional embodiments of this application, the primer pair of the KASP molecular marker RW4 can be used for germplasm selection of melon peel color.

[0022] In summary, this application has the following advantages:

[0023] Compared to existing technologies, this application successfully developed a KASP molecular marker, RW4, which is closely related to the identification of melon peel color traits. The RW4 molecular marker consists of two forward primers, RW4-F1 and RW4-F2, with lengths of 47 bp and 48 bp respectively, and a reverse primer, RW4-R, with a length of 29 bp. This application utilizes the KASP molecular marker RW4 for genotyping of red and white melons. Identification of the target plant's DNA can be achieved through a single PCR amplification, and the entire detection process is simple, eliminating the need for complex steps such as enzyme digestion, electrophoresis, and sequencing. Using a high-throughput genotyping system, genotyping maps and values ​​can be rapidly obtained, enabling rapid identification of the target plant's genotype. Therefore, the KASP molecular marker RW4 in this application can be applied simply, rapidly, and efficiently to the breeding of melon peel color varieties. Attached Figure Description

[0024] Figure 1 This is a phenotypic comparison diagram of the red-skinned melon type (M1506) and the white-skinned melon type (BPC) involved in the embodiments of this application at different developmental stages;

[0025] Figure 2 This is a schematic diagram of the initial QTL positioning results of the melon peel color involved in the embodiments of this application;

[0026] Figure 3 This is a map of the RW4 SNP sites of the KASP molecular marker in melon involved in the embodiments of this application, where M1506.sorted.bam.Coverage and 132.sorted.bam.Coverage represent the resequencing data of M1506 and BPC, respectively;

[0027] Figure 4 This document presents the genotyping diagrams of the red-skinned melon type "M1506", the white-skinned melon type "BPC", and the F3 generation population involved in the embodiments of this application. Figure 4 In the diagram, (a) represents the sample distribution plate of the population DNA. Figure 4 (b) in the table represents the genotyping results of the population using the KASP molecular marker RW4. NTC (without a reaction template, replaced by ddH2O in the reaction) is the negative control; Empty indicates a void; Unknown indicates an unknown state; Missing indicates no liquid was sprayed into the reaction wells; HDE indicates no fluorescence was detected. Detailed Implementation

[0028] The principles and features of this application are described below with reference to embodiments. The examples are for illustrative purposes only and are not intended to limit the scope of this application. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0029] As mentioned above, breeding melon varieties with red skin can not only increase the commercial value of melons and enrich market diversity, but also help improve the international competitiveness of my country's melon industry and contribute to agricultural development. Furthermore, research on melon skin color by scholars both domestically and internationally has largely focused on green, yellow, and white, with few reports on red melon skin. Therefore, exploring the color-forming mechanism of melon skin and conducting research on the genetic laws and gene mapping of red melon skin is of great significance for guiding the breeding of melons with distinctive skin color.

[0030] Molecular marker technology has been widely applied in gene mapping. Currently, RFLP, RAPD, AFLP, SSR, InDel, and SNP are commonly used methods in molecular marker technology. Kompetitive allele-specific PCR (KASP), as a mainstream high-throughput SNP technology, has achieved high-precision genotyping of biallelic alleles (SNPs and InDels) due to its excellent stability and accuracy. With the rapid development of sequencing technology in my country, InDel and SNP markers can be converted into high-throughput competitive allele-specific PCR markers (KASP) for genotyping of biological populations. This technological advancement will greatly promote the progress of gene mapping and molecular-assisted breeding.

[0031] Based on this, this application details and provides a KASP molecular marker for detecting melon peel color traits. Furthermore, this application also relates to primer pairs associated with the KASP molecular marker, and a kit containing these specific primer pairs, designed for efficient identification of melon peel color traits under laboratory conditions. This application is not limited to providing these molecular markers and kits, but further elaborates on the specific application methods of these tools in the germplasm selection process for melon peel color. Simultaneously, based on the aforementioned KASP molecular marker, primer pairs, and kit, this application details a method for identifying melon peel color traits. This method includes steps such as extracting DNA from melon samples, performing PCR amplification, and using KASP technology for genotyping analysis, thereby achieving accurate identification of melon peel color traits. These all fall under the application of the reagents provided in this application for detecting KASP molecular markers of melon peel color traits.

[0032] In the first aspect, the KASP molecular marker used to identify the color trait of melon peel described in this application is identified as KASP molecular marker RW4; the KASP marker RW4 was designed based on a single nucleotide polymorphism (SNP) at position 537543 on chromosome Chr04 in the melon genome (DHL92-V4) (http: / / cucurbitgenomics.org / v2 / organism / 23).

[0033] Further analysis revealed that the base at this SNP site was mutated from guanine (G) to thymine (T), and its nucleotide sequence can be found in the sequence identifier SEQ ID NO.1.

[0034] The sequence identifier SEQ ID NO.1 and its corresponding variant sites are detailed below:

[0035] AAAACATTTAATGGGGATTTTGAAGATATTGGTGGTGGTAATATTTTGGTG[G / T]TGTTTTGCATGGAATTGAAAGTTTAGGGGAAGGACTTTTTGGTTTTTGACT.

[0036] Secondly, the primer pairs of the KASP molecular markers used to identify the color traits of melon peel described in this application include RW4-F1 as shown in SEQ ID NO.2, RW4-F2 as shown in SEQ ID NO.3, and RW4-R as shown in SEQ ID NO.4.

[0037] The sequence identifiers SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 are detailed below:

[0038] RW4-F1 (SEQ ID NO.2):

[0039] GAAGGTGACCAAGTTCATGCTATATTGGTGGTGGTAATATTTGGTGG.

[0040] RW4-F2 (SEQ ID NO.3):

[0041] GAAGGTCGGAGTCAACGGATTGATATTGGTGGTGGTAATATTTGGTGT.

[0042] RW4-R (SEQ ID NO.4):

[0043] CCAAAAGTCCTTCCCCTAAACTTTCAATT.

[0044] Thirdly, the kit for identifying the color trait of melon peel using the KASP molecular marker described in this application includes the primer pairs of the KASP molecular marker RW4 described in the second aspect, namely RW4-F1 as shown in SEQ ID NO.2, RW4-F2 as shown in SEQ ID NO.3, and RW4-R as shown in SEQ ID NO.4; wherein RW4-F1 as shown in SEQ ID NO.2 and RW4-F2 as shown in SEQ ID NO.3 are forward primers, and RW4-R as shown in SEQ ID NO.4 is a reverse primer. It also includes a Kaspar 2×reactionmix for the reaction (containing: Taq DNA polymerase, dNTPs, MgCl2, FAM and HEX / VIC fluorescent reporter group labeled probes, ROX reference dye, and stabilizer).

[0045] Fourthly, the method for identifying the color characteristics of melon peel described in this application includes the following steps:

[0046] First, genomic DNA was extracted from the target melon. Then, using this genomic DNA as a template, PCR amplification was performed on the Gene Matrix™ high-throughput genotyping system (HC Scientific, Chengdu) using primers labeled with KASP and RW4, employing the Matrix Cycler and Matrix Scanner. Genotypic data analysis was then performed using Matrix Master software.

[0047] The PCR amplification procedure is as follows:

[0048] Pre-denaturation at 94℃ for 15 min;

[0049] 94℃ denaturation for 20s, 65℃-57℃ annealing and extension for 45s, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ per cycle;

[0050] 94℃ denaturation for 20s, 57℃ annealing and extension for 60s, 30 cycles;

[0051] The characteristics of the target melon are determined based on the base types in the test results.

[0052] In a specific implementation, if the detected base type is TT, the target melon will exhibit a homozygous white-skinned phenotype.

[0053] If the detected base type is GG, the target melon will exhibit a homozygous red-skinned phenotype.

[0054] If the detected base type is GT, the target melon will exhibit a heterozygous red-skinned phenotype.

[0055] In a specific embodiment, the primers for KASP-labeled RW4 consist of two forward primers and one reverse primer. The forward primers include RW4-F1 as shown in SEQ ID NO.2 and RW4-F2 as shown in SEQ ID NO.3, while the reverse primer is RW4-R as shown in SEQ ID NO.4. Furthermore, a fluorescent reporter group FAM is added to the 5' end of the forward primer RW4-F1, and a fluorescent reporter group HEX is added to the 5' end of the forward primer RW4-F2.

[0056] The technical solutions of this application will be described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0057] Example 1

[0058] This embodiment provides a more detailed explanation of the identification of genes responsible for the color trait of melon peel and the development of KASP markers:

[0059] S1. In this application study, the following were selected: Figure 1 Two different types of melons were used as experimental materials: the red-skinned type "M1506" and the white-skinned type "BPC" (both types were provided by the Biological Breeding Laboratory of the Xinjiang Uygur Autonomous Region Academy of Agricultural Sciences, and were 6-generation stable inbred lines). Using the red-skinned type "M1506" (P1) as the female parent and the white-skinned type "BPC" (P2) as the male parent, hybridization was successfully performed to obtain F1 generation plants. During the hybridization process, the female parent's hermaphroditic flowers were strictly emasculated and encapsulated for isolation between 5 PM and 6 PM on the same day. The male flowers of the male parent underwent a flower-pinching treatment. The following morning, between 8 AM and 10 AM, the petals of the pinned male flowers on the male parent were removed to expose the stamens. The pollen from the anthers was gently and evenly applied to the stigma of the emasculated female parent's hermaphroditic flowers. Finally, a label indicating the pollination date was attached to the node of the pollinated flower. Subsequently, the F1 generation plants were allowed to self-pollinate to produce F2 generation plants. Phenotypic investigations were conducted on the parents and the F1 and F2 generation plants.

[0060] The color of melon peel was evaluated using a combination of visual inspection and spectrophotometry. Visual inspection categorized melon peel color into six grades: red, orange-red, orange, orange-yellow, yellow, light yellow, and white. Grades 1 and 2 were defined as red, grades 3 and 4 as orange, grades 5 and 6 as yellow, and grade 7 as white. A TS7708 spectrophotometer was used to measure the peel color of mature fruits from each generation, selecting three measurement sites along the equator. The color of melon peel... L, a, b The values ​​were determined by the "CIE Lab" system. LThe value represents brightness, and the numerical value is directly proportional to the brightness of the surface of the object being measured. a The value represents the red-green tint, with positive values ​​indicating red and negative values ​​indicating green. b The value represents the degree of yellow-blue, with positive values ​​indicating yellow and negative values ​​indicating blue. H The hue angle is also known as the color angle. H The value can be derived from a Value and b The value is calculated using the formula:

[0061] .

[0062] Hue angle ( H The formula for calculating the hue angle (also known as the hue angle) is based on the CIE Lab system. a Value (red-green hue) and b The mathematical transformation of values ​​(yellow-blue hue) is fundamentally about converting two-dimensional chromaticity information (color intensity). a and b This is transformed into an intuitive angular value to quantify the "hue" of a color (i.e., the basic appearance of a color, such as red, orange, yellow, etc.), ultimately... H The range is 0° to 360°, corresponding to different hues.

[0063] The color of the peel of mature fruit was determined by visual inspection, combined with measurements taken using a spectrophotometer. L Value and calculated H The value was used to jointly determine the fruit peel color of the parents and F1 and F2 generation plants.

[0064] S2. To further determine the specific location of the gene regulating melon peel color trait, this application selected 30 plants exhibiting white peel and 30 plants exhibiting red peel from the F2 generation population, and also selected two parents as references to construct a mixed pool of extreme traits. These samples were sent to Shanghai Paisenuo Biotechnology Co., Ltd. for in-depth sequencing and genotyping using bulked segregant analysis (BSA) and high-throughput sequencing technology. By analyzing the single nucleotide polymorphisms (SNPs) among the mixed pools, this application successfully identified a region on chromosome 4 of melon that is significantly associated with the peel color trait based on the Euclidean distance (ED) algorithm. The preliminary QTL localization results of melon peel color, i.e., the schematic diagram of the ΔSNP-index association analysis of melon peel color based on SNPs, are shown below. Figure 2 As shown. Figure 2The horizontal axis represents the physical distance on chromosomes (megabase pairs, Mb), visually showing the location range of the target trait gene on the chromosome; the vertical axis represents the SNP-index difference between the two extreme phenotypic pools. That is, ΔSNP-index = SNP-index (high phenotypic pool). The SNP-index (low phenotypic pool) reflects the difference in genotype frequencies at a specific locus between two pools. A larger difference indicates a higher probability of association between that locus and the target trait. The dark blue threshold line represents the 99% confidence interval, and the light blue threshold line represents the 95% confidence interval. The size of this region is defined as 0.1 megabase pairs (Mb). Figure 3 As shown, the horizontal axis represents the base position on each chromosome, and the vertical axis represents the Nth power of the ED value of the SNP. Each point represents a SNP, the black line is the fitted line, and the orange line is the threshold line. Figure 3 132 corresponds to the BPC parent. To further narrow down this candidate region, this application developed a set of KASP (Kompetitive AlleleSpecific PCR) markers closely linked to the color of melon peel within the initially located region.

[0065] S3. Within the 0.1 Mb candidate region, this application further developed a set of KASP molecular marker technologies. Specifically, the KASP marker RW4 was designed based on the 537543rd SNP site located on chromosome Chr04, as shown below. Figure 4 As shown, M1506.sorted.bam.Coverage and BPC.sorted.bam.Coverage represent the resequencing data of M1506 and BPC, respectively. To achieve this labeling, this application designed three sets of primers: RW4-F1 (47 base pairs in length), RW4-F2 (48 base pairs in length), and RW4-R (29 base pairs in length). Subsequently, 104 plants were planted in the F3 population obtained by self-pollination of the F2 generation, and leaf samples were collected from each plant.

[0066] Take young tissue and place it in a 96-well PCR plate. Add 70 μL of Buffer A (containing 50 mM glucose, 25 mM Tris-HCl pH 8.0, and 10 mM EDTA pH 8.0) and heat it in a PCR instrument at 99°C for 2 minutes.

[0067] After cooling to room temperature, add an equal volume of Buffer B (containing 0.2M NaOH and 1% SDS), and centrifuge briefly to thoroughly mix Buffer A and Buffer B to obtain the AB mixture.

[0068] The AB mixture was diluted 20-fold for KASP labeling detection. Tris-HCl is tris(hydroxymethyl)aminomethane hydrochloride, EDTA is ethylenediaminetetraacetic acid, SDS is sodium dodecyl sulfate, and NaOH is sodium hydroxide.

[0069] This application used the KASP molecular marker RW4 for genotyping in order to further screen and confirm the target gene.

[0070] S4. In this study, the KASP molecular marker RW4 was used to genotype individuals from two parental populations, M1506, BPC, and F3. The KASP reaction was performed in a reaction plate, and the reaction system included: 10 μL of Kaspar 2×reactionmix, 0.02 μL each of primers F1 and F2 at a concentration of 100 μM, 0.06 μL of primer R, and 1 μL of DNA.

[0071] The PCR amplification procedure is as follows:

[0072] Pre-denaturation at 94℃ for 15 min;

[0073] 94℃ denaturation for 20s, 65℃-57℃ annealing and extension for 45s, 10 cycles, with the annealing and extension temperature decreasing by 0.8℃ per cycle;

[0074] 94℃ denaturation for 20s, 57℃ annealing and extension for 60s, 30 cycles.

[0075] Through testing, this application successfully categorized the parent and F1 strains into three distinct classes. Figure 4 Furthermore, this application successfully detected three base types in the F3 population. When the genotype of the melon detected is consistent with the white-skinned parent (TT), the target melon's peel color is white at fruit maturity due to carrying a homozygous white-skinned recessive allele (T), thus the target melon's phenotype can be determined to be homozygous white-skinned. When the genotype of the melon detected is consistent with the red-skinned parent (GG), the target melon's peel color is red at fruit maturity due to carrying a homozygous red-skinned dominant allele (G), thus the target melon's phenotype can be determined to be homozygous red-skinned. When the detected base type is GT, the target melon's peel color at fruit maturity is similar to the F1 plant's phenotype because it carries a white-skinned recessive allele (T) and the red-skinned dominant allele (G) is expressed dominantly in the heterozygote (GT). Thus, the target melon's phenotype can be determined to be heterozygous red-skinned.

[0076] This classification result is in Figure 4 This was presented intuitively in the text. Figure 4 (a) represents the sample. Figure 4(b) Markers indicating the completion of the test. First, one group of genotypes is located near the Y-axis, similar to the "BPC" genotype in the parents, and is classified as the homozygous white-skinned genotype TT. Second, another group of genotypes is located near the X-axis, similar to the "M1506" genotype in the parents, and is classified as the homozygous red-skinned genotype GG. Finally, another group of genotypes is located near the axis of symmetry between the X and Y axes, similar to the F1 genotypes, and is classified as the heterozygous red-skinned genotype GT. Based on this, it can be concluded that the KASP molecular marker RW4 can serve as an effective molecular marker for identifying the rind color trait of melons.

[0077] Figure 4 In the diagram, positions A12 and D12 represent "M1506", and positions B12 and E12 represent "BPC", serving as positive controls. Positions C12 and F12 represent F1, while H12 and G12 represent NTC (without a reaction template, using ddH2O instead of nucleic acids in the reaction) serving as negative controls. The FAM channel corresponds to the "M1506" genotype, which is GG; the HEX channel corresponds to the "BPC" genotype, which is TT; and the middle channel corresponds to the heterozygous genotype, which is GT.

[0078] While specific embodiments of this application have been described in detail, this should not be construed as limiting the scope of protection of this application. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims still fall within the scope of protection of this application.

Claims

1. The application of a primer pair for detecting KASP molecular markers in identifying the color trait of melon pericarp, characterized in that, The application includes the following steps: Genomic DNA was extracted from the leaves of the F3 generation melon, and PCR amplification was performed using the genomic DNA of the F3 generation melon as a template. Fluorescence detection was performed based on the primer pair to obtain the gene type of the F3 generation melon. Based on the detected gene type, the traits of the F3 generation melon were determined. The red-skinned type M1506 was used as the female parent and the white-skinned type BPC was used as the male parent to cross and obtain F1 generation melon plants. The F1 generation melon plants were self-pollinated to produce F2 generation plants, and the F2 generation plants were self-pollinated to obtain the F3 generation melon plants. The KASP molecular marker is designed based on the SNP site of melon. The SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1, which is G or T. The polymorphism of the KASP molecular marker at the SNP site is G or T. The F3 generation melon of the GG genotype is homozygous red-skinned, the F3 generation melon of the TT genotype is homozygous white-skinned, and the F3 generation melon of the GT genotype is heterozygous red-skinned.

2. The application according to claim 1, characterized in that, The PCR amplification includes: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 seconds Annealing at 65℃-57℃ for 45 seconds. 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ denaturation for 20s, 57℃ annealing and extension for 60s, 30 cycles.

3. The application according to claim 1, characterized in that, The gene type was obtained based on the following reaction system: 10 μL KASP 2×reaction mix, 0.02 μL each of primers F1 and F2 at a concentration of 100 μM, 0.06 μL primer R, and 1 μL DNA.

4. The application according to claim 1, characterized in that, The primer pair includes two forward primers and one reverse primer, with fluorescent reporter groups FAM and HEX added to the 5' ends of the two forward primers, respectively.

5. The application according to claim 4, characterized in that, The two forward primers are RW4-F1 with nucleotide sequences as shown in SEQ ID NO.2 and RW4-F2 with nucleotide sequences as shown in SEQ ID NO.3, and the reverse primer is RW4-R with nucleotide sequences as shown in SEQ ID NO.

4.

6. The application according to claim 4, characterized in that, The primer pair can be used to prepare a kit for identifying the KASP molecular markers of the F3 generation melon peel color trait.

7. The application according to claim 4, characterized in that, The primer pair can be used for germplasm selection of F3 generation melon peel color.

Images