Method for purifying cocktail of hydrogen-dependent methylotrophic methanogenic archaea, strain and application of strain
By purifying hydrogen-dependent methyltrophic methanogenic archaea through disassembly and separation steps and a cocktail method, the problem of low efficiency in traditional methods was solved, and new strains were obtained for methane production and biogasification.
Patent Information
- Application Number
- CN202410984406.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-22
- Publication Date
- 2026-01-27
AI Technical Summary
Traditional methods have difficulty efficiently purifying hydrogen-dependent methylotrophic methanogenic archaea that are not broadly archaeal, limiting our understanding of their role in the global carbon cycle and methane release.
A cocktail approach involving disassembly and separation steps, combined with metagenomic sequencing, various culture media and culture conditions, was used to gradually purify target archaea by reducing archaeal community diversity and bacterial taxonomic diversity, and by using specific primers and antibiotic combinations.
Efficient and targeted purification of hydrogen-dependent methyltrophic methanogenic archaea was achieved, and a new strain, Methanosuratincola petrocarbonis, was obtained for methane production and biogasification.
Smart Images
Figure HDA0004956976870000011 
Figure HDA0004956976870000012 
Figure HDA0004956976870000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbiology, specifically relating to a cocktail method, strains, and applications for purifying hydrogen-dependent methyl-trophic methanogenic archaea. Background Technology
[0002] Methane is the second most significant greenhouse gas after CO2, impacting global climate change. It is estimated that 1 billion tons of methane in the atmosphere each year originate from methanogenic archaea, equivalent to 2% of the global carbon cycle. 1 Therefore, methanogenic archaea occupy an important position in the global carbon cycle. Methanogenic archaea are a class of strictly anaerobic archaea, widely distributed in terrestrial, deep biosphere, hydrosphere, and anthropogenic anaerobic environments, including terrestrial and underground oil and coal reservoirs, marine and freshwater sediments, animal intestines, and biogas digesters. 2 Methanogenic archaea are mainly classified into hydrogen-trophic, acetate-trophic, methyl-trophic, oxymethyl, and alkyl-trophic types according to their nutritional type. Methyl-trophic archaea can be further divided into methyl cleavage and hydrogen-dependent methyl-trophic archaea. In recent years, metagenomic sequencing has revealed an increasing number of hydrogen-dependent methyl-trophic methanogenic archaea distributed throughout the entire Archaea domain, including the phylum Gastromycota. 3 Archaea 4 Archaea 5 and Fosterella 6 And so on, and are widely distributed in different underground environments. 7 .
[0003] Traditional methods for purifying hydrogen-dependent methyltrophic methanogenic archaea typically employ a one-step process, directly using limiting dilution gradients or rolling tube picking to obtain pure strains. However, these traditional methods are conventional and limited in efficiency, resulting in low purification rates for the target strains. To date, only about ten hydrogen-dependent methyltrophic methanogenic archaea have been purified using traditional methods, all belonging to the phylum *Hyperarchaea*. No pure cultures of non-*Hyperarchaea* phyla have been obtained, significantly limiting our understanding of the role of these methanogenic archaea in the global carbon cycle and methane release. Therefore, there is an urgent need to research new, efficient, and scalable purification methods for methanogenic archaea, which are of great significance for expanding methane production pathways and discovering new functional genes in archaea.
[0004] References:
[0005] 1Thauer,R.K.,Kaster,A.-K.,Seedorf,H.,Buckel,W.&Hedderich,R.Methanogenic archaea:ecologically relevant differences in energyconservation.Nature Reviews Microbiology6,579-591(2008).
[0006] 2Lyu,Z.,Shao,N.,Akinyemi,T.&Whitman,W.B.Methanogenesis.CurrentBiology28,R727-R732,doi:https: / / doi.org / 10.1016 / j.cub.2018.05.021(2018).
[0007] 3Nobu,M.K.,Narihiro,T.,Kuroda,K.,Mei,R.&Liu,W.-T.Chasing the elusiveEuryarchaeota class WSA2:genomes reveal a uniquely fastidious methyl-reducingmethanogen.The ISME journal10,2478-2487(2016).
[0008] 4Evans,P.N.et al.Methane metabolismin the archaeal phylumBathyarchaeota revealed by genome-centric metagenomics.Science350,434-438(2015).
[0009] 5McKay,L.J.et al.Co-occurring genomic capacity for anaerobic methaneand dissimilatory sulfur metabolisms discovered in theKorarchaeota.Nat.Microbiol.4,614-622(2019).
[0010] 6Vanwonterghem,I.et al.Methylotrophic methanogenesis discovered in the archaeal phylum Verstraetearchaeota.Nat.Microbiol.1,16170(2016).
[0011] 7Garcia, PS, Gribaldo, S. & Borrel, G. Diversity and evolution of methane-related pathways in archaea. Annu. Rev. Microbiol. 76, 727-755 (2022).
[0012] 8 Zhou, Z. et al. Non-syntrophic methanogenic hydrocarbon degradation by an archaeal species. Nature 601, 257-262 (2022).
[0013] 9Bolyen, E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852-857 (2019). Summary of the Invention
[0014] This invention provides a method for purifying methanogenic archaea using a cocktail approach, which involves disassembling and separating steps while dynamically combining multiple separation methods to gradually and deterministically simplify the community structure, thereby achieving the goal of highly efficient and targeted purification of hydrogen-dependent methyltrophic methanogenic archaea.
[0015] Therefore, the first objective of this invention is to provide a method for isolating and purifying hydrogen-dependent methylotrophic methanogenic archaea. The second objective is to provide a novel hydrogen-dependent methylotrophic methanogenic archaea of the phylum *Fostellaria*, which can utilize methanol and monomethylamine as electron acceptors and hydrogen as an electron donor to produce methane.
[0016] The third objective of this invention is to provide a method for producing methane using methanogenic archaea fermentation.
[0017] This invention first provides a cocktail method for purifying hydrogen-dependent methyl-trophic methanogenic archaea. Under the premise that the sample contains the target archaea and can grow, the diversity of the archaea community and the diversity of the bacterial groups are reduced in stages, and then the target archaea is purified according to the growth characteristics of the target archaea to obtain the purified target archaea.
[0018] Specifically, the steps are as follows:
[0019] S1 uses metagenomic sequencing and 16S rRNA amplicon sequencing to analyze and select the presence of target archaea in samples for subsequent purification. Multiple different combinations of culture media and conditions were selected for cultivation, and specific primers for the target archaea were designed to determine the optimal culture media and conditions for their growth.
[0020] S2 reduces the diversity of archaeal communities by using high-throughput nutrient-rich dilution culture, continuous gradient dilution culture in original bottles, and controlling the growth substrate of non-target archaea (such as continuous displacement of the air to remove H2 / CO2) to gradually reduce the abundance and concentration of non-target archaea until only target archaea and bacterial groups exist.
[0021] S3 reduces bacterial diversity by adding different types of antibiotic combinations and lysozyme, combined with gradient dilution culture, to reduce bacterial diversity to only one target archaea, namely a hydrogen-dependent methyl-trophic methanogenic archaea and one target bacterium.
[0022] S4 determines whether bacteria and archaea coexist or co-exist based on bacterial and archaeal genome characteristics, combined with the growth cycles of bacteria and target archaea, and microscopic observation. First, pure bacterial cultures are isolated. The effect of antibiotics on bacterial growth is assessed, followed by an assessment of the effect of antibiotics on the target archaea. Appropriate antibiotics are selected, and antibiotics are added at intervals based on the degree of bacterial growth inhibition, with serial dilutions and passages performed until the bacterial concentration is undetectable.
[0023] In a specific implementation, S1 includes the following specific steps:
[0024] 1) Extract DNA from the sample and perform metagenomic and 16S rRNA amplicon sequencing to confirm the community composition and metabolic characteristics of the sample;
[0025] 2) By comparing and analyzing metagenomic and 16S rRNA amplicon sequencing data with the database, it was determined that the sample contained the target archaea;
[0026] 3) Using metagenomic data analysis methods, determine the substrates, nutrients, and growth cofactors that the target archaea can utilize.
[0027] More specifically, the samples are those that potentially contain hydrogen-dependent methyltrophic methanogenic archaea, such as, but not limited to, oilfield reservoir water, oil sludge, hot springs, marine sediments, coal seam water, and soil.
[0028] In a specific implementation, the specific operation of S2 is as follows:
[0029] 1) Place the sample obtained in S1 into an anaerobic bottle, add the basic culture medium, then add the substrate, and incubate at a certain temperature;
[0030] The substrate is at least a substrate required for metagenomic analysis, including methanol and methanol / H2, or further includes one or more of the following substances: crude oil, inactivated oil sludge, n-docosahexane, n-eicosane, n-hexadecane, hexadecylcyclohexane, hexadecylbenzene, butyric acid, propionic acid, acetic acid, formic acid, glucose, yeast extract, pyruvic acid, lactic acid, and H2 / CO2.
[0031] The temperature is set in the range of 20-80℃, and specifically designed according to gradients of 25℃, 35℃, 45℃, 55℃, 65℃ and 75℃ for cultivation;
[0032] 2) After detecting and confirming the methane production in the anaerobic bottle, subculture was carried out;
[0033] Furthermore, the subculture method is as follows:
[0034] a. Collect methanogenic cultures, extract total DNA from the cultures in anaerobic bottles, and continuously monitor the growth of the target archaea using PCR with target archaea-specific primers. At the same time, use qPCR to periodically detect the growth status of the target archaea.
[0035] Furthermore, the specific primer pair is MSR4F / MSR4R or mcrA4F / mcrA4R;
[0036] b. Further select cultures in which the target archaea grow, extract total DNA and perform 16S rRNA amplicon sequencing to determine the composition and abundance of the bacterial community containing the target archaea, providing a reference for subsequent targeted removal of other strains.
[0037] In a specific implementation, S2 operates as follows:
[0038] 1) Based on the S1 metagenomic analysis and the substrates for the growth of the target archaea in S2, the preferred mixed substrates were determined to include yeast extract, casein amino acids, coenzyme M, rumen fluid, acetic acid, lactic acid, and methanol.
[0039] 2) Select a culture containing more than 10% of the target archaea, serially dilute it 10-fold to a 96-well plate, add the nutrient-rich medium containing the mixed substrate to each well, and incubate the culture for 10... -2Up to 10 -4 Dilute to 16 replicate wells, 10 -5 Up to 10 -8 Dilute to 96 replicate wells, set different pH and temperature, add mixed antibiotics for incubation and screening;
[0040] Furthermore, the different pH values are preferably pH 5.4, pH 6.1, and pH 6.5;
[0041] Furthermore, the different temperatures are preferably 35°C, 45°C, and 55°C;
[0042] Furthermore, the mixed antibiotics are preferably 100 mg / L ampicillin, 100 mg / L kanamycin, 50 mg / L vancomycin, and 100 mg / L gentamicin;
[0043] 3) The 96-well plate culture was validated by PCR and subjected to first-generation sequencing; the primer pair for validation was MSR4F / MSR4R, and the primer pair for first-generation sequencing was Arch519F / Arch915R.
[0044] 4) Using a continuous gradient dilution passage method, repeat steps 2) and 3) in step S3, and finally confirm the target archaea with the first-generation sequencing results;
[0045] 5) The culture medium containing the target archaea obtained in step 4) is expanded in an anaerobic tube; furthermore, the expansion culture conditions are the same as those for the target archaea substrate, pH, and temperature.
[0046] 6) Perform 16S rRNA amplicon sequencing on the expanded cultured bacterial solution to clarify the archaeal community structure until the archaeal community contains only one target archaeology and no more than two non-target archaeology. The non-target archaeology is mainly hydrogen-nutritive methanogenic archaeology.
[0047] 7) Using N2 for continuous headspace replacement gas and continuous 0.1-10% dilution of the original bottle for passage, hydrogen-nutritive methanogenic archaea are removed to obtain a simple system containing single-target methanogenic archaea and bacteria.
[0048] In a specific implementation, the specific operation of S3 is as follows: In the simple system of methanogenic archaea obtained in step S2, antibiotics and lysozyme are added simultaneously, and continuous gradient dilution culture is performed to obtain a binary culture containing one bacterium and the target methanogenic archaea.
[0049] Hydrogen-dependent methylotrophic methanogenic archaea in the environment generally also contain hydrogen-producing fermenting bacteria. Theoretically, this binary culture can occur because hydrogen-dependent methylotrophic methanogenic archaea, in the absence of exogenous hydrogen, can only obtain hydrogen through hydrogen-producing fermenting bacteria.
[0050] Furthermore, the antibiotic is one or a combination of several of the following: 100 mg / L ampicillin, 100 mg / L kanamycin, 50 mg / L vancomycin, and 100 mg / L gentamicin; the lysozyme concentration is 500 mg / L.
[0051] In a specific implementation, S4 operates as follows:
[0052] 1) Based on the characteristics of bacterial and archaeal genomes, and considering the inconsistency in the growth cycles of bacteria and target archaea, microscopic observation shows that bacteria and archaea do not aggregate, indicating that the bacteria are not symbiotic with the archaea.
[0053] 2) The antibiotic gradient concentration screening method includes: a) using the bacterial standard strains isolated from the binary culture to screen for antibiotics that have an inhibitory effect on the bacteria in the binary culture but do not inhibit the target archaea; b) adding the screened antibiotics to the binary culture, and adding antibiotics in a cumulative manner after 6-8 days of culture to prevent the antibiotics from becoming ineffective at high temperatures; c) adding antibiotics at 0.1%-10% through continuous dilution and subculturing to remove bacteria.
[0054] 3) Further, the antibiotic is a mixed antibiotic consisting of 500 mg / L erythromycin, 200 mg / L streptomycin and 200 mg / L vancomycin.
[0055] This invention provides a hydrogen-dependent methyl-trophic methanogenic archaea that can use hydrogen as an electron donor and methyl compounds (methanol and monomethylamine) as electron acceptors to produce methane. The strain has a unique phylogenetic position, belonging to the phylum Fosterellata, which is not a broad archaea. Its Latin name is Methanosuratincola petrocarbonis, and its accession number is CGMCC No. 46065.
[0056] The present invention also provides the application of the aforementioned hydrogen-dependent methyl-trophic methanogenic archaea, the strain of which is used to produce methane gas, an energy substance, and / or to biogasify residual crude oil in depleted oil reservoirs.
[0057] The present invention also provides a method for preparing methane, which involves fermenting the aforementioned hydrogen-dependent methyl-trophic methanogenic archaea to synthesize methane from methanol and methylamine using hydrogen gas.
[0058] Preferably, the fermentation temperature is 45-65℃, more preferably 55℃; the fermentation pH is 5.0-7.5, more preferably 6.0-6.5. More preferably, the fermentation temperature is 55℃; the fermentation pH is 6.0-6.5.
[0059] The methanogenic archaea of the phylum Fosterellata with hydrogen-dependent methyl-trophic methanogenic metabolism described in this invention was deposited on July 18, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo. 46065. Attached Figure Description
[0060] Figure 1a This shows the changes in archaeal community structure at different isolation stages of *Fostella*.
[0061] Figure 1b This shows the changes in bacterial community structure at different isolation stages of *Fostellaria fusella*.
[0062] Figure 2 The copy number changes of CCAM 1872(a) and Methanoculleus(Mcl)(b) are shown in successive generations.
[0063] Figure 3 The changes in OD600nm of Acetomicrobium at different antibiotic concentrations are shown. These include ampicillin (a), kanamycin (b), erythromycin (c), chloramphenicol (d), streptomycin (e), vancomycin (f), and a mixture of antibiotics (g).
[0064] Figure 4 The changes in copy number of Acetomicrobium after continuous passage following the addition of a mixed antibiotic show the changes in copy number.
[0065] Figure 5 This shows a gel image of bacterial target fragments detected by 27F / 1492R. PC: positive control, NC: negative control, M: DNA marker map.
[0066] Figure 6 This shows the methanogenesis of CCAM 1872 with different methyl substrates. The substrates are: MeOH (methanol), MMA (monomethylamine), DMA (dimethylamine), TMA (trimethylamine), and MeSH (methanethiol).
[0067] Figure 7 The methanogenesis rate (μ) of CCAM 1872 at different temperatures (a) and different pH values (b) is shown. Detailed Implementation
[0068] The present invention will be described below through specific embodiments in order to better understand the present invention, but this does not constitute a limitation on the present invention.
[0069] Example 1: Isolation and purification method of hydrogen-dependent methyltrophic methanogenic archaea
[0070] The isolation and purification method for the Fostera archaea CCAM 1872, which exhibits hydrogen-dependent methylotrophic methanogenesis, is performed in the following order:
[0071] 1. Sample collection of hydrogen-dependent methylotrophic methanogenic archaea
[0072] 1) Take water or sludge samples from the Shengli Oilfield reservoir and extract DNA using a modified 0.1mm glass bead oscillation method. 8 Metagenomic and 16S rRNA amplicon sequencing were performed to confirm the community composition and metabolic characteristics of the samples.
[0073] A modified 0.1 mm glass bead oscillation method was used to extract DNA. This method combined 0.1 mm glass bead oscillation with the Ezup column-based bacterial genomic DNA extraction kit (Sangon Biotech Co., Ltd.) to extract DNA.
[0074] The detailed instructions are as follows:
[0075] a) 0.1mm glass beads were sterilized in a muffle furnace at 300℃ in a glass beaker;
[0076] b) Place 1 ml of bacterial culture into a 2 mL screw cap tube, centrifuge at 16200 g for 10 minutes using a Thermo 17R benchtop refrigerated centrifuge, remove the supernatant, retain the bacterial cells, and add 0.5 g glass beads, 20 μl proteinase K, 180 μl buffer digestion, and 200 μl 1×TE buffer to the tube.
[0077] c) Use a rapid sample preparation instrument (FastPrep-24, MP) to rapidly oscillate at 6.5 m / s for 45 s, and repeat the operation once;
[0078] d) Place the shaken and broken sample in a benchtop refrigerated centrifuge and centrifuge at 16200g for 10 minutes;
[0079] e) Transfer 200 μl of the supernatant from the tube to a new 1.5 ml EP tube;
[0080] f) Add 200 μl of Buffer BD to a 1.5 mL EP tube, invert and mix well. A precipitate will form. Heat at 70 °C for 10 min, then remove and add 200 μl of anhydrous ethanol directly and invert and mix well. Transfer all the liquid to the adsorption column, let stand for 2 min, and centrifuge at 13800 g for 1 min in a benchtop refrigerated centrifuge. Discard the waste liquid in the collection tube.
[0081] g) Add 500 μl of PW solution to the adsorption column, centrifuge at 13800 g for 30 s in a benchtop refrigerated centrifuge, and discard the waste liquid in the collection tube.
[0082] h) Add 500 μl Wash solution to the adsorption column, place it in a benchtop refrigerated centrifuge and centrifuge at 13800g for 30s, then discard the waste liquid in the collection tube.
[0083] i) Place the adsorption column and collection tube in a benchtop refrigerated centrifuge and centrifuge at 13800g for 2 min. Then transfer the adsorption column into a new 1.5mL EP tube. Open the caps of the adsorption column and centrifuge tube and allow them to air dry at room temperature for about 10 min.
[0084] j) Add 80 μl of CE Buffer (suspended drop onto the adsorption column membrane) to the dried adsorption column, let stand for 3 min, and centrifuge at 13800 g for 2 min; transfer the liquid in the EP tube back to the adsorption column membrane, let stand for 3 min, and centrifuge at 13800 g for 2 min; discard the adsorption column.
[0085] k) The concentration of DNA was determined using Nanodrop 2000, and the DNA sample was aliquoted into two portions: one for subsequent experiments and the other flash-frozen in liquid nitrogen at -80°C for sequencing.
[0086] 2) After obtaining the metagenomic and 16S rRNA amplicon sequencing data of the sample, downstream analysis was performed. The metagenomic data underwent quality control using Trimmomatic to remove adapters, followed by fine assembly using MetaSPAdes. Finally, the target genome was obtained by binning using (a) BBMap and MetaBAT and (b) MetaWRAP workflows. The genome size, integrity, and contamination were checked using checkM, and the species classification of the target genome was determined using GTDB-tk database annotation. Finally, gene structure and function annotation of the target genome using multiple databases (e.g., KEGG, eggnog-mapper, etc.) revealed that the strain possesses complete methylcoenzyme M reductase and methyltransferase, lacks the Woody Young pathway, and is confirmed to have hydrogen-dependent methyltrophic methanogenic metabolic function (i.e., whether the sample contains hydrogen-dependent methyltrophic methanogenic archaea). Based on genomic analysis, the methanogenic substrates of the target archaea are methanol or methylamine and H2, the carbon source is acetic acid or CO2, and the growth cofactor is CoM.
[0087] Detailed information on the 16S rRNA amplicon sequencing data is as follows:
[0088] This experiment used three pairs of amplicon primers for sequencing: (a) bacteria: 341F: CCTAYGGGRBGCASCAG / 806R: GGACTACNNGGGTATCTAAT; (b) archaea: Arch519F: CAGCCGCCGCGGTAA / Arch915R: GTGCTCCCCCGCCAATTCCT; (c) universal primers for bacteria and archaea (this primer was mainly used for subsequent isolation of simple systems): 515F mod F: GTGYCAGCMGCCGCGGTAA / 806R mod R: GGACTACNVGGGTWTCTAAT). After obtaining the sequencing data, downstream analysis was performed. The Qiime 2 universal amplicon sequencing workflow was mainly used. 9 The clean / valid data is processed, including steps such as quality control and noise reduction, chimera filtering, selection of representative sequences, and species annotation, ultimately generating a feature table and taxonomy. The results are further filtered and analyzed using the generated files to obtain final data on community composition and abundance.
[0089] 2. Obtaining target archaea enrichments that can be stably passaged and grown.
[0090] 1) First, add the basic culture medium to the anaerobic bottle, and then add different substrates (substrates include 1 g / L crude oil, 1 g / L inactivated oil sludge, 1 ml / L n-docosahexane, 1 ml / L n-eicosane, 1 ml / L n-hexadecane, 1 ml / L hexadecylcyclohexane, 1 ml / L hexadecylbenzene, 20 mM butyric acid, 20 mM propionic acid, 20 mM acetic acid, 20 mM formic acid, 20 mM glucose, 0.5 g / L yeast extract, 20 mM pyruvic acid, 20 mM lactic acid, 20 mM methanol, 20 mM methanol / H2 and 28 ml H2 / 7 ml CO2), and then add oil layer water and oil sludge samples containing target hydrogen-dependent methyl-trophic methanogenic archaea, and place them in different temperatures of 25℃, 35℃, 45℃, 55℃, 65℃ and 75℃ for static culture;
[0091] The basal culture medium consisted of: 9 g / L NaCl, 3 g / L MgCl₂·6H₂O, 0.15 g / L CaCl₂·2H₂O, 0.3 g / L NH₄Cl, 0.2 g / L KH₂PO₄, 0.5 g / L KCl, 0.5 g / L cysteine hydrochloride, 1 ml / L 1% resazurin solution, and 2 g / L trace element solution. The culture medium components were added to the aqueous solution according to the specified proportions. The culture medium was boiled for 30 minutes, dispensed into anaerobic flasks with headspace replaced by 99.999% N₂, and sealed with rubber stoppers. The flasks were then autoclaved at 121°C for 30 minutes.
[0092] 2) Use gas chromatography to detect the methane production in the anaerobic bottle, and perform 10%-30% subculturing on the anaerobic bottle that produces methane.
[0093] a. Collect 1 ml of the methanogenic culture and extract DNA using the "Modified 0.1 mm Glass Bead Shaking Method" described above. Design specific primers for the target strain. Specifically, extract the 16S rRNA and methyl-CoA M subunit A gene sequences from the target archaea described in section 1.2. Use NCBI-Primer for specific primer design, expecting amplified fragments of 182 bp and 345 bp, respectively. Refer to SEQ ID NO:1 to design the upstream and downstream primer sequences for the target archaea as follows:
[0094] The upstream primer MSR4F (5'->3') for the target archaea's 16S rRNA gene is: TCTTGGTTAAACCTCAAGGCTC; the downstream primer MSR4R (5'->3') is: TCCCTGGCTTTCGTCCCTC. Referring to SEQ ID NO:2, the upstream primer for the target archaea's methyl-CoA M subunit A gene sequence is: mcrA4F (5'->3'): ATGCCGACAATAGTAGCCAT; the downstream primer mcrA4R (5'->3'): CATGTAGCTGCCGAACCAGA. PCR amplification was performed to detect the presence of the target archaea.
[0095] The PCR mixture was in 30 μl tubes, with the following components and amounts: 20 μl sterile deionized water, 3 μl 10x buffer solution, 2.4 μl ldNTP solution, 1.8 μl MgCl2 solution, 0.8 μl primer MSR4F, 0.8 μl primer MSR4R, 0.2 μl rTaq enzyme, and 1 μl target DNA solution. The PCR amplification program was 95°C for 10 minutes [(95°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 30 seconds), 35 cycles], 72°C amplification for 10 minutes, and 4°C until the sample was removed.
[0096] The qPCR process is as follows: The qPCR mixing system is a single tube of 10 μl. The components and contents of each tube are as follows: 5 μl SsoFastEvaGreen, 3.5 μl sterile deionized water, 0.25 μl primer 1 (MSR4F or mcrA4F), 0.25 μl primer 2 (MSR4R or mcrA4R), and 1 μl target DNA solution.
[0097] The detailed qPCR procedure is as follows: (a) Open the laminar flow hood, wipe the laminar flow hood surface and pipettes clean with alcohol swabs, and place the pipette tips (1ml, 200μl, 10μl), eight-tube sets and caps, eight-tube racks, 1.5ml and 2ml EP tubes and racks, and EP gloves in the laminar flow hood. Irradiate with UV light for 30 minutes. (b) Prepare serially diluted standards: (operate on ice) Take out eight 1.5ml EP tubes, add 45μl of sterile deionized water to each tube, add 5μl of 10⁹ original solution standard to the first EP tube and mix well. Then open the cap and add 5μl of liquid to the next tube. Repeat the same procedure until the standard is diluted to 10² copies. (c) Prepare the total reaction system required for the qPCR experiment in 1.5ml EP tubes, based on the 10μl qPCR mixing system per tube. (d) Dispense the system: Add 9μl of liquid to each tube. (e) Transfer the qPCR mixture into eight-tube strips, adding three replicates horizontally, and set up a negative control; (f) Add diluted standard, three replicates per group, and add 1 μl of DNA to the other eight-tube strips; add 1 μl of sterile deionized water to the negative control group; (g) After all additions are completed, tighten the cap with EP gloves, repeat the operation, and centrifuge for 20 seconds; (c) Turn on the CFX96 real-time PCR instrument, set the target program (98℃ for 2 minutes, (95℃ denaturation for 15 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 10 seconds, fluorescence acquisition) this process 45 cycles, 72℃ amplification for 10 minutes, melting curve 65℃ to 95℃), set the sample layout, and place the samples in the instrument according to the layout, start the operation, and obtain the results after completion.
[0098] b. Next, the DNA from the target archaea culture, including the addition of acetic acid, propionic acid, butyric acid, crude oil, n-docosahexane, n-eicosane, n-hexadecane, hexadecylcyclohexane, and hexadecylbenzene, and incubated at 35-65℃, is subjected to 16S rRNA amplicon sequencing. The community composition and abundance containing the target strain are then analyzed. For detailed procedures, refer to the "Detailed Information on 16S rRNA Amplicon Sequencing Data" section above. The enriched community structure of the target archaea is shown below. Figure 1a As shown in Phase 1, in addition to the target archaea, the archaeal community mainly contains Methanoculleus, Methanothermobacteria, and Ca.Methanoliparum. Based on the substrate differences between the target archaea and other archaea, substrates that the target archaea grows but other archaea do not are added to remove other archaea (see the next step of analysis).
[0099] 3. A simplified system for tracing archaeal communities to target archaea.
[0100] 1) Based on the substrates required for the target archaea in step 1 (genomic analysis) and the substrates for the growth of the target strain in step 2, add the substrates required for the target strain to ensure the growth of the target archaea:
[0101] 2) The substrate for obtaining the target archaea was determined to be a mixture of substrates including 0.5 g / L yeast extract, 0.5 g / L casein amino acids, 10 mg / L coenzyme M, 5 mM acetic acid, 5 mM lactic acid and 5 mM methanol;
[0102] 3) Serially dilute the culture containing more than 10% of the target archaea into 96-well plates 10-fold, add the mixed substrate from the previous step to each well, and incubate the culture for 10... -2 Up to 10 -4 Dilute to 16 replicate wells, 10 -5 Up to 10 -8 Dilute to 96 replicate wells and screen for conditions by setting different pH (pH 5.4, pH 6.1 and pH 6.5), temperature (35℃, 45℃ and 55℃) and adding mixed antibiotics (100 mg / L ampicillin, 100 mg / L kanamycin, 50 mg / L vancomycin and 100 mg / L gentamicin);
[0103] 4) PCR verification was performed on 96-well plates using primer pair MSR4F / MSR4R. At the same time, PCR verification was performed on wells containing the target bacteria using universal archaea primer pair 519F / 915R, followed by first-generation sequencing.
[0104] 5) Perform continuous gradient dilution and subculture on the bacterial culture containing the target wells under the same conditions as in step 3) of this step, until the sequence is detected as the target strain using universal archaea primers;
[0105] 6) Using the same substrate, pH, and temperature conditions as the target wells in the previous step, expand the bacterial culture of the target wells into the anaerobic tubes;
[0106] 7) 16S rRNA amplicon sequencing was performed on the expanded bacterial culture to confirm that its archaeal community structure contained only the target strain and another hydrogen-trophic methanogenic archaea, *Methanoculleus*. The results are shown in [see attached table]. Figure 1a Phase 2;
[0107] 8) Based on the target archaea growth conditions determined in 6), add 0.5 g / L yeast extract, 0.5 g / L casein amino acids, 10 mg / L coenzyme M, and 10 mM methanol to the basal medium. Add 20 mM 2-(N-morpholino)ethanesulfonic acid monohydrate (MES) buffer (pH 6.0). Adjust the pH to 6.0–6.5 using sterile, anaerobic 1 M HCl or NaOH solution and incubate at 55°C. Continuously pump 99.999% N2 into the culture flask to replace the H2 / CO2 in the headspace of the culture flask, and perform continuous original-flask subculturing at 0.1%–10% to inhibit *Methanoculleus*. Every 2–5 days, collect 1 ml of culture, extract DNA, and perform qPCR using specific primer pairs MSR4F / MSR4R or mcrA4F / mcrA4R to detect the growth of the target archaea. Based on the 16S rRNA gene sequence of *Methanoculleus* (SEQ ID NO:3), targeted primers for *Methanoculleus* were designed using the same method as above. The upstream primer ZC2F (5'->3') for the 16S rRNA gene sequence of *Methanoculleus* was CAAGAGCCCGGAGTTGGATT, and the downstream primer ZC2R (5'->3') was ACGGTTGAGCCGTCAGATTT. qPCR was performed on *Methanoculleus* using ZC2F / ZC2R. The annealing temperature of ZC2F / ZC2R was 60℃, and the expected amplification of the target fragment was 279 bp (the detection method is the same as the qPCR procedure described above). The culture was passed in the original vials until no *Methanoculleus* was detected, and the archaea contained only the target archaea (see...). Figure 1a Phase 3 and Figure 2 ).
[0108] 4. Remove bacteria to obtain target pure bacteria
[0109] 1) 16S rRNA amplicon sequencing clarified the bacterial community structure. The bacterial community contained four strains: Acetomicrobium, Coprothermobacter, Pseudothermotoga, and Thermosipho (see...). Figure 1b Phase 3), antibiotics (100 mg / L ampicillin, 10 mg / L chloramphenicol, 100 mg / L gentamicin, 100 mg / L kanamycin, 100 mg / L streptomycin, and 50 mg / L vancomycin, added alone or in combination) and 500 mg / L lysozyme were added simultaneously for 10 days. -2 Up to 10 -5 Diluted cultures inhibited bacterial growth, ultimately yielding a binary culture containing one bacterium, *Acetomicrobium*, and the target methanogenic archaea (see [link]). Figure 1a and Figure 1bPhase 4);
[0110] 2) Identification of antibiotics inhibiting Acetomicrobium: Acetomicrobium sp. CY-2 was obtained by anaerobic roll tube isolation using Hengate. Acetomicrobium was inhibited by adding 50, 100, 200 mg / L ampicillin, 50, 100, 200 mg / L kanapenem, 50, 100, 200 mg / L streptomycin, 50, 100, 200 mg / L vancomycin, 50, 100, 200 mg / L erythromycin, and 10, 50, 100 mg / L chloramphenicol or a combination of antibiotics. The OD600 nm of Acetomicrobium was measured every 2-4 days. The antibiotics that inhibited Acetomicrobium sp. CY-2 on days 6-8 were 100 and 200 mg / L erythromycin, 100 and 200 mg / L streptomycin, and 50, 100, and 200 mg / L vancomycin (see [link to relevant documentation]). Figure 3 );
[0111] 3) Determine antibiotic conditions that do not inhibit the target archaea: Add 200 and 500 mg / L erythromycin, 200 mg / L streptomycin, and 200 mg / L vancomycin, or a mixture of 200 mg / L erythromycin / streptomycin / vancomycin, 500 mg / L erythromycin, and 200 mg / L streptomycin / vancomycin, respectively, to the binary culture, and add one antibiotic on days 4-8. On day 4, add 500 mg / L erythromycin to the 200 mg / L erythromycin culture, and on day 8, add 1000 mg / L erythromycin to the 200 mg / L erythromycin culture. On day 8, add 500 mg / L erythromycin to the 500 mg / L erythromycin culture. 1500 mg / L erythromycin was added to 00 mg / L erythromycin culture. On day 8, 400 mg / L or 800 mg / L streptomycin was added to 200 mg / L streptomycin culture. On day 8, 400 mg / L or 800 mg / L vancomycin was added to 200 mg / L vancomycin culture. The methane production was used to detect the target archaea. The optimal concentration for inhibiting Acetomicrobium without inhibiting the target archaea was determined to be a mixture of antibiotics (500 mg / L erythromycin, 200 mg / L streptomycin, and 200 mg / L vancomycin).
[0112] 4) Continuous passage to remove Acetomicrobium: Add the mixed antibiotics from step 3) of this step, repeating the process on days 6-8. Passage through 6-7 generations using a 10-100 fold dilution gradient to inhibit Acetomicrobium. Design specific primers AM2F / AM2R based on the Acetomicrobium 16S rRNA gene sequence SEQ ID NO:4. The upstream primer AM2F (5'->3') for the Acetomicrobium 16S rRNA gene sequence is: GGAAGTGGAATTCCCGGTGT, and the downstream primer is (5'->3'): CGAAGATATGGTCCTCGCCC. The expected target fragment length is 370bp. Collect 0.5ml of culture from the end of each passage and perform qPCR detection of Acetomicrobium using AM2F / AM2R. The annealing temperature of AM2F / AM2R is 60℃. Follow the qPCR method described above until Acetomicrobium is undetectable. Stop passageing (see [link to relevant documentation]). Figure 4 PCR detection was performed on cultures where Acetomicrobium was undetectable using universal bacterial primers (27F / 1492R) and archaea primer pair (519F / 915R). No bands were observed in bacterial samples. First-generation sequencing was performed on archaea samples, yielding a single peak. The sequencing results showed 100% similarity to the target archaea's 16S rRNA gene, confirming the acquisition of a pure target strain (see results below). Figure 5 ).
[0113] Example 2: Identification of hydrogen-dependent methylotrophic methanogenic archaea
[0114] The pure target strain obtained in Example 1 was further identified and verified. The culture was detected by PCR using universal bacterial primers (27F / 1492R) and archaea primer pair (Arch519F / Arch915R). No band was observed in the bacterial detection. The archaea detection was performed by first-generation sequencing, and the result was a single peak. The sequencing results were 100% similar to the 16S rRNA gene of the target archaea of Fostera serratus, and the target strain was identified as Fostera serratus archaea, which was coded as CCAM 1872.
[0115] Using basal culture medium, add 2 ml / L of vitamin mixture sterilized by 0.22 μm filter membrane, and vitamin B. 12The solution consists of 2 ml / L vitamin B1, 10 mg / L 2-mercaptoethanesulfonic acid and 20 mM 2-(N-morpholino)ethanesulfonic acid monohydrate (MES) buffer (pH 6.0), 1% selenite-tungstate solution, 0.5 g / L yeast extract, 0.5 g / L casein amino acids, 2 mM sodium acetate, and 1 mM NaHCO3. The substrates are 10 mM of five different methyl groups (methanol, methylamine, dimethylamine, trimethylamine, and methanethiol). A 10 kPa H2 bubble is then introduced. The pH is adjusted to 6.5–7.0 using sterile, anaerobic 1 M HCl or NaOH solution, and the mixture is incubated at 55°C. Methane content is measured every 5–7 days.
[0116] CCAM 1872 can utilize hydrogen to reduce methanol and methylamine to produce methane; results are shown below. Figure 6 .
[0117] Effects of temperature and pH on methanogenesis by CCAM1872 (Example)
[0118] The culture medium used in Example 2 was employed, with the substrate consisting of 20 mM methanol and H2 bubbled through at 10 kPa. The pH was adjusted to 6.0–6.5 using sterile, anaerobic 1 M HCl or NaOH solution. The culture was incubated at 25, 35, 40, 45, 50, 60, 65, and 75°C. pH settings were 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, and 9.0, with a temperature of 55°C. Methane content was measured every 5–7 days. The fermentation temperature for CCAM 1872 was 45–65°C, with an optimal temperature of 55°C. Figure 7 (a) The fermentation pH is 5.0-7.5, with the optimum pH being 6.0-6.5. Figure 7 (b).
[0119] CCAM 1872 is a thermophilic bacterium and the highest temperature-tolerant hydrogen-dependent methyltrophic methanogenic archaea isolated to date. Most hydrogen-dependent methyltrophic methanogenic archaea are mesophilic. CCAM 1872 can withstand the high temperatures of environments such as underground oil reservoirs or hydrothermal vents for biomass energy production or biogasification of depleted crude oil.
Claims
1. A cocktail method for purifying hydrogen-dependent methyltrophic methanogenic archaea, characterized in that, Under the premise of confirming that the sample contains the target archaea and can grow, the diversity of archaeal communities and bacterial groups are reduced in stages, and then the target archaea is purified according to the growth characteristics of the target archaea to obtain the purified target archaea. Specifically, the method includes the following steps in sequence: S1 uses metagenomics and 16S rRNA amplicon sequencing technology to analyze and select whether target archaea are present in the samples for subsequent purification; it selects a variety of different combinations of culture media and culture conditions for cultivation, designs specific primers for target archaea, and determines the culture media and culture conditions for the growth of target archaea. S2 reduces the diversity of archaeal communities by selecting high-throughput nutrient-rich dilution culture, continuous gradient dilution culture in the original bottle, and controlling the growth substrate of non-target archaea. For example, by using continuous N2 displacement to remove H2 / CO2 from the air, the abundance and concentration of non-target archaea are gradually reduced until only target archaea and bacterial groups exist. S3 reduces bacterial diversity by adding different types of antibiotic combinations and lysozyme, combined with gradient dilution culture, to reduce bacterial diversity to a simple system containing only one target archaea, namely a hydrogen-dependent methyl-trophic methanogenic archaea. S4. Based on the growth cycle of bacteria and target archaea, and combined with the genomic characteristics of bacteria and archaea, and microscopic observation, determine whether bacteria and archaea are symbiotic or co-existing. First, isolate and obtain pure cultures of bacteria, assess the effect of antibiotics on bacterial growth, then assess the effect of antibiotics on target archaea, select appropriate antibiotics, and then add antibiotics at continuous intervals according to the degree of bacterial growth inhibition, and perform serial dilution subculturing until the bacterial concentration is undetectable, and finally obtain purified target archaea.
2. The cocktail method as described in claim 1, characterized in that, S1 includes the following specific steps: 1) Extract DNA from the sample and perform metagenomic and 16S rRNA amplicon sequencing to confirm the community composition and metabolic characteristics of the sample; 2) By comparing metagenomic and 16S rRNA amplicon sequencing data with the database, it was determined that the sample contained the target archaea; 3) Using metagenomic data analysis methods and various combinations of culture media and culture conditions, the target archaea were cultured to determine the substrates, nutrients, and growth cofactors available to them, as well as the culture media and culture conditions.
3. The method according to claim 1 or 2, wherein the sample is a sample that may contain hydrogen-dependent methyltrophic methanogenic archaea, such as oilfield reservoir water, oil sludge, hot springs, marine sediments, coal seam water, soil, etc.
4. The cocktail method as described in claim 1 or 2, characterized in that, The method for determining the culture medium and culture conditions described in S1 is as follows: 1) Place the sample in an anaerobic bottle, continuously introduce N2 into the anaerobic bottle to form an anaerobic environment, add the basic culture medium, then add the substrate, seal the bottle with a rubber stopper and an aluminum seal, and incubate at a certain temperature. The substrate is at least a substrate required for metagenomic analysis, including methanol and methanol / H2, or further includes one or more of the following substances: crude oil, inactivated oil sludge, n-docosahexane, n-eicosane, n-hexadecane, hexadecylcyclohexane, hexadecylbenzene, butyric acid, propionic acid, acetic acid, formic acid, glucose, yeast extract, pyruvic acid, lactic acid, and H2 / CO2. The temperature is set in the range of 20-80℃, and specifically designed according to gradients of 25℃, 35℃, 45℃, 55℃, 65℃ and 75℃ for cultivation; 2) After detecting and confirming the methane production in the anaerobic bottle, subculture was carried out; Furthermore, the subculture method is as follows: a. Collect methanogenic cultures, extract total DNA from the cultures in anaerobic bottles, and continuously monitor the growth of the target archaea using PCR with target archaea-specific primers. At the same time, use qPCR to periodically detect the growth status of the target archaea. Furthermore, the specific primer pairs are primers specifically designed using the 16S rRNA gene sequence of the target archaea and primers specifically designed using the methyl coenzyme M reductase α subunit nucleic acid sequence; b. Further select cultures in which the target archaea grow, extract total DNA for 16S rRNA amplicon sequencing, determine the community composition and abundance containing the target archaea, and provide a reference for subsequent targeted removal of other strains.
5. The cocktail method according to any one of claims 1-4, characterized in that, The specific operation of S2 is as follows: 1) Based on S1 metagenomic analysis and the substrates for the growth of the target archaea, the substrates were further identified as mixed substrates, preferably including yeast extract, casein amino acids, coenzyme M, rumen fluid, acetic acid, lactic acid, and methanol; 2) Select a culture containing more than 10% of the target archaea, serially dilute it 10-fold to a 96-well plate, add the nutrient-rich medium containing the mixed substrate to each well, and incubate the culture for 10... -2 Up to 10 -4 Dilute to 16 replicate wells, 10 -5 Up to 10 -8 Dilute to 96 replicate wells, set different pH and temperature, add mixed antibiotics for incubation and screening; Furthermore, the different pH values are preferably pH 5.4, pH 6.1, and pH 6.5; Furthermore, the different temperatures are preferably 35°C, 45°C, and 55°C; Furthermore, the mixed antibiotics are preferably 100 mg / L ampicillin, 100 mg / L kanamycin, 50 mg / L vancomycin, and 100 mg / L gentamicin; 3) The 96-well plate cultures were validated by PCR and subjected to first-generation sequencing. The primer pairs used for validation were primers specifically designed using the 16S rRNA gene sequence of the target archaea, and the primer pairs used for first-generation sequencing were universal primers for archaea. 4) Using a continuous gradient dilution and passage method, repeat steps 2) and 3) in step S2, and finally confirm the target archaea with the first-generation sequencing results; 5) The culture medium containing the target archaea obtained in step 4) is expanded in anaerobic tubes; furthermore, the expansion culture conditions are the same as those for the target archaea substrate, pH, and temperature. 6) Perform 16S rRNA amplicon sequencing on the expanded cultured bacterial solution to clarify the archaeal community structure until the archaeal community contains only one target archaea and no more than two non-target archaea. The non-target archaea are hydrogen-nutritive methanogenic archaea. 7) Using N2 for continuous headspace replacement of H2 / CO2 in the gas and continuous 0.1-10% dilution of the original bottle for passage, hydrogen-nutritive methanogenic archaea are removed to obtain a simple system containing single-target methanogenic archaea and bacteria.
6. The cocktail method according to any one of claims 1-5, characterized in that, The specific operation of S3 is as follows: After obtaining the simple system of a single-target methanogenic archaea and bacteria in step S2, antibiotics and lysozyme are added, and continuous gradient dilution culture is carried out to obtain a binary culture containing a single-target methanogenic archaea and a bacterium. Furthermore, the antibiotic is one or a combination of several of the following: 100 mg / L ampicillin, 100 mg / L kanamycin, 50 mg / L vancomycin, and 100 mg / L gentamicin; the lysozyme concentration is 500 mg / L. Furthermore, the specific operation of S4 is as follows: Based on the characteristics of bacterial and archaea genomes, and considering the inconsistency in the growth cycles of bacteria and target archaea, and the fact that bacteria and archaea do not aggregate under a microscope, it is determined that the bacteria are not symbiotic with the archaea. The antibiotic gradient concentration screening method includes: a) using standard bacterial strains isolated from binary cultures to screen for antibiotics that inhibit the bacteria in the binary cultures but do not inhibit the target archaea; b) adding the screened antibiotics to the binary cultures, and adding antibiotics in a cumulative manner after 6-8 days of culture to prevent antibiotics from becoming ineffective at high temperatures; c) adding antibiotics at 0.1%-10% through continuous dilution and subculturing to remove bacteria. Furthermore, the antibiotic is a mixture of 500 mg / L erythromycin, 200 mg / L streptomycin, and 200 mg / L vancomycin.
7. A hydrogen-dependent methyltrophic methanogenic archaea, characterized in that, It belongs to the phylum Fosterella, which is not a broad archaea, and its Latin name is... Methanosuratincolapetrocarbonis, Its accession number is CGMCC No.46065.
8. The application of the hydrogen-dependent methyl-trophic methanogenic archaea as described in claim 7, used for the production and preparation of energy material methane gas and / or the biogasification of residual crude oil in depleted oil reservoirs; the strain can also serve as a potential engineered strain for synthetic biology research.
9. A method for preparing methane, characterized in that... Methane is synthesized from methanol and methylamine by fermentation of the hydrogen-dependent methylotrophic methanogenic archaea as described in claim 7, using hydrogen gas.
10. The method as described in claim 9, characterized in that... The strain is a thermophilic and slightly acidophilic strain, the fermentation temperature is 45-65℃, preferably 55℃, and the fermentation pH is 5.0-7.5, preferably 6.0-6.5.