Application of synovial fluid-derived exosome miRNA marker in osteoarthritis diagnosis

By detecting the expression of miR-3196 in exosomes derived from synovial fluid, and utilizing high-throughput sequencing and nucleic acid hybridization technologies, the problem of early diagnosis of osteoarthritis has been solved, enabling the critical opportunity for early identification and treatment of osteoarthritis.

CN121450784APending Publication Date: 2026-02-03AFFILIATED HOSPITAL OF NANTONG UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511826852.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-05
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Current technologies rely on imaging examinations for early diagnosis of osteoarthritis, which cannot effectively diagnose the disease in its early stages, leading to its progression to later stages.

Method used

The expression level of miR-3196 in exosomes derived from synovial fluid was detected using high-throughput sequencing and nucleic acid hybridization techniques. miR-3196 was then identified and amplified using specific probes or primers to achieve early diagnosis of osteoarthritis.

Benefits of technology

It improves the early diagnostic efficacy of osteoarthritis by detecting the significant differential expression of the exosomal miRNA marker miR-3196 in synovial fluid, thus enabling the critical timing for early identification and treatment of osteoarthritis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121450784A_ABST
    Figure CN121450784A_ABST
Patent Text Reader

Abstract

The invention discloses application of a synovial fluid source exosome miRNA marker in an osteoarthritis diagnosis product, and belongs to the field of biological medicine detection. The synovial fluid source exosome miRNA marker is miR-3196, and the reagents comprise reagents for detecting the expression level of the synovial fluid source exosome miRNA marker miR-3196 by a sequencing technology, a nucleic acid hybridization technology and a nucleic acid amplification technology. Experimental verification finds that miR-3196 is remarkably low in expression in a synovial fluid exosome of an OA patient, after the miR-3196 low in expression in the exosome is taken by cartilage cells, related signal channels are activated and degradation of the cartilage cells is promoted by regulating MAPK15 in the cartilage cells in a targeted mode, and the miR-3196 can be applied to early clinical diagnosis of osteoarthritis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical testing and relates to the application of synovial fluid-derived exosomal miRNA biomarkers in osteoarthritis diagnostic products. Background Technology

[0002] Osteoarthritis (OA) is a chronic disease characterized by degenerative changes in articular cartilage, ossification of the cartilage, and secondary bone hyperplasia. Osteoarthritis most commonly affects the knee joint, leading to severe joint deformities, impaired joint function, and in severe cases, disability, significantly impacting the quality of life of middle-aged and elderly individuals. Early diagnosis is crucial for disease prevention and management. Currently, the diagnosis of osteoarthritis still relies on imaging examinations; however, by the time changes are observed on imaging, osteoarthritis is already in an advanced stage.

[0003] Studies have shown that synovial lesions may be one of the important pathological changes in the early stages of osteoarthritis (OA). Synovial fluid, a viscous substance secreted by the inner synovial cells into the joint cavity, can be obtained through minimally invasive surgery and is an ideal means of diagnosing osteoarthritis. Exosomes are small vesicles, approximately 40-100 nanometers in diameter, secreted by living cells and present in various body fluids, enclosed by a bilateral lipid membrane. It has been reported that almost all living cells (including synovial cells) can secrete exosomes, and their presence has also been detected in synovial fluid. Exosomes contain specific proteins, precursors, lipids, and various RNAs, secreted by cells into the extracellular space, participating in intercellular communication. Therefore, microRNAs (miRNAs) in exosomes derived from synovial fluid have extremely high potential as biomarkers for the early diagnosis of osteoarthritis. Because exosomes have a lipid bilayer structure, they can effectively protect their contained miRNAs from the effects of RNases, maintaining extremely high stability. Increasingly, studies suggest that exosomal miRNAs are ideal disease biomarkers.

[0004] Therefore, finding highly specific and sensitive exosomal miRNA markers derived from synovial fluid is crucial for the early clinical diagnosis of osteoarthritis. Summary of the Invention

[0005] The purpose of this invention is to at least partially solve the above-mentioned technical problems and provide an application of synovial fluid-derived exosomal miRNA markers in the diagnosis of osteoarthritis.

[0006] In a first aspect, the present invention provides the application of a reagent for detecting the expression level of the synovial fluid-derived exosomal miRNA marker miR-3196 in the preparation of products for diagnosing osteoarthritis.

[0007] The sequence of miR-3196, a synovial fluid-derived exosomal miRNA marker disclosed in this invention, can be found in the miRBase database (http: / / microrna.sanger.ac.uk / ). The sequence of miR-3196 is shown in SEQ ID NO:1.

[0008] The sequence of miR-3196 is: CGGGGCGGCAGGGGCCUC (SEQ ID NO:1) Furthermore, the osteoarthritis described herein is a degenerative change or ossification of articular cartilage.

[0009] Furthermore, the reagents include those for detecting the expression level of the synovial fluid-derived exosomal miRNA marker miR-3196 using sequencing technology, nucleic acid hybridization technology, and nucleic acid amplification technology.

[0010] Furthermore, the reagents are selected from: A probe that specifically identifies the synovial fluid-derived exosomal miRNA marker miR-3196; or Primers for specifically amplifying the synovial fluid-derived exosomal miRNA marker miR-3196.

[0011] Furthermore, the sequences of the primers for specifically amplifying the synovial fluid-derived exosomal miRNA marker miR-3196 are shown in SEQ ID NO:2-SEQ ID NO:3, respectively.

[0012] The sequencing technology described in this invention refers to high-throughput sequencing technology, also known as next-generation sequencing technology. This represents a revolutionary change from traditional sequencing technologies, capable of sequencing hundreds of thousands to millions of DNA molecules simultaneously, significantly improving sequencing efficiency. This type of large-scale sequencing technology greatly enhances the speed of interpreting genetic information from multiple species, ensuring the acquisition of sequence information for all miRNAs and the deciphering of miRNA maps. Simultaneously, high-throughput sequencing makes it possible to perform detailed and comprehensive analysis of the transcriptome and genome of a species, hence it is also called deep sequencing. Representative high-throughput sequencing platforms include Roche's 454 sequencer (Roch GSFLX sequencer), Illumina's Solexa Genome Analyzer, and ABI's SOLiD sequencer.

[0013] The nucleic acid hybridization technology described in this invention includes probe hybridization technology and gene chip technology. Probe hybridization technology refers to hybridizing labeled probes with miRNA samples, followed by signal detection to determine the expression level of the miRNA. The probe hybridization methods include Northern blotting, miRNA expression profiling chips, ribozyme protection analysis, RAKE assay, in situ hybridization, and microsphere-based flow cytometry. Gene chip technology refers to a method that uses microarray technology to attach high-density DNA fragments to solid surfaces such as membranes or glass slides in a specific order or arrangement using high-speed robotics or in situ synthesis. DNA probes labeled with isotopes or fluorescence are used, and the principle of base complementarity hybridization is employed to conduct large-scale gene expression and monitoring studies. Its sequencing principle is hybridization sequencing, which involves hybridizing with a set of nucleic acid probes with known sequences to determine the nucleic acid sequence. Probes with known target nucleotide sequences are immobilized on a substrate surface. When a fluorescently labeled nucleic acid sequence in solution exhibits complementary matching with a corresponding nucleic acid probe on the gene chip, the position of the probe with the strongest fluorescence intensity is determined to obtain a set of completely complementary probe sequences. Based on this, the sequence of the target nucleic acid can be reconstructed.

[0014] Compared with existing technologies, this invention is the first to discover that the synovial fluid-derived exosomal miRNA marker miR-3196 has high diagnostic efficacy for the early clinical diagnosis of osteoarthritis, showing significant differential expression in osteoarthritis patients, and can be applied to the diagnosis of osteoarthritis. Attached Figure Description

[0015] These and / or other aspects and advantages of the present invention will become apparent and readily understood from the following description of preferred embodiments taken in conjunction with the accompanying drawings, in which: Figure 1 Heatmap and cluster analysis results of significantly differentially expressed miRNAs in exosomes derived from synovial fluid of OA patients; Figure 2 Volcano map of differentially expressed genes in cartilage tissue; Figure 3 Figure showing the results of GO / KEGG enrichment analysis of upregulated differentially expressed genes; Figure 4 Figure showing the results of GO / KEGG enrichment analysis for downregulated differentially expressed genes; Figure 5 The study showed the number of significantly differentially expressed miRNAs and their potential target molecules in exosomes derived from synovial fluid in OA patients. Figure 6The results of characterization of exosomes in synovial fluid are shown; Figure A shows a typical TEM image of exosomes in the synovial fluid of OA patients; Figure B shows the size and distribution of exosomes in the synovial fluid of OA patients and control groups under nanoparticle tracking analysis; Figure C shows the detection of exosome markers by Western blotting. Figure 7 The results show the expression and binding ability verification of miR-3196 and its target molecule MAPK15. Detailed Implementation

[0016] The technical solution of the present invention will be further described in detail below through embodiments and in conjunction with the accompanying drawings. In this specification, the same or similar reference numerals indicate the same or similar components. The following description of the embodiments of the present invention with reference to the accompanying drawings is intended to explain the overall inventive concept of the present invention and should not be construed as a limitation thereof.

[0017] It should be noted that the terms used in this application are generally those commonly used by those skilled in the art. If there is any inconsistency with commonly used terms, the terms used in this application shall prevail.

[0018] Research data and equipment 1. Synovial fluid / articular cartilage specimens from OA patients and control groups Synovial fluid samples from all OA patients and the control group were obtained from Nantong Haimen District People's Hospital. Synovial fluid was obtained from the knee joint of non-OA patients (cruciate ligament injury, meniscus injury, synovial plica syndrome) and OA patients during knee replacement surgery. The extracted synovial fluid was immediately sent to the laboratory and exosome extraction was completed within 24 hours.

[0019] Articular cartilage samples from OA patients were obtained from joint replacement surgeries performed on OA patients whose joints met the definition of OA post-surgery. Normal articular cartilage samples were obtained from normal joints of patients who underwent lower limb amputations at Haimen District People's Hospital. Specimens were stored at -80°C.

[0020] The sample collection was approved by the Ethics Review Board (IRB) of Nantong Haimen District People's Hospital before the procedure, and the patient signed an informed consent form before the procedure. The patient did not receive any special treatment before the procedure.

[0021] Selection criteria for OA patients: (1) Recurrent knee pain within the past month; (2) X-ray showed joint space narrowing, subchondral bone sclerosis, cystic changes, and osteophyte formation; selection criteria for the non-OA patient control group: (1) No morning stiffness in the joints, and no crepitus (bone crepitus sensation) during joint movement; (2) The X-ray showed no obvious abnormal changes such as joint space narrowing or osteophyte formation.

[0022] 2. Cell line 293T source The cell line used in this experiment was 293T, purchased from Hunan Fenghui Biotechnology Co., Ltd. It was routinely cultured and regularly tested for mycoplasma to ensure that the cell line was not contaminated with mycoplasma.

[0023] 3. Main Instruments Steam sterilizer (TOMY Corporation, Japan); Vertical flow double-opening standard laminar flow workbench Bench; CO2 incubator (Thermo Fisher Scientific); inverted fluorescence microscope and digital imaging system (Leica GmbH, Germany); 10 μL, 20 μL, and 1000 μL pipettes (Eppendoff, USA); low-temperature ultracentrifuge (Beckman, USA); electrically heated water bath; laboratory ultrapure water system. Millipore; -80°C ultra-low temperature freezer (Thermo Fisher Scientific); Western blot electrophoresis gel apparatus (Bio-Rad Laboratories, USA); sterile cell culture flasks (Coring, USA); sterile cell culture plates of different sizes (6-well, 24-well, 96-well) (Corning); Illumina HiSeq instrument (Illumina, USA); transmission electron microscope (Leica); real-time PCR instrument (Eppendoff).

[0024] 4. Main reagents RPMI-1640 cell culture medium (Biological Industries, Israel); premium fetal bovine serum (Biological Industries, Israel); rabbit anti-human ALIX monoclonal antibody (ab27537, Abcam); rabbit anti-human CD9 monoclonal antibody (ab236630, Abcam); rabbit anti-human MAPK15 polyclonal antibody (Santa Cruz Biotechnology, CA, USA); HRP-labeled mouse anti-human ACTB monoclonal antibody (HRP-60008, Wuhan Sanying Company); exosome miRNA extraction kit (Ambio××n); mir-3196 minic; has-miR-3196 and U6 primers; TagMan MicroRNA Reverse Transcription Kit; Anhydrous ethanol (analytical grade); 75% ethanol; Trypsin cell digestion solution; 1×PBS solution (Thermo Fisher Scientific, 0.01M pH 7.2-7.4); Liquid nitrogen; 10% formalin; Earle's balanced salt solution (Shanghai Sangon Biotech Co., Ltd.); Protein quantification kit (Thermo Fisher Scientific); Isopropanol.

[0025] Example 1: Screening for differentially expressed genes in exosomes derived from OA synovial fluid 1. Data Sources and Processing We searched for public gene expression data and complete clinical annotations in the Gene Expression Omnibus (GEO) database and downloaded the gene expression dataset GSE126677 of OA synovial fluid-derived exosomes from the GEO database (http: / / www.ncbi.nlm.nih.gov / geo / ).

[0026] GSE126677 Information: GPL16791 Illumina HiSeq 2500 high-throughput sequencing platform, containing miRNA expression array data of exosomes derived from synovial fluid in 3 normal elderly individuals (70-80 years old) and 2 OA patients.

[0027] 2. Differential Expression Analysis Statistical differential analysis of the miRNA-seq expression matrix in GSE126677 was performed using DESeq software, and 11 differentially expressed miRNAs were screened out with a p-value less than 0.01.

[0028] 3. Experimental Results Due to the species-specific nature of miRNAs, non-human miRNAs were initially excluded, resulting in 5 differentially expressed miRNAs. Three of these miRNAs were highly expressed in the OA group, and two were expressed at low levels. The results are as follows: Figure 1 As shown in Table 1, the results indicate that the expression of miR-3196, which is involved in this invention, is significantly downregulated in the synovial fluid samples of OA patients.

[0029] Table 1. Values ​​of differentially expressed miRNAs in the GSE126677 chip Example 2: Differential gene analysis of articular cartilage tissue in OA patients 1. Data Sources and Processing After exosomes derived from synovial fluid are taken up by articular chondrocytes, the miRNAs within them target and regulate the mRNA of chondrocytes, leading to chondrocyte degeneration and cartilage deterioration. To further investigate how exosomes derived from synovial fluid mediate chondrocyte degeneration, we then searched and downloaded the GSE114007 dataset from the GEO database. The GSE114007 dataset contains mRNA-seq data from articular cartilage tissues of 8 healthy individuals and 10 patients with osteoarthritis (OA).

[0030] 2. Differential gene expression analysis Statistical differential analysis of the mRNA-seq expression matrix in GSE114007 was performed using DESeq software. Differentially expressed genes were screened based on padj values ​​less than 0.1 and fold changes greater than 2, resulting in a volcano plot of differentially expressed genes in cartilage tissue. Figure 2 As shown in the figure. The results showed that there were 1734 differentially expressed genes, of which 1010 genes were upregulated in the cartilage tissue of OA patients and 733 genes were downregulated.

[0031] 3. GO / KEGG enrichment analysis of upregulated genes in cartilage tissue of OA patients GO and KEGG enrichment analyses were performed on upregulated genes using the WebGestalt website. Figure 3 GO results showed that the upregulated genes were significantly enriched in biological processes such as extracellular structural tissues, biomineral tissue development, and ossification. Figure 3 A; KEGG results showed that the upregulated genes were significantly enriched in pathways such as protein digestion and absorption, ECM, cell adhesion, cell cycle, ferroptosis, and osteoclast differentiation. Figure 3 B.

[0032] 4. GO / KEGG enrichment analysis of downregulated genes in cartilage tissue of OA patients GO / KEGG enrichment analysis was performed on downregulated genes using the WebGestalt website to obtain... Figure 4 GO results for downregulated genes showed that these genes were significantly enriched in biological processes such as DNA transcription, adipocyte differentiation, cellular carbohydrate metabolism, oxygen-stimulated response, and endothelial cell differentiation. (See attached image.) Figure 4 A; KEGG results showed that the downregulated genes were significantly enriched in the circadian rhythm, HIF-1, PI3K-AKT, and TNF pathways. Figure 4 B.

[0033] 5. Target molecule screening for differentially expressed miRNAs in exosomes To investigate the specific molecules regulated by abnormally expressed miRNAs in synovial fluid-derived exosomes during cartilage destruction in osteoarthritis (OA) patients, we performed an intersection analysis of target molecules of differentially expressed miRNAs in exosomes with differentially expressed genes in articular cartilage tissue from OA patients. After aggregation, target molecules were screened to obtain a more reasonable number. The results are shown in bar chart format. Figure 5 The specific miRNAs and their target molecules are shown in Table 2.

[0034] Table 2. Differentially expressed miRNAs and target molecules in exosomes Example 3: Validation of low expression of miR-3196 and its target molecule MAPK15 in exosomes 1. Extraction of synovial exosomes (1) Exosomes were extracted from synovial fluid using standard gradient centrifugation.

[0035] (2) First, joint aspiration is performed on non-OA patients (cruciate ligament injury, meniscus injury, synovial fold syndrome, etc.) and synovial fluid is obtained from the knee joint in OA patients during knee replacement surgery.

[0036] (3) The extracted synovial fluid was immediately placed in an ice box and sent to the laboratory, and the exosome extraction was completed within 24 hours.

[0037] (4) The detailed steps for exosome extraction are as follows: Take 1 ml of synovial fluid, centrifuge at 3000 RPM for 20 minutes, collect the supernatant, and centrifuge again at 10000 RPM for 60 minutes, collecting the supernatant. Centrifuge again at 100000 RPM for 60 minutes, resuspend the precipitate in phosphate-buffered saline (PBS) and wash twice, repeat the centrifugation at 100000 RPM for 1 hour, and collect the precipitate, which is the exosome. Resuspend the extracted exosomes in 20 μL of PBS, aliquot and store at -80°C.

[0038] 2. Identification of exosomes derived from synovial fluid using transmission electron microscopy. (1) Exosome fixation: Take an appropriate amount of exosomes extracted in the above steps, fix them in EP tubes with 2.5% glutaraldehyde at 37°C for 2 hours, wash the precipitate with PBS, centrifuge at 100000 RPM for 1 hour, collect the precipitate, wash with PBS and centrifuge again.

[0039] (2) Slide preparation: The fixed exosomes were resuspended in 20 μL of clean PBS and carefully attached to a small copper slide for transmission electron microscopy development. The slides were then dried at room temperature.

[0040] (3) Negative staining of exosomes: 3% phosphotungstic acid was dropped onto a small copper plate and dried at room temperature.

[0041] (4) Imaging: Carefully place the negatively stained copper plate into the transmission electron microscope imaging system, adjust the magnification and field of view, locate typical exosomes, and observe the morphology of the extracted exosomes using a transmission electron microscope (TEM). The results are as follows: Figure 6 As shown, the results indicate that exosomes derived from synovial fluid exhibit typical exosome characteristics: they are enclosed by a lipid bilayer membrane and have a cup-shaped three-dimensional structure. Figure 6 A). Nano-sight measurement of exosome size showed that the diameter of exosomes derived from synovial fluid in OA patients was 106.9 nm, while that in the normal control group was 96.6 nm. Figure 6 B). Western blot analysis showed that specific exosome markers (CD9 and ALIX) were highly enriched in both groups of synovial fluid-derived exosomes. Figure 6 C).

[0042] 3. Extraction of exosomal miRNAs (1) After isolating exosomes, strictly follow the operating steps in the instructions of the exosome miRNA extraction kit (Ambion) to extract miRNAs from exosomes.

[0043] (2) Extraction of total RNA: First, take 100ul of resuspresion buffer to resuspend exosomes and place at room temperature for 10 minutes. Then, add 100ul of Denaturing Solution and place at 4℃ for 5 minutes. Next, add 200ul of Acid-Phnol and vortex for half a minute. Centrifuge at 12000g for 10 minutes, discard the precipitate and take the supernatant.

[0044] (3) Extraction of miRNAs: Add 133 μL of anhydrous ethanol to the supernatant and filter. Add another 355 μL of anhydrous ethanol to the filtrate and filter again. Discard the filtrate and keep the filter. Next, add 700 μL of miRNA wash solution 1 and 500 μL of wash solutions 2 and 3 in sequence, and discard the filtrates. Finally, use 15 μL of Elution Solution to elute the miRNAs. Dilute the extracted miRNA solution to an appropriate concentration and measure its concentration using a spectrophotometer.

[0045] 4. qRT-PCR of exosomal miRNAs (1) Perform miRNA reverse transcription strictly in accordance with the instructions of the TagMan MicroRNA Reverse Transcription kit.

[0046] (2) Preparation of reverse transcription amplification system: 10×RT Buffer 1.5ul + RNase Inhibitor 0.19ul + 100mM dNTPs 0.15ul + 5×RT primer 3ul + MultiScribe Reverse Transcriptase 1ul + RNase-free water 4.16ul + Template RNA 5ul.

[0047] (3) The cDNA was obtained by reverse transcription according to the following reverse transcription program: 16°C for 30 minutes; 42°C for 30 minutes; 85°C for 5 minutes.

[0048] (4) qRT-PCR detection of miR-3196: The expression of miR-3196 was detected using the Taqman Universal Master Mix kit, with U6 as an internal control.

[0049] (5) miR-3196 primer sequence: miR-3196: The forward primer is 5'-- CGCGCGGGGCGGCAGG --3' (SEQ ID NO:2); The reverse primer is 5'-- AGTGCAGGGTCCGAGGTATT --3' (SEQ ID NO:3); U6 internal reference primer: The forward primer is 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO:4); The reverse primer is 5'-AACGCTTCACGAATTTGCGT-3' (SEQ ID NO:5); 5. Western blot analysis (WB) (1) Extraction of tissue protein: a. Cut the obtained cartilage tissue into small pieces.

[0050] b. Grind each group of cartilage tissue in liquid nitrogen, and add protein lysis buffer to fully lyse the proteins. Centrifuge at 10,000 RPM for 15-25 minutes at 4°C, and collect the supernatant.

[0051] (2) Extraction of cell proteins: a. Discard the culture medium and wash several times with PBS.

[0052] b. After adding protein lysis buffer, scrape off cells with a spatula. Centrifuge at 10,000 RPM for 15-25 minutes at 4°C and collect the supernatant.

[0053] (3) Protein concentration determination of each group of samples: After determining the protein concentration using the BCA protein quantification kit, seal the EP tube and place it in a water bath at 100°C for 6-10 minutes. Then, aliquot the protein and store it in a low-temperature freezer (store at -20°C for no more than two weeks or at -80°C for no more than 6 months).

[0054] (4) SDS-PAGE electrophoresis: a. Gel Preparation: Select a gel preparation plate with an appropriate number of lanes. Carefully inspect the plate for stains, ensuring it is clean and free of watermarks. After installing the plate, press it with water to check for leaks. Pour the prepared separating gel into the plate, adding isopropanol on top to ensure a smooth, bubble-free surface. Let it stand at room temperature for 30 minutes until the separating gel is completely solidified. Pour off the isopropanol from the surface and rinse repeatedly with ddH2O until clean. Prepare a stacking gel of the appropriate concentration, insert a comb, and let it stand at room temperature for 30 minutes until the stacking gel is completely solidified.

[0055] b. Electrophoresis: Prepare fresh electrophoresis buffer. Place the prepared gel plate in the electrophoresis tank and pour in an appropriate amount of buffer. Remove the comb and carefully load the prepared proteins into each lane sequentially. Calculate the concentration and loading volume before loading to ensure the amount of protein loaded into each lane is consistent. Install the electrophoresis chamber and run the sample at 80V until it reaches the junction of the separating and stacking gels. Then, switch to 120V.

[0056] c. Transfer: Prepare the PVDF membrane, activate it in methanol, and fully hydrate it in distilled water. Carefully remove the adhesive from the gel plate and place it in the transfer solution. Stack the cotton pad, filter paper, adhesive, and PVDF membrane as required, and clamp them tightly in the transfer clamp, ensuring no air or air bubbles enter between each layer. Install the transfer apparatus, add fresh transfer solution, and set the appropriate transfer conditions to begin the transfer. During the transfer process, try to keep the transfer apparatus at 4°C.

[0057] d. After the transfer is complete, the PVDF membrane is sealed at room temperature for 1 hour as usual.

[0058] e. Incubation of primary antibody: MAPK15 (Santa Cruz Biotechnology, CA, USA) overnight at 4 °C.

[0059] f. Incubation with secondary antibody: Wash the membrane thoroughly with TBST and incubate with secondary antibody at room temperature for 2 hours.

[0060] g. Development: TBST is used for thorough washing again. Manual X-ray film development is performed. After imaging, grayscale values ​​are analyzed using ImageJ, and p-values ​​between groups are calculated using SPSS.

[0061] 5. Cell Culture The revived 293T cell line was routinely cultured in RPMI 1640 (BI Biotechnology Co., Ltd.) containing 10% fetal bovine serum. When the cell density reached 90%, it was routinely digested and passaged. 293T cells in logarithmic growth phase were used in the experiment, and the number of passages was ensured not to exceed 8.

[0062] 6. Luciferase Reporting The binding affinity of miR-3196 to MAPK15 was detected using a luciferase reporter assay. First, the 3'-UTR region of wild-type MAPK15 was amplified by PCR and inserted into the pGL3-control vector to generate a wild-type (WT) plasmid of MAPK15. Site-directed mutagenesis was then performed on the wild-type MAPK15 plasmid to generate a 3'-UTR mutant fragment of MAPK15 containing a mutant sequence at the complementary site of miR-3196. The plasmids were transfected, and fluorescence intensity was detected using a dual-luciferase system.

[0063] First, qRT-PCR was used to verify the differential expression of miR-3196 in exosomes derived from synovial fluid from 8 OA patients and 5 healthy volunteers. The results are as follows: Figure 7 Figure A shows the expression of mir-3196 in synovial fluid-derived exosomes from OA patients (8 cases) and normal volunteers (5 cases) as detected by qRT-PCR; ****, P<0.0001. The left side of Figure B shows the expression of MAPK15 in articular cartilage from OA patients and normal volunteers as detected by Western blotting; the right side of Figure B shows the statistical graph of three independent replicate experiments, ****, P<0.0001. Figure C shows the direct binding of mir-3196 to MAPK15 as detected by luciferase reporter assay, **, P<0.001. The left side of Figure D shows the expression of MAPK15 after overexpression of mir-3196 in 293T cells as detected by Western blotting; the right side of Figure D shows the statistical graph of three independent replicate experiments, ***, P<0.001. The results show that the expression of mir-3196 in synovial fluid-derived exosomes from OA patients was significantly lower than that in normal volunteers (Figure 7A). Next, Western blotting was used to detect the expression of MAPK15 in the articular cartilage of two OA patients and two healthy volunteers. Consistent with the microarray results, MAPK15 expression was higher in the articular cartilage of OA patients (Figure 7B). Finally, luciferase reporter assay and Western blotting verified the direct binding of mir-3196 to MAPK15 (Figures 7C-D).

[0064] Figure 7 The figure shows the results of the expression and binding ability verification of miR-3196 and its target molecule MAPK15.

[0065] Figure 7 Figure A shows the expression of miR-3196 in synovial fluid-derived exosomes from OA patients (8 cases) and healthy volunteers (5 cases) detected by qRT-PCR; ****, P<0.0001. The results indicate that the expression of miR-3196 in synovial fluid-derived exosomes from OA patients was significantly lower than that in healthy volunteers.

[0066] Figure 7 The left side of Figure B shows the Western blot analysis of MAPK15 expression in the articular cartilage of OA patients and healthy volunteers; the right side of Figure B shows the statistical plot of three independent replicate experiments, ****, P<0.0001. The results are consistent with the microarray results, showing that MAPK15 is highly expressed in the articular cartilage of OA patients.

[0067] Figure 7 Figure C in the figure illustrates the detection of the direct binding of miR-3196 to MAPK15 in the luciferase reporter assay, **, P<0.001. The results show that, compared with the mutant (Mut) group, miR-3196 can directly recognize and bind to the 3′UTR of wild-type (WT) MAPK15, inhibiting the expression of downstream reporter genes (decreased luciferase activity).

[0068] Figure 7 The left side of Figure D shows the Western blot analysis of MAPK15 expression in 293T cells after overexpression of miR-3196; the right side of Figure D shows the statistical plot of three independent replicates, ***, P<0.001. The results show that overexpression of miR-3196 significantly downregulated MAPK15 protein levels.

[0069] Figure 7 Figures C and D in the diagram show the direct binding of miR-3196 to MAPK15 and its inhibition of MAPK15 protein expression levels.

[0070] While some embodiments of the present general inventive concept have been shown and described, those skilled in the art will understand that changes may be made to these embodiments without departing from the principles and spirit of the present general inventive concept, the scope of which is defined by the claims and their equivalents.

Claims

1. Application of reagents for detecting the expression level of miR-3196, a miRNA marker derived from synovial fluid, in the preparation of products for diagnosing osteoarthritis.

2. The application according to claim 1, characterized in that, The reagents include those used in sequencing, nucleic acid hybridization, and nucleic acid amplification techniques to detect the expression level of miR-3196, a miRNA marker derived from synovial fluid exosomal tissue.

3. The application according to claim 2, characterized in that, The reagents are selected from: A probe that specifically identifies the synovial fluid-derived exosomal miRNA marker miR-3196; or Primers for specifically amplifying the synovial fluid-derived exosomal miRNA marker miR-3196.

4. The application according to claim 3, characterized in that, The sequences of the primers for specifically amplifying the synovial fluid-derived exosomal miRNA marker miR-3196 are shown in SEQ ID NO:2-SEQ ID NO:3, respectively.

Citation Information

Patent Citations

  • Application of miR-4443 and target gene thereof in diagnosis and treatment of chondroblastic osteosarcoma

    CN105950716A

  • Application of marker in preparation of diagnostic kit or therapeutic drug for rheumatoid arthritis

    CN112779327A

  • Immunoregulatory imide drugs as ZETA chain associated protein kinase 70 (ZAP70) agonists and uses thereof

    CN114502176A

  • Non-Invasive Classification of Benign and Malignant Melanocytic Lesions Using MicroRNA Profiling

    US20220359037A1