tsrna detection primer compositions, kits, methods, and applications

Abstract

The present application relates to the field of biotechnology and molecular diagnosis, and discloses a tsRNA detection primer composition, a kit, a method and an application, wherein the primer composition comprises a specific connecting primer for a tsRNA target, a CRISPR / Cas13a guide RNA, a signal probe and an RT-PCR primer. The kit and the method of the present application are based on the combination of a "linker-tailing" connecting reaction and a CRISPR / Cas13a system, and provide three modes of fluorescent detection, colorimetric detection and RT-PCR detection. Among them, the colorimetric detection mode innovatively introduces a Cas13a-mediated in-situ synthesis of a bimetallic nanoscale enzyme technology, and realizes double amplification of the signal through magnetic separation and nanoscale enzyme catalytic color development. The present application can effectively distinguish tsRNA and maternal tRNA with high sequence homology, has the advantages of strong specificity, high sensitivity, simple operation and visual results, and can be widely applied in the ultra-sensitive detection of tumor markers tsRNA and related scientific research and clinical auxiliary diagnosis.

Description

tsRNA detection primer compositions, kits, methods and applications Technical Field

[0001] This invention relates to the fields of biotechnology and molecular diagnostics, and particularly to tsRNA detection primer compositions, kits, methods and applications. Background Technology

[0002] Cancer, as a disease that seriously threatens human health, has always had early diagnosis, treatment monitoring, and prognostic assessment as core topics in medical research. In recent years, a class of tRNA-derived small RNAs (tsRNAs) has gradually become a research hotspot. tsRNAs mainly originate from mature tRNAs or pre-tRNAs, and are usually produced under stress conditions such as hypoxia and starvation. In mammals, the anticodon loop of mature tRNA is cleaved by angiopoietin (ANG) to form 5' tiRNA and 3' tiRNA. tsRNAs possess specific secondary structures and various chemical modifications, enabling them to exist stably and widely in body fluids, have a long half-life, and exhibit significant cell and tissue specificity.

[0003] As an emerging non-coding RNA, tsRNA plays a crucial role in tumorigenesis and development, exhibiting rich biological regulatory functions. For example, at the transcriptional level, tsRNA can competitively bind to and inhibit oncogene expression; at the post-transcriptional level, it can inhibit the initiation complex, thereby affecting overall protein synthesis; some tsRNAs can even mimic miRNAs to participate in regulation. Furthermore, tsRNA is widely involved in regulating processes such as the cell cycle and apoptosis, and even initiates reverse transcription and promotes viral synthesis during viral infection. Based on these characteristics, tsRNA shows great potential in clinical applications of oncology.

[0004] In diagnostics, tsRNAs exhibit significant differences in the body fluids of cancer patients. For example, elevated plasma 5-tRF-GlyGCC expression has an area under the curve (AUC) of 0.882 for diagnosing colorectal cancer, while decreased plasma tRF-5026a has an AUC of 0.883. Some tsRNAs in the serum of gastric cancer patients also have extremely high diagnostic value. In prognostic assessment, tsRNA expression levels are closely related to tumor malignancy, metastasis, and recurrence. For instance, analysis of peripheral blood and bone marrow small RNA profiles from acute myeloid leukemia (AML) patients revealed that tsRNAs can not only distinguish between normal individuals and AML patients but also indicate poor prognosis. Adding specific tsRNAs to the traditional International Prognostic Index (IPI) for joint scoring can significantly address the problem of inaccurate intermediate / high-risk stratification.

[0005] Despite the high clinical value of tsRNA, its research and application still face significant challenges in detection technology, mainly in the following aspects:

[0006] 1. High sequence homology (core pain point): The tsRNA is completely identical to the maternal tRNA sequence. Conventional detection methods have difficulty distinguishing between free tsRNA fragments and full-length mature tRNA, making it impossible to know the true abundance of tsRNA.

[0007] 2. Low abundance and small fragment size: tsRNA molecules are typically 18-30 nt in length, similar to miRNAs, and have low abundance in body fluids, requiring ultrasensitive and highly specific detection systems for accurate capture.

[0008] 3. Existing technologies have significant limitations: Currently, the main methods for detecting tsRNA include small RNA sequencing, RT-PCR, and Northern Blot. These methods suffer from drawbacks such as large sample requirements, cumbersome procedures, long detection cycles, and reliance on expensive equipment and specialized personnel. In particular, they fail to meet the clinical demand for rapid, low-cost, and easily interpretable detection methods.

[0009] To address these challenges, emerging biosensing technologies offer novel approaches. The CRISPR / Cas13a system, with its isothermal high specificity and strong signal amplification capabilities, recognizes target RNA under crRNA guidance and activates its trans-cleavage activity, efficiently cleaving surrounding reporter molecules and achieving cascaded signal amplification. Furthermore, metal nanozymes, as artificial enzymes combining the properties of nanomaterials with the catalytic activity of enzymes, offer advantages over natural enzymes, including high stability, low cost, and ease of preparation. Bimetallic nanozymes, in particular, achieve a synergistic catalytic performance advantage ("1+1>2") through electronic coupling and spatial synergy between the two metals, and the interaction between the two atoms prevents metal aggregation, making them more suitable for complex biomedical scenarios. Summary of the Invention

[0010] In view of this, the purpose of this invention is to provide tsRNA detection primer compositions, kits, methods and applications that can overcome the technical problems existing in the current tsRNA detection technology, such as the inability to accurately distinguish tsRNA from maternal tRNA, low detection sensitivity, reliance on expensive equipment and lack of visualization detection methods, and to achieve a visually intuitive presentation of results.

[0011] The present invention solves the above-mentioned technical problems through the following technical means:

[0012] In a first aspect, the present invention provides a tsRNA detection primer composition, the primer composition comprising:

[0013] Group A: Primers used for the ligation reaction, including 5' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 1 and 3' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 2; the 5' end of the nucleotide sequence of SEQ ID No. 1 is modified with a phosphate group and the 3' end is modified with an amino group;

[0014] Group B: Guide RNAs for CRISPR / Cas13a reactions, including 5'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 3 and 3'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 4;

[0015] Group C: Nucleic acid probes for signal output, selected from probes with nucleotide sequences as shown in SEQ ID No. 5 or RNA reporters with nucleotide sequences as shown in SEQ ID No. 6;

[0016] Group D: Primer pairs used for RT-PCR amplification, selected from primer pairs consisting of nucleotide sequences such as SEQ ID No. 7 and SEQ ID No. 8, and / or primer pairs consisting of nucleotide sequences such as SEQ ID No. 9 and SEQ ID No. 10.

[0017] The five RNA sequences (SEQ ID No. 1-SEQ ID No. 4, SEQ ID No. 6), one DNA and RMA mixed sequence (SEQ ID No. 5), and four DNA sequences (SEQ ID No. 7-SEQ ID No. 10) designed in this invention are as follows:

[0018] 5'Prime-Gly-GCC (SEQ ID No. 1):

[0019] 5P-GCGAGCACAGAGAGAUAACGACUC-NH2.

[0020] 3'Prime-Gly-GCC (SEQ ID No. 2):

[0021] GCGAGCACAGAGAGAUAACGAAUA.

[0022] 5'crRNA-Gly-GCC (SEQ ID No.3):

[0023] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCUCUGUGCUCGCGCGAGAAUUCUACCAC.

[0024] 3'crRNA-Gly-GCC(SEQ ID No.4):

[0025] GAUUUAGACUACCCCAAAAAACGAAGGGGACUAAAACCGAACCCGGGCCUCUAUUCGUUAUCUCU。

[0026] probe(SEQ ID No.5):

[0027] 5'Biotin-rU / rA / rU / rA / rU / rA / rU / rA / rU / rA / rU / ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAT。

[0028] RNA reporter(SEQ ID No.6):

[0029] FAM-UAUAUA-BHQ1

[0030] 5'Universal prime-R(SEQ ID No.7)

[0031] GAGTCGTTATCTCTCTGTGCTCGC。

[0032] 5'prime-F(SEQ ID No.8)

[0033] GCATTGGTGGTTCAGTGGTAGAAT。

[0034] 3'prime-R(SEQ ID No.9)

[0035] TGCATTGGCCGGGAATCGAACCCG。

[0036] 3'Universal prime-F(SEQ ID No.10)

[0037] GCGAGCACAGAGAGATAACGA.

[0038] In a second aspect, the present invention provides a tsRNA detection kit, comprising the primer composition described above, and an enzyme reaction system for ligating tsRNA, the enzyme reaction system comprising RNA ligase and its reaction buffer, ATP and a coagulant; the kit is also optionally selected from one or more of the following detection systems: (1) CRISPR / Cas13a fluorescence detection system: containing Cas13a protein; (2) CRISPR / Cas13a colorimetric detection system: containing Cas13a protein, magnetic beads, and platinum and palladium salts for constructing nanozymes; (3) RT-PCR detection system: containing reverse transcriptase and DNA polymerase.

[0039] Preferably, when used for fluorescence detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 6; when used for colorimetric detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 5, and the kit further comprises a reducing agent and a chromogenic substrate; when used for RT-PCR detection, the primer composition comprises at least one pair of SEQ ID No. 1-SEQ ID No. 2 and SEQ ID No. 7-SEQ ID No. 10.

[0040] Thirdly, the present invention provides the use of the above-described primer composition or the above-described kit in the preparation of products for detecting tsRNA abundance.

[0041] Fourthly, the present invention provides the application of the kit described above in the preparation of products for detecting tsRNA abundance, wherein the detection using the kit includes a "linker-tailing" ligation step and a signal detection step;

[0042] The "connector-tailing" ligation step includes: establishing a "tailing" system for the 5'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 1, and performing a ligation reaction; establishing a "connector" system for the 3'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 2, and performing a ligation reaction;

[0043] The signal detection step is selected from one or more of CRISPR / Cas13a-mediated fluorescence detection, CRISPR / Cas13a-mediated colorimetric detection, and RT-PCR detection.

[0044] Preferably, in the "connector-tailing" ligation step, the volume ratio of each component is as follows: 1 part of primer SEQ ID No.1 or SEQ ID No.2 at a concentration of 1 μM, 1-3 parts of ligase buffer, 0.5-2 parts of ATP, 3-7 parts of PEG-8000, 0.5-2 parts of T4 RNA Ligase, and 3-7 parts of RNA sample; the reaction conditions are: incubation at 30-45℃ for 60-100 min.

[0045] Preferably, the signal detection step is CRISPR / Cas13a-mediated fluorescence detection, and the specific steps include:

[0046] S1. The tailed product is mixed with Cas13a protein, crRNA shown in SEQ ID No.3, and RNAreporter shown in SEQ ID No.6, and fluorescence signals are collected. The abundance of 5'tsRNA is determined based on the fluorescence signal intensity.

[0047] S2. The adapter product is mixed with Cas13a protein, crRNA shown in SEQ ID No. 4, and RNAreporter shown in SEQ ID No. 6, and fluorescence signals are collected; the abundance of 3'tsRNA is determined based on the fluorescence signal intensity.

[0048] More preferably, the stronger the fluorescence signal, the higher the tsRNA abundance; no fluorescence signal indicates the absence of tsRNA.

[0049] Preferably, the signal detection step is a CRISPR / Cas13a-mediated colorimetric detection, specifically including the following steps:

[0050] A1. Preparation of magnetic bead probe: Magnetic beads are combined with the probe shown in SEQ ID No. 5;

[0051] A2. Shearing reaction: The tailed product and the linker product were mixed and reacted with Cas13a protein, group B crRNA and MB@probe, respectively;

[0052] A3. Nanozyme color development: Platinum salt, palladium salt and reducing agent are added to the reaction system to form bimetallic nanozymes in situ. After magnetic separation and washing, colorimetric substrate is added; the abundance of tsRNA is determined based on the colorimetric signal intensity.

[0053] More preferably, the weaker the colorimetric signal, the higher the tsRNA abundance; the stronger the colorimetric signal, the lower the tsRNA abundance.

[0054] Preferably, in step A3, the platinum salt is K2PtCl4, the palladium salt is K2PdCl4, the reducing agent is NaBH4, and the chromogenic substrate includes TMB and H2O2; the reaction time for in-situ formation of nanozymes is 1-5 min, and the chromogenic reaction time is 10-20 min.

[0055] Preferably, the signal detection step is RT-PCR detection, specifically including: using the tailed product or the adapter product as a template, amplifying the product using the primer pair described in group D under the action of reverse transcriptase and DNA polymerase; performing gel electrophoresis analysis on the amplified product, the band appearing at 50-55bp is tsRNA, the band appearing at 100-110bp is maternal tRNA, and the brighter the band, the higher the tsRNA abundance.

[0056] This invention develops a novel tsRNA detection method involving two steps: tsRNA elongation and tsRNA recognition, as well as CRISPR / Cas13a system signal output. First, tails and adapters were designed for 5' tsRNA and 3' tsRNA, respectively. Under the action of T4RNA Ligase 1, the 5' tsRNA is tailed at its 3' end, and the 3' tsRNA is adapter-attached at its 5' end, elongating the tsRNA (Figure 1A). Notably, its homologous parent tRNA is also headed / terminated. Next, 5' crRNA and 3' crRNA were cleverly designed to specifically recognize the elongation product. Specifically, the recognition region (28 nt) of crRNA recognizes either the adapter or the tail on one side, and specifically recognizes either 5' crRNA or 3' crRNA on the other. In other words, only specific tsRNAs that have completed heading / termination can be fully complementary to crRNA, activating the Cas13a system. In the dual-mode, the fluorescence signal was generated by an RNA reporter modified with FAM and BHQ1, which acts as a trans-cleavage substrate activated by Cas13a and produces significant fluorescence upon cleavage (Figure 1C). The visualized colorimetric signal was generated by a PtPd bimetallic nanozyme attached to a probe on the surface of a magnetic bead (MB). Specifically, the probe consists of two parts: a 5' DNA end and a 3' RNA end containing 6 nt RNA, facilitating recognition by Cas13a trans-cleavage activity. The probe was enriched onto the streptavidin-modified MB via biotin modification at the RNA end (Figure 1B). At the same concentration of PtPd... 2+ and Pd 2+Under the action of NaBH4, a bimetallic nanozyme PtPd is formed using DNA as the growth nucleus. This metal nanozyme exhibits very strong peroxidase-like activity, catalyzing the conversion of TMB to oxTMB within 2 minutes, which appears blue. Utilizing this property, in the presence of tsRNA, the probe is cleaved and detached from the microplate (MB). After washing and magnetic separation, the remaining PtPd decreases, and TMB does not show color. In the absence of tsRNA, the probe and PtPd on the MB are retained, rapidly catalyzing the color development of TMB. In summary, the output mode of tsRNA is strong fluorescence with weak colorimetric analysis (colorless, Figure 1D), while the signals of other RNAs, including homologous parental tRNA, are non-fluorescent with strong colorimetric analysis (blue, Figure 1E).

[0057] The beneficial effects of this invention are:

[0058] (1) This invention employs a unique "connector-tailing" strategy to lengthen tsRNA, avoiding the problem of missed detection due to short fragments. Utilizing the efficient ligation characteristics of T4 RNA Ligase 1 for single-stranded small RNA fragments (tsRNA), combined with the high specificity recognition of the CRISPR / Cas13a system, it can accurately distinguish short-chain tsRNA from long-chain maternal tRNA (pre-tRNA or mature tRNA) with complex folding structures, thereby revealing the true abundance of tsRNA. This invention enhances anti-interference capabilities, enabling accurate identification of low-abundance tsRNA among a large number of maternal tRNAs, with a detection limit as low as 0.17%, achieving precise identification of highly homologous tsRNAs and tRNAs.

[0059] (2) In colorimetric detection mode, this invention combines the "reverse cleavage" cascade amplification effect of CRISPR / Cas13a with the highly efficient catalytic amplification effect of bimetallic nanozymes (PtPd). Once activated, Cas13a can continuously cleave the probe, while the in-situ generated PtPd nanozymes have a synergistic catalytic activity of "1+1>2". The combination of the two greatly reduces the detection limit to as low as 3.47 fM, which is 10 times higher than the sensitivity of traditional techniques. 5 This can avoid missed detections caused by insufficient sensitivity.

[0060] (3) This invention integrates three modes: fluorescence (precise quantification), colorimetry (intuitive, no need for expensive instruments, suitable for POCT on-site testing), and RT-PCR (traditional verification). Users can flexibly choose according to laboratory conditions and testing needs. This invention is simple to operate, uses isothermal reactions, does not rely on large instruments, has low cost, and is suitable for clinical environments. Attached Figure Description

[0061] Figure 1 is a schematic diagram of Cas13a fluorescence-colorimetric dual-mode detection of tsRNA based on the "linker-tailing" ligation reaction and bimetallic nanozyme; in the figure, A is the "linker-tailing" ligation reaction; B is the preparation of MB@Probe; C is the Cas13a-fluorescence mode detection of tsRNA; D and E are the principles of Cas13a-colorimetric mode detection in the presence and absence of tsRNA, respectively.

[0062] Figure 2 shows the screening of metal nanozymes. In the figure, AG shows the changes in absorbance at 370 nm of Pt, Pd, Co, PtPd, PtCo, PdCo, ​​and PtPdCo within 40 min; H shows the color changes of different metal nanozymes after catalyzing TMB color development for 40 min; and I shows the optimization of the concentration of PtPd generated by NaBH4 catalysis.

[0063] Figure 3 shows the morphology and elemental characterization of PtPd. In the figure, A is the morphology and lattice of PtPd measured by HRTEM; B is the surface elemental characterization of PtPd by XPS energy dispersive spectroscopy.

[0064] Figure 4 shows the morphology and elemental composition of MB@DNA@PtPd. In the figure, A is TEM imaging of MB@DNA@PtPd; B is EDS spectroscopy characterization of the elemental composition of MB@DNA@PtPd.

[0065] Figure 5 shows the elemental composition of MB@DNA@PtPd. In the figure, A is the XPS energy dispersive spectroscopy characterizing the surface elements of MB@DNA@PtPd; B and C are the XRD characterizing the elemental composition of PtPd and MB@DNA@PtPd, respectively; D is the potential of probe, streptavidin-modified MB (SA-MB), and SA-MB@probe tested by Zeta testing.

[0066] Figure 6 shows the sensitivity of this invention. In the figure, A is the ability of T4 RNA Ligase 1 to elongate tsRNA and tRNA by PAGE; B and D are the fluorescence signals and images under UV light after testing different concentrations of tsRNA; C is the linear relationship between fluorescence signal and tsRNA concentration; E and F are the absorbance and color changes at 370 nm after testing different concentrations of tsRNA; G is the linear relationship between absorbance at 370 nm and tsRNA concentration.

[0067] Figure 7 shows the specificity test of the present invention. In the figure, A and B show the specificity of the fluorescence signal test method and the fluorescence signals of different RNAs under ultraviolet light; C and D show the specificity of the colorimetric signal test method and the color changes of different RNAs.

[0068] Figure 8 shows the anti-interference, repeatability, and reproducibility tests of the present invention. In the figure, A and E are fluorescence and colorimetric signals of tsRNA and tRNA mixtures with different ratios; B and F are fluorescence signals and linear relationships between absorbance and ratio; C and D are fluorescence and colorimetric signals of mixtures with different ratios under ultraviolet and incandescent lamps; and G, H, I, and J are the repeatability and reproducibility test results.

[0069] Figure 9 illustrates the principle and sensitivity test of RT-PCR based on "adaptor-tailing". In the figure, A is a schematic diagram of the principle; B is the optimization of RT-PCR annealing temperature; C is the sensitivity test of 5'tsRNA; D is the sensitivity test of 3'tsRNA; E is the anti-interference ability test of 5'tsRNA; and F is the anti-interference ability test of 3'tsRNA.

[0070] Figure 10 shows the specificity and reproducibility tests of RT-PCR based on "adaptor-tailing". In the figure, A and B are specificity tests; C and D are reproducibility and reproducibility tests of 5'tsRNA and 3'tsRNA.

[0071] Figure 11 shows the abundance of tsRNA in cells using a Cas13a-based fluorescence-colorimetric dual-mode detection method. In the figure, A and C show the fluorescence intensity of 5'tsRNA and 3'tsRNA in HEK293 cells at different concentrations; B and D show the linear relationships between the fluorescence intensity of 5'tsRNA and 3'tsRNA and cell concentration, respectively; E shows the colorimetric spectrum and color changes of 3'tsRNA in HEK293 cells at different concentrations; and F shows the linear relationship between absorbance at 370 nm and cell concentration.

[0072] Figure 12 shows the abundance of tsRNA in mouse blood tested by a fluorescence-colorimetric dual-mode detection method based on Cas13a. In the figure, A, B, and D show the fluorescence intensity of 5'tsRNA and 3'tsRNA in the blood of healthy mice and AML mice, as well as their intensity under UV light; C and E show the distribution of 3'tsRNA absorbance in healthy mice and AML mice, respectively.

[0073] Figure 13 shows the application of RT-PCR in actual sample detection. In the figure, A and B are RT-PCR tests to detect the abundance of 5'tsRNA and 3'tsRNA in cells at different concentrations; C and D are RT-PCR tests to detect the abundance of 5'tsRNA and 3'tsRNA in the blood of healthy mice and mice with leukemia.

[0074] Figure 14 shows the abundance of 5'tsRNA and 3'tsRNA in the serum of healthy volunteers and AML patients using a Cas13a-based fluorescence-colorimetric dual-mode detection method. In the figure, A, B, C, and D show the fluorescence intensity of 5'tsRNA and 3'tsRNA in the serum of each healthy volunteer and AML patient, as well as their intensity under UV light; E and F show the absorbance and color change of 3'tsRNA in the serum of each healthy volunteer and AML patient.

[0075] Figure 15 shows the application of RT-PCR in AML patients. In the figure, A and B are RT-PCR tests of the abundance of 5'tsRNA and 3'tsRNA in the serum of healthy volunteers and AML patients. Detailed Implementation

[0076] The technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0077] Example 1: Construction and screening of bimetallic nanozymes.

[0078] Add 1 μL of 20 mM NaBH4 to 5 μL of 20 mM K2PtCl4, 5 μL of 20 mM K2PdCl4, 5 μL of 20 mM CoCl2·6H2O, 5 μL of a mixture of 20 mM K2PtCl4 and K2PdCl4, 5 μL of a mixture of 20 mM K2PtCl4 and CoCl2·6H2O, 5 μL of a mixture of 20 mM CoCl2·6H2O and K2PdCl4, 5 μL of a mixture of 20 mM K2PdCl4, K2PtCl4 and CoCl2·6H2O, and react for 2 min to form single-metal nanozymes Pt, Pd and Co, bimetallic nanozymes PtPd, PtCo and PdCo, ​​and trimetallic nanozymes PtPdCo. Add 5 μL of each nanozyme to 50 μL of TMB and 50 μL of H2O2, and record their respective color changes and absorbance at 370 nm.

[0079] To screen for the best-performing metal nanozymes, this invention tested the performance of Pt, Pd, and Co. Under the action of NaBH4, Pt... 2+ Pd 2+ and Co 2+It is reduced to its elemental form. As shown in Figures 2A-2H, Pt can rapidly catalyze the color development of TMB, the catalytic activity of Pd is time-dependent, while Co has the weakest catalytic performance and no obvious signal is observed. The PtPd bimetallic nanozyme rapidly reaches the signal plateau within 10 minutes, and its catalytic effect is significantly stronger than that of the single-metal nanozymes Pt and Pd, while the catalytic performance of PtCo and PdCo is not significantly enhanced. This may be because Pt provides electrons to Pd, forming a symbiotic structure that enhances the performance of both. The PtPdCo trimetallic nanozyme can reach the maximum signal in a short time, and its catalytic efficiency is higher than that of the PtPd bimetallic nanozyme. However, due to its rapid catalysis, the color changes quickly from blue to green and then to brownish-yellow, which is not conducive to stable signal acquisition. The optimal concentration of NaBH4 is 5 mM (Figure 2I). In summary, to achieve rapid and stable signal output, this invention selects the PtPd bimetallic nanozyme as the colorimetric signal output element.

[0080] Example 2: Morphology and elemental composition characterization of PtPd and MB@Probe@PtPd.

[0081] As an important sensing element for colorimetric sensors, PtPd was first synthesized using high-resolution transmission electron microscopy (HRTEM), XPS, and XRD. HRTEM morphology and size analysis showed that the PtPd particle size distribution ranged from 1 to 3.7 nm, mainly concentrated at 2.2 nm, exhibiting good dispersion. The lattice spacing of the PtPd nanoparticles was 0.233 nm (Figure 3A). XRD was used to investigate the crystallinity of PtPd. Due to the small particle size, the diffraction peaks were weak (Figure 5B). Specifically, diffraction peaks corresponding to Pt were found at 39.892° and 46.395° (PDF 87–0640), and diffraction peaks corresponding to Pd were found at 39.924° and 46.433° (PDF 87–0643). XPS was used to characterize the surface elemental composition and valence state of PtPd. As shown in Figure 3B, photoelectron signals of Pd 3d and Pt 4f elements can be observed (based on a C 1s (284.8 eV) calibration baseline). The Pt 4f peak is resolved into four peaks with binding energies of 76.08 eV and 72.78 eV, corresponding to Pt 3d and Pt 4f respectively. 2+ 4f 5 / 2 and Pt 2+ The binding energies of 74.18 eV and 70.68 eV correspond to Pt 4f 5 / 2 and Pt 4f 7 / 2, respectively. In the X-ray photoelectron spectrum of Pd 3d electronic states, the Pd 3d 3 / 2 peak at 343.08 eV and the Pd 3d 5 / 2 peak at 337.88 eV are attributed to Pd 4f 7 / 2. 2+ The binding energies at 339.98 eV and 334.78 eV correspond to Pd, respectively. 03d 3 / 2 and Pd 0 3d 5 / 2. The above data proves the successful synthesis of PtPd.

[0082] This invention constructs an MB@probe@PtPd signal output terminal for tsRNA colorimetric detection. First, the characteristics of MB@probe@PtPd are investigated. As shown in Figure 4A, TEM morphology and size show that MB@probe@PtPd is between 230 and 275 nm, with a distinct transparent ring at the edge of MB, indicating successful DNA-PtPd attachment to MB. Elemental characterization shows the presence of C, N, O, P, Fe, Pd, and Pt elements on the individual material (Figure 4B). XPS surface elemental characterization reveals photoelectron signals containing C1s, N1s, P2p, O1s, Pd 3d, and Pt 4f elements (Figure 5A). The Pt 4f peak in MB@probe@PtPd was resolved into four peaks with binding energies of 77.18 eV and 71.68 eV, corresponding to Pt 4f elements respectively. 2+ 4f 5 / 2 and Pt 2+ The binding energies of 74.48 eV and 70.78 eV correspond to Pt 4f 5 / 2 and Pt 4f 7 / 2, respectively. In the X-ray photoelectron spectrum of Pd 3d electronic states, the Pd 3d 3 / 2 peak at 342.48 eV and the Pd 3d 5 / 2 peak at 337.68 eV are attributed to Pd 4f 7 / 2. 2+ The binding energies at 340.38 eV and 335.28 eV correspond to Pd, respectively. 0 3d 3 / 2 and Pd 0 3d 5 / 2. Compared to PtPd materials, their peak shift is likely due to interactions with DNA. In XRD analysis, C appeared in the energy spectrum. 10 N9P3O 12 The corresponding diffraction peaks for Fe3O4 (PDF 72–2134), Pd (PDF 75–0449), and Pt (PDF 87–0643) are shown in Figure 5C. Finally, the zeta potentials of probe, streptavidin-modified MB (SA-MB), and SA-MB@probe were tested. It was found that SA-MB@probe, like probe, exhibits a negative charge (Figure 5D), indicating that the almost uncharged MB successfully binds a large amount of probe. These data fully demonstrate the successful synthesis of MB@probe@PtPd.

[0083] Example 3: Investigation of the sensitivity, specificity, and repeatability of fluorescence-colorimetric dual-mode technology based on the Cas13a system.

[0084] To test the performance of the method, this invention uses different concentrations and ratios of 5'tsRNA-Gly-GCC (GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC), tRNA-Gly-GCC (5P-GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCAAUGCA), and 3'tsRNA-Gly-GCC (5P-GAGGCCCGGGUUCGAUUCCCGGCCAAUGCA) as targets to participate in the reaction.

[0085] The "head-tail" ligation step is the tsRNA extension step and the basis for recognition. This invention first investigates the efficiency of the ligation reaction. As shown in Figure 6A, after ligating a tail to the 3' end of 5' tsRNA and a adapter to the 5' end of 3' tsRNA, the fragments significantly increased in size (lines 7 and 10). Similarly, after head-tail ligation of the parent tRNA, fragment enlargement was observed (lines 6 and 9), indicating that T4 RNA Ligase 1 effectively extends tsRNA. Furthermore, this invention investigates the Cas13a system's ability to recognize tsRNA. As shown in Figures 6B and 6D, the fluorescence signal continuously increases with increasing tsRNA concentration. Under UV light, fluorescence signals were observed even at concentrations as low as 0.5 nM tsRNA. A good linear relationship existed between fluorescence signal and concentration from 1 nM to 100 nM (Figure 6C), with a detection limit as low as 0.44 nM. On the other hand, with the addition of dual nanozymes, the method significantly expands the detection range, as shown in Figures 6E and 6F, where the blue color gradually deepens as the concentration decreases from 100 nM to 10 fM. Based on the linear relationship between absorbance at 370 nm and concentration and the 3σ rule (Figure 6G), the detection limit is as low as 3.47 fM. Compared with other methods, the method developed in this invention has greater practical advantages in terms of time, detection limit, and accuracy.

[0086] This invention further explores the specificity of fluorescence and colorimetric detection methods for tsRNA. As shown in Figures 7A and 7B, among numerous tsRNAs and tRNAs at concentrations 10 times higher, tsRNA-Gly and tsRNA mixtures (including Mix-tsRNA and Mix, which contain tsRNA-Gly and other RNAs) exhibit significant fluorescent signals; among similarly short miRNA fragments, only tsRNA shows a clear fluorescent signal; in the mixture, the Cas13a system, with the assistance of crRNA, can also successfully identify tsRNA. Similarly, in the colorimetric detection method, as shown in Figures 7C and 7D, among numerous RNAs, tsRNA-Gly and tsRNA mixtures (including Mix-tsRNA and Mix, which contain tsRNA-Gly and other RNAs) have the lightest color, while other RNAs, including parental tRNA, are similar to the control, showing a deep blue color. Therefore, fluorescence and colorimetric detection methods have high specificity in tsRNA detection and are not affected by interference from other RNAs.

[0087] It is worth noting that tsRNA originates from the maternal tRNA, and the two share 100% sequence homology. This means that during sequence recognition, the greatest interference to tsRNA comes from tRNA itself. To test the interference of the method, this invention tested the signals of tsRNA / tRNA mixtures with different proportions. As shown in Figure 8A, as the proportion of tsRNA gradually decreases, the fluorescence signal gradually weakens, and a mixture as low as 1% can be identified under ultraviolet light (Figure 8C); the colorimetric signal gradually strengthens, and the blue color gradually deepens visibly (Figures 8E and 8D). Fitting analysis revealed that the fluorescence signal and colorimetric signal exhibit good linear relationships with the proportions and follow the 3σ rule (Figures 8B and 8F), respectively. The calculated detection limits for fluorescence are as low as 0.7%, and for colorimetric signals as low as 0.17%.

[0088] Next, the reproducibility of the method was tested. Through repeated experiments by different researchers and the same researcher, the RSD of the fluorescence signal was found to be 4.86% and 3.71%; the RSD of the colorimetric signal was 4.59% and 3.60% (Figures 8G-8J), both less than 5%, fully demonstrating that the method has good reproducibility and repeatability.

[0089] Furthermore, to compare the performance with traditional methods, this invention developed an RT-PCR technique based on "adaptor-tailing". According to other literature on RT-PCR techniques for tsRNA detection (adding polyA to the 3' end of tsRNA before RT-PCR), this technique cannot distinguish between 3' tsRNA and maternal tRNA. This is because the primers specifically bind to the same position as the 3' tsRNA or maternal tRNA, resulting in identical sequences that cannot be distinguished. Therefore, this invention constructs an RT-PCR technique based on "adaptor-tailing": a tail sequence is added to the end of the 5' tsRNA; under the action of specific primers, the amplification products of 5' tsRNA and maternal tRNA have different lengths. An adapter sequence is added to the 5' end of the 3' tsRNA, as shown in Figure 9A, to lengthen the tsRNA. Similarly, utilizing the inherent length difference between 3' tsRNA and maternal tRNA, products of different lengths are amplified, and electrophoresis clearly distinguishes between 3' tsRNA and maternal tRNA. At the optimal annealing temperature (61.8℃, Figure 9B), RT-PCR can detect as low as 100 nM 5'tsRNA and 100 pM 3'tsRNA (Figures 9C and 9D). This technique exhibits strong resistance to interference, identifying as low as 1% 5'tsRNA and 10% 3'tsRNA in mixtures of tsRNA and tRNA with varying proportions (Figures 9E and 9F). Further studies revealed good specificity, with corresponding bands appearing only in tsRNA or mixtures containing tsRNA (Figures 10A-10B). Furthermore, the adapter-tailing-based RT-PCR technique demonstrates high reproducibility and repeatability (Figures 10C-10D). Although the newly developed RT-PCR technique outperforms traditional techniques, it is still slightly inferior to the fluorescence-colorimetric dual-mode technique based on Cas13a and bimetallic nanozymes. This technique is 200-10 times more sensitive than RT-PCR. 5 It is twice as fast and has stronger anti-interference ability (detection limit as low as 0.17%).

[0090] Example 4: Cell detection.

[0091] HEK293 cells were serially diluted, and RNA was extracted separately. The method constructed in this invention was used to detect 5' tsRNA and 3' tsRNA, respectively. As cell concentration decreased, fluorescence intensity continuously decreased (Figures 11A and 11C), while the colorimetric signal gradually increased (Figure 11E). This indicates that as cell concentration decreases, the concentration of extracted total RNA decreases, and the abundance of tsRNA also decreases. The lowest resolvable concentration under UV light and the naked eye was 10-1. 4 cells·mL -1The fluorescence and colorimetric signals showed good linear relationships with cell concentration (Figures 11B, 11D, and 11F). Based on the 3σ rule, the detection limit was 570 cells / mL. -1 (5' tsRNA fluorescence mode), 714 cells·mL -1 (3' tsRNA fluorescence mode), 2.22 cells·mL -1 (Colorimetric mode).

[0092] Furthermore, RT-PCR was used to detect tsRNA in HEK293 cells at different concentrations. The results showed that RT-PCR could detect 10 tsRNAs of 5' tsRNA and 10 tsRNAs of 3' tsRNA, respectively. 5 and 10 6 cells·mL -1 For tRNA, this technology can detect levels as low as 10. 4 cells·mL -1 (Figures 13A-13B). The concentration differences may be due to concentration coverage in PCR. Specifically, in cells, the concentration of tsRNA is lower than that of tRNA, and PCR amplification preferentially selects the higher concentration, resulting in a reduced probability of amplifying the lower concentration of the target. In contrast, fluorescence and colorimetric detection techniques based on Cas13a and bimetallic nanozymes have higher detection capabilities, with detection limits as low as 570 cells / mL. -1 (Fluorescence) and 2.22 cells·mL -1 (Colorimetric analysis). This is due to the trans-cleavage activity of Cas13a and the signal amplification capability of the bimetallic nanozyme.

[0093] Example 5: Clinical sample testing in mice and AML patients.

[0094] Studies have shown that the abundance of tsRNA in the blood of patients with acute myeloid leukemia (AML) is higher than that in healthy individuals, and can be used for early diagnosis and prognosis of AML. To verify this view, an AML mouse model was constructed in the early stages of this invention. Blood was collected from healthy mice and mice with AML, and RNA was extracted to test the abundance of tsRNA. As shown in Figures 12A and 12B, the fluorescence signal of AML mice was significantly higher than that of healthy mice for both 5' and 3' tsRNA, and the same result could be observed under ultraviolet light (Figure 12D). The colorimetric signal of diseased mice was significantly lower than that of healthy mice (Figures 12C and 12E). The results indicate that the abundance of tsRNA in the blood of diseased mice is significantly higher than that of healthy mice. In addition, this invention uses RT-PCR technology to detect tsRNA in mouse blood and tests its detection capability in complex samples (Figure 13C). The results showed that, for the detection of 5' tsRNA, the abundance of tsRNA in mice with AML was significantly higher than that in healthy mice, which is consistent with the results of fluorescence and colorimetric detection techniques (Figure 13C). In the 3' tsRNA detection, no significant difference was found between healthy and diseased mice (Figure 13D). However, in the results of fluorescence and colorimetric detection techniques, the average fluorescence intensity of diseased mice was significantly higher than that of healthy mice, and the two could be clearly distinguished in colorimetric mode. This inconsistency may be due to the lower abundance of tsRNA in mouse blood, below the detection range of RT-PCR. Therefore, fluorescence and colorimetric detection techniques are more advantageous in practical applications.

[0095] Next, blood samples were collected from 4 healthy volunteers and 16 AML patients, and serum RNA was extracted. Detection revealed that the fluorescence intensity of both 5' tsRNA and 3' tsRNA in AML patients was significantly higher than that in healthy volunteers (Figures 14A-14D). In colorimetric analysis, the signal from healthy volunteers was clearly deep blue, while the signal from AML patients was significantly weaker (Figures 14E-14F). These data indicate that the abundance of tsRNA in the serum of AML patients is significantly higher than that in healthy volunteers. The abundance of tsRNA in serum can be used to identify the occurrence of AML. Simultaneously, tsRNA in the serum of healthy volunteers and AML patients was detected using "adapter-tailed" RT-PCR technology. Figure 15A shows that for 5' tsRNA detection, the amplification product from AML patients was more abundant than that from healthy volunteers, while no significant difference was found in 3' tsRNA detection (Figure 15B). However, both 5' tsRNA and 3' tsRNA clearly identified healthy volunteers and AML patients in the fluorescence and colorimetric detection results. This difference may also be due to the low tsRNA abundance. Furthermore, RT-PCR results also show that the abundance of tRNA in serum is very low or absent, while tsRNA is dominant. This provides useful evidence for research on the potential intercellular communication function of tsRNA.

[0096] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. A tsRNA detection primer composition, characterized in that, The primer composition comprises: Group A: primers for ligation reactions, including 5' Prime-Gly-GCC as shown in SEQ ID No. 1 and 3' Prime-Gly-GCC as shown in SEQ ID No. 2; the 5' end of the nucleotide sequence of SEQ ID No. 1 is modified with a phosphate group and the 3' end is modified with an amino group; Group B: guide RNA for CRISPR / Cas13a reactions, including 5' crRNA-Gly-GCC as shown in SEQ ID No. 3 and 3' crRNA-Gly-GCC as shown in SEQ ID No. 4; Group C: nucleic acid probes for signal output, selected from probe as shown in SEQ ID No. 5 or RNA reporter as shown in SEQ ID No. 6; and Group D: primer pairs for RT-PCR amplification, selected from primer pairs composed of nucleotide sequences such as SEQ ID No. 7 and SEQ ID No. 8, and / or primer pairs composed of nucleotide sequences such as SEQ ID No. 9 and SEQ ID No.

10.

2. tsRNA detection kit, characterized in that, The kit includes the primer composition of claim 1 and an enzyme reaction system for ligating tsRNA, the enzyme reaction system including RNA ligase and its reaction buffer, ATP and polyethylene glycol; the kit includes one or more of the detection systems (1), (2) and (3): (1) CRISPR / Cas13a fluorescence detection system: containing Cas13a protein; (2) CRISPR / Cas13a colorimetric detection system: containing Cas13a protein, magnetic beads, and platinum and palladium salts for constructing nanozymes; (3) RT-PCR detection system: containing reverse transcriptase and DNA polymerase.

3. The use of the primer composition of claim 1 or the kit of claim 2 in the preparation of products for detecting tsRNA-Gly-GCC abundance.

4. A method for detecting tsRNA-Gly-GCC abundance for non-disease diagnostic purposes, characterized in that, The detection using the kit of claim 2 includes a "connector-tailing" ligation step and a signal detection step; the "connector-tailing" ligation step includes: establishing a "tailing" system for the 5'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 1, and performing a ligation reaction; establishing a "connector" system for the 3'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 2, and performing a ligation reaction; the signal detection step is selected from one or more of CRISPR / Cas13a-mediated fluorescence detection, CRISPR / Cas13a-mediated colorimetric detection and RT-PCR detection.

5. The method according to claim 4, characterized in that, In the "connector-tailing" ligation step, the volume ratio of each component is as follows: 1 part of primer SEQ ID No.1 or SEQ ID No.2 at a concentration of 1 μM, 1-3 parts of ligase buffer, 0.5-2 parts of ATP, 3-7 parts of PEG-8000, 0.5-2 parts of T4 RNA Ligase 1, and 3-7 parts of RNA sample; the reaction conditions are: incubation at 30-45℃ for 60-100 min.

6. The method according to claim 4, characterized in that, The signal detection step is a CRISPR / Cas13a-mediated fluorescence detection, specifically including: S1. Mixing the tailed product with Cas13a protein, crRNA shown in SEQ ID No. 3, and RNAreporter shown in SEQ ID No. 6, and collecting fluorescence signals; determining the 5' tsRNA abundance based on the fluorescence signal intensity; S2. Mixing the adapter product with Cas13a protein, crRNA shown in SEQ ID No. 4, and RNAreporter shown in SEQ ID No. 6, and collecting fluorescence signals; determining the 3' tsRNA abundance based on the fluorescence signal intensity.

7. The method according to claim 4, characterized in that, The signal detection step is a CRISPR / Cas13a-mediated colorimetric detection, specifically including: A1. Preparation of magnetic bead probe: binding magnetic beads to the probe shown in SEQ ID No. 5; A2. Shearing reaction: mixing the tailed product and the adapter product with Cas13a protein, group B crRNA, and MB@probe, respectively; A3. Nanozyme color development: adding platinum salt, palladium salt, and reducing agent to the reaction system to form a bimetallic nanozyme in situ, followed by magnetic separation and washing, and then adding a colorimetric substrate; determining the tsRNA abundance based on the colorimetric signal intensity.

8. The method according to claim 7, characterized in that, In step A3, the platinum salt is K2PtCl4, the palladium salt is K2PdCl4, the reducing agent is NaBH4, and the chromogenic substrate includes TMB and H2O2; the reaction time for in-situ nanozyme formation is 1-5 min, and the chromogenic reaction time is 10-20 min.

9. The method according to claim 4, characterized in that, The signal detection step is RT-PCR detection, and the specific steps include: using the tailed product or the adapter product as a template, amplification is performed using the primer pair described in group D under the action of reverse transcriptase and DNA polymerase; the amplified products are analyzed by gel electrophoresis, and the band appearing at 50-55bp is tsRNA, the band appearing at 100-110bp is maternal tRNA, and the brighter the band, the higher the tsRNA abundance.

Images