ShTIP1 gene, protein and application
By overexpressing the ShTIP1 gene in sugarcane and rice to regulate leaf size, the problem of leaf morphology regulation was solved, achieving the breeding goals of high yield, water conservation, and stress resistance, and providing a new molecular breeding method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
- Filing Date
- 2026-01-09
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies are insufficient to effectively regulate the size of sugarcane and rice leaves, affecting photosynthetic efficiency, transpiration water consumption, and stress resistance. There is a lack of precise regulatory targets for molecular breeding.
By cloning the sugarcane ShTIP1 gene, constructing an overexpression vector, and overexpressing or overexpressing the ShTIP1 gene in sugarcane and rice, genetic transformation was carried out using Agrobacterium-mediated transformation to reduce leaf size.
It significantly reduces the leaf size of sugarcane and rice, improves water use efficiency, enhances drought resistance, optimizes population structure, increases sucrose accumulation, and provides a new method for molecular breeding.
Smart Images

Figure CN121472254B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically a ShTIP1 gene, protein, and its application. Background Technology
[0002] The core target traits in sugarcane breeding include sugar content, stress resistance, and leaf morphology. As the main organ for photosynthesis, leaf morphology directly determines photosynthetic efficiency and biomass accumulation, thus affecting crop yield. Therefore, its genetic improvement has always been a key area of research in crop breeding and plant biology. Understanding the molecular regulatory mechanisms of key traits such as leaf size is of great significance for crop genetic improvement.
[0003] Aquaporins (AQPs) belong to the major intrinsic protein (MIP) superfamily and are widely distributed throughout the biological world, responsible for the efficient and selective transmembrane transport of water molecules. In plants, aquaporins not only participate in water balance and long-distance transport but also play a crucial role in growth and development, stress response, and various physiological processes. Among them, tonopalatal intrinsic proteins (TIPs), as an important subclass of aquaporins, have functions that extend beyond simple water transport to include the transmembrane transport of small molecules and gases such as carbon dioxide and hydrogen peroxide, thus participating extensively in cellular metabolism, turgor pressure regulation, and signal transduction. Summary of the Invention
[0004] To address the above problems, this invention provides a ShTIP1 gene, protein, and its applications.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] A ShTIP1 gene, the sequence of which is as shown in SEQ ID NO: 1;
[0007] The ShTIP1 gene is negatively correlated with plant leaf size.
[0008] A ShTIP1 protein, wherein the ShTIP1 protein is a protein encoded by the aforementioned ShTIP1 gene, and its amino acid sequence is shown in SEQ ID NO: 2.
[0009] A recombinant vector containing the ShTIP1 gene, wherein the recombinant vector containing the ShTIP1 gene is obtained by ligating the aforementioned ShTIP1 gene into an overexpression vector.
[0010] A strain carrying the ShTIP1 gene, wherein the strain carrying the ShTIP1 gene is Agrobacterium carrying the ShTIP1 gene;
[0011] The sequence of the ShTIP1 gene is shown in SEQ ID NO: 1.
[0012] An application of the ShTIP1 gene in reducing plant leaf size, wherein the application is to overexpress or overexpress the ShTIP1 gene in sugarcane or rice to reduce plant leaf size;
[0013] The sequence of the ShTIP1 gene is shown in SEQ ID NO: 1.
[0014] Furthermore, the application involves transforming sugarcane or rice with a recombinant vector containing the ShTIP1 gene or a strain carrying the ShTIP1 gene, thereby overexpressing or over-expressing the ShTIP1 gene in sugarcane or rice to reduce the size of plant leaves.
[0015] Furthermore, the application reduces leaf size by overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to decrease the distance between leaf veins.
[0016] A method to improve the cold resistance of plants, the method being to overexpress or overexpress the ShTIP1 gene in sugarcane or rice to reduce the size of plant leaves;
[0017] The sequence of the ShTIP1 gene is shown in SEQ ID NO: 1.
[0018] Furthermore, the method involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to reduce the distance between leaf veins and thus decrease leaf size.
[0019] A plant breeding method, wherein the breeding method involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to obtain sugarcane or rice with reduced leaf size;
[0020] The sequence of the ShTIP1 gene is shown in SEQ ID NO: 1.
[0021] The beneficial effects of the ShTIP1 gene, protein, and application of this invention are as follows:
[0022] Given the central role of aquaporins in plant water relations and growth and development, research on the function of ShTIP1 in sugarcane has significant theoretical and applied value. This invention focuses on the regulatory role of ShTIP1 on sugarcane leaf size, aiming to systematically elucidate its molecular mechanism in leaf morphogenesis. Leaf size directly affects transpiration water consumption, photosynthetic efficiency, canopy structure, and lodging resistance. By regulating ShTIP1 expression, leaf area can be appropriately reduced, thereby achieving synergistic optimization of multiple agronomic traits: on the one hand, it can reduce transpiration water loss, improve water use efficiency, and enhance drought resistance; on the other hand, it can improve field ventilation and light penetration, optimize canopy structure, and may promote the distribution of photosynthetic products to the stem (sucrose storage organ), thereby increasing sucrose accumulation. This invention not only helps to deepen the understanding of the regulatory mechanism of sugarcane leaf development, but also provides new functional gene resources and precise regulatory targets for molecular breeding, laying a theoretical foundation for cultivating a new generation of high-yielding, water-saving, and stress-resistant sugarcane varieties.
[0023] The research of this invention shows that overexpression of ShTIP1 in rice and sugarcane can significantly reduce leaf size and shorten the distance between leaf veins; therefore, ShTIP1 is a leaf regulation-related gene with important application prospects.
[0024] This invention clones the sugarcane ShTIP1 gene, constructs an overexpression vector, and reduces the leaf size of plants by overexpressing this single gene (sugarcane ShTIP1 gene). This demonstrates that the ShTIP1 gene can negatively regulate the leaf size of sugarcane and rice, laying a theoretical foundation for breeding a new generation of high-yield, water-saving, and stress-resistant sugarcane and rice varieties.
[0025] In practical applications, the ShTIP1 gene can be introduced into target plants to obtain plants with smaller leaves, providing a new method for molecular breeding of sugarcane and rice. Attached Figure Description
[0026] Figure 1 This is a map of the pCAMBIA3300-ShTIP1 plant expression vector in Example 1 of this invention;
[0027] Figure 2This invention presents the phenotype and ShTIP1 expression status of PCR-positive transgenic sugarcane plants overexpressing ShTIP1. Figure a shows the phenotype of PCR-positive transgenic sugarcane plants overexpressing ShTIP1 in Example 2, with a scale bar of 5 cm. Figure b shows the ShTIP1 expression level in the leaves of PCR-positive transgenic sugarcane plants overexpressing ShTIP1 using RT-qPCR analysis in Example 4. GAPDH was used as an internal reference gene, and the data were normalized. In ShTIP1-OE, #1, #2, and #3 represent three stable expression lines: ShTIP1#1, ShTIP1#2, and ShTIP1#3. WT-XTT22 represents wild-type sugarcane XTT22. Data represent mean ± SE (n=3). All different letters indicate significant differences in one-way ANOVA using a t-test (P<0.05).
[0028] Figure 3 This invention presents the phenotype of ShTIP1-overexpressing transgenic rice and the overexpression status of ShTIP1. Figure a shows the phenotype of ShTIP1-overexpressing transgenic rice in Example 3, with a scale bar of 10 cm. Figure b shows the expression status of ShTIP1 in the transgenic rice overexpressing ShTIP1 verified by semi-quantitative RT-PCR in Example 4, with OsACTIN as an internal reference. In ShTIP1-OE, #1, #2, and #3 represent three transgenic rice varieties overexpressing ShTIP1, and in WT-ZH11, #1, #2, and #3 represent three wild-type rice varieties ZH11.
[0029] Figure 4 The images show the leaf phenotypic characteristics of the ShTIP1 overexpressing transgenic sugarcane in Example 4 of this invention; where Figure a shows the leaf phenotypic of the ShTIP1 overexpressing transgenic sugarcane, with a scale bar of 2.5 cm; Figure b shows a cross-sectional slice of the sugarcane leaf, with a scale bar of 100 micrometers. Figure 4 In ShTIP1-OE, #1, #2, and #3 are three transgenic sugarcane plants that overexpress ShTIP1, while WT-XTT22 is a wild-type sugarcane plant, XTT22.
[0030] Figure 5 These are leaves and cross-sectional sections of rice plants with positive integration of the ShTIP1 gene in Example 4 of the present invention; wherein, Figure a shows the leaf phenotype of the rice plant with positive integration of the ShTIP1 gene, with a scale bar of 2.5 cm; Figure b shows a cross-sectional section of a rice leaf, with a scale bar of 100 micrometers. Figure 5 In the ShTIP1-OE, #1, #2, and #3 are three rice plants that are positive for the ShTIP1 gene integration, and WT-ZH11 is the wild-type rice ZH11.
[0031] Figure 6This refers to the distance between the leaf veins of sugarcane and rice in Example 4 of this invention; wherein, in XTT22, #1, #2, and #3 on the left are three wild-type sugarcane XTT22 plants, and #1, #2, and #3 on the right are three ShTIP1 transgenic sugarcane plants; in ZH11, #1, #2, and #3 on the left are three wild-type rice ZH11 plants, and #1, #2, and #3 on the right are three rice ShTIP1 gene-positive integrated plants; all different letters indicate that there are significant differences in one-way ANOVA using the T-test (P<0.05);
[0032] Figure 7 The values represent the number of leaf veins in sugarcane and rice. Specifically, in XTT22, #1, #2, and #3 on the left represent three wild-type sugarcane plants (XTT22), and #1, #2, and #3 on the right represent three ShTIP1 transgenic sugarcane plants. In ZH11, #1, #2, and #3 on the left represent three wild-type rice plants (ZH11), and #1, #2, and #3 on the right represent three rice plants with ShTIP1 gene-positive integration. All different letters indicate significant differences in a one-way ANOVA using a t-test (P < 0.05).
[0033] Figure 8 The values represent the number of interveinal epidermal cells in sugarcane and rice leaves. Specifically, in XTT22, #1, #2, and #3 on the left represent three wild-type sugarcane plants (XTT22), and #1, #2, and #3 on the right represent three ShTIP1 transgenic sugarcane plants. In ZH11, #1, #2, and #3 on the left represent three wild-type rice plants (ZH11), and #1, #2, and #3 on the right represent three rice plants with ShTIP1 gene-positive integration. All different letters indicate significant differences in a one-way ANOVA using a t-test (P < 0.05). Detailed Implementation
[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.
[0035] Plant materials: Sugarcane variety XTT22 and rice ZH11 were grown at the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences.
[0036] Example 1: Construction of ShTIP1 overexpression vector
[0037] 1) Cloning of the full-length sequence of the sugarcane ShTIP1 gene
[0038] The CDS sequence of ShTIP1 was obtained from the sugarcane XTT22 genome database (the sequence of the ShTIP1 gene is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2). Specific primers were designed for PCR amplification. Total DNA was extracted from young leaves of sugarcane XTT22 using the CTAB method and used as a template for PCR amplification of the full-length sequence of ShTIP1. The full-length amplification primers for ShTIP1 were: ShTIP1-F: 5'-ATGCCGATCAGCAGGAT-3', ShTIP1-R: 5'-TTAGTAGTCGGTGGTGG-3'. The PCR amplification system is as follows:
[0039] Table 1 PCR amplification system
[0040]
[0041] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; extension at 72℃ for 5 min. PCR amplification products were subjected to 1% agarose gel electrophoresis, gel excision and recovery, and sent to Sangon Biotech Co., Ltd. for sequencing verification.
[0042] 2) Construction of ShTIP1 overexpression vector
[0043] Following the same construction method as the GFP fusion expression vector, a 3×FLAG and nuclear localization NLS sequence were first added to the 5' end of the ORF sequence via PCR amplification, and a 3×His tag was added to the 3' end. BamHI and SacI restriction sites were added to both ends of the tagged ShTIP1 reading frame sequence, respectively. The reading frame sequence was then integrated into the pCAMBIA3300 plant expression vector containing the downstream of the Ubi promoter via restriction enzyme digestion and ligation. The primers for adding restriction sites were: ShTIP1-OE-F: 5'-GGGGATCCATGCCGATCAGCAGGATCGC-3', ShTIP1-OE-R: 5'-GGGAGCTCTTAGTAGTCGGTGGTGGGGA-3'. The PCR product with added restriction sites and the vector were double-digested, ligated, and transformed. Positive clones were sequenced to verify the inserted fragment. Double digestion was performed on the correctly sequenced ligated vector to verify successful construction of the pCAMBIA3300-ShTIP1 plant expression vector. Figure 1 This refers to a recombinant vector containing the ShTIP1 gene. The constructed vector plasmid was transformed into Agrobacterium strain EHA105 using the freeze-thaw method to obtain Agrobacterium carrying the pCAMBIA3300-ShTIP1 vector, which was then used for the next step of genetic transformation.
[0044] Example 2: Genetically transformed sugarcane with ShTIP1 overexpression
[0045] In this embodiment, tender shoot tips of sugarcane XTT22 were used as explants. Agrobacterium-mediated transformation was used to obtain transgenic sugarcane seedlings resistant to the ShTIP1-Flag fusion vector. The ShTIP1-Flag-positive resistant plants in the tissue culture bottles were acclimatized for one week by opening the caps, and then transplanted into crystal soil to adapt to the microbial growth environment. Once their root systems were stable, they were transplanted into seedling trays for further cultivation, resulting in PCR-positive transgenic sugarcane plants overexpressing ShTIP1. Figure 2 Figure a in the text is as follows:
[0046] 1) Selection and processing of sugarcane materials
[0047] (1) Sugarcane variety XTT22 was used as the genetic transformation recipient material. Healthy plants without disease or pests were selected, and the outer old leaves were removed layer by layer. Young leaves about 12cm away from the sugarcane stem tip growth point were selected as explants for inducing callus culture.
[0048] (2) Place the selected explants in 75% alcohol for 5-8 minutes, then place them in 0.1% mercuric chloride for 8-10 minutes. After disinfection, wash them 2-3 times with sterile ddH2O and blow them dry.
[0049] (3) Remove the outermost leaf sheath of the explant, then cut it into thin slices about 0.2-0.5 mm thick, place them on M1 solid medium, and culture them in the dark at 22℃ for 15-20 days. Change the medium and subculture until embryogenic callus grows. Select the most viable embryogenic callus as material for genetic transformation.
[0050] 2) Activation of Agrobacterium strains containing plant expression vectors
[0051] (1) Agrobacterium strain carrying the pCAMBIA3300-ShTIP1 vector was streaked in YEP solid medium containing 50 µg / mL rifampicin, 10 µg / mL streptomycin and 100 µg / mL kanamycin, and cultured upside down at 28 °C for 2 days. Single colonies were picked and inoculated into YEP liquid medium containing 50 µg / mL rifampicin, 10 µg / mL streptomycin and 100 µg / mL kanamycin, and cultured at 28 °C and 225 rpm for 12-16 h.
[0052] (2) Take the above bacterial culture and place it in 80 mL of YEP liquid medium containing 50 µg / mL rifampin, 10 µg / mL streptomycin and 100 µg / mL kanamycin. Incubate at 28 °C and 230 rpm until OD. 600 It reaches 0.4~0.6.
[0053] (3) Transfer the bacterial culture to a new sterile centrifuge tube, centrifuge at 4℃ and 4000rpm for 5min, discard the supernatant, aspirate the remaining culture medium, add 120mL of MR liquid medium (containing 150µmol / L of acetylsuccinone), resuspend the bacterial cells, and incubate at 28℃ and 200rpm for 2h to obtain Agrobacterium infection solution.
[0054] 3) Agrobacterium infection of sugarcane embryonic callus
[0055] (1) Select embryogenic callus with good growth from sugarcane callus, and transfer it to sterilized filter paper to dry.
[0056] (2) Transfer the above sugarcane embryonic callus into Agrobacterium infection solution and place for 30 min.
[0057] (3) Filter out the Agrobacterium infection solution and place the infected callus on sterile filter paper to dry.
[0058] (4) The dried infected callus tissue was placed on MS solid medium and incubated in the dark at 22°C for 5 days.
[0059] (5) After dark culture, the tissue was washed once in sterile water containing 200 mg / L carbenicillin (Car), then washed 2-4 times with sterile water without Car, and washed once with liquid MS. The tissue was then placed on sterile callus filter paper and dried with a strainer.
[0060] (6) After drying, place it on M2 solid medium containing 200 mg / L Carb and culture it in a constant temperature incubator at 28°C for about three weeks until the embryogenic callus tissue slowly differentiates into green seedlings.
[0061] 4) Screening Agrobacterium-transformed plants using PPT
[0062] The callus-differentiated seedlings were transferred to a selection medium containing PPT (i.e., MS medium with 2 mg / L 6-benzylaminopurine and 2.0 mg / L herbicide PPT, which is phosphatidylin) and cultured for about 20 days. During this process, the medium should be changed in a timely manner until the transformed seedlings are screened out.
[0063] 5) Rooting and hardening of resistant seedlings
[0064] The selected transgenic seedlings were transferred to M3 solid medium for rooting culture. After the seedlings had fully developed their roots, they were removed from the medium, cleaned, old leaves were removed, disinfected, and then transplanted into crystal soil. The seedlings were marked and hardened off for one week. After they grew well, they were planted in flower pots to obtain ShTIP1 overexpressing transgenic plants.
[0065] 6) PCR detection of the integration fragment in ShTIP1-overexpressing transgenic plants
[0066] When the seedlings planted in the plug trays have grown 3-4 leaves, take 0.1g of tender leaves and grind them into powder with liquid nitrogen. Extract the total DNA from the leaves using the CTAB method. Use the extracted DNA as a detection template and dilute it 10 times before use.
[0067] First, the integration of the herbicide-resistant bar gene into the transgenic plants was detected. Bar gene detection primers: Bar409-F: CGAGACAAGCACGGTCAACT; Bar409-R: CTGCCAGAAACCCACGTCAT. PCR detection primers for ShTIP1-overexpressing transgenic plants: ShTIP1-F: 5'-ATGCCGATCAGCAGGAT-3'; ShTIP1-R: 5'-TTAGTAGTCGGTGGTGG-3'. PCR reaction system:
[0068] Table 2 PCR reaction system
[0069]
[0070] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; extension at 72℃ for 5 min. PCR amplification products were subjected to 1% agarose gel electrophoresis, gel excision and recovery, and sent to Sangon Biotech Co., Ltd. for sequencing verification.
[0071] First, PCR detection of bar gene integration was performed on ShTIP1 overexpressing transgenic plants. Then, using DNA from successfully transformed plants with the Bar gene as templates, overexpression fragment integration detection was performed to determine the integrity of the integrated fragment region, thus obtaining PCR-positive ShTIP1 overexpressing transgenic sugarcane plants.
[0072] Example 3: Genetically transformed rice with ShTIP1 overexpression
[0073] To further verify the function of the ShTIP1 gene, we studied and obtained transgenic rice with ShTIP1 overexpression in the ZH11 background ( Figure 3 (Figure a in the text), specifically as follows:
[0074] 1) Culture of callus tissue
[0075] (1) Rice variety ZH11 was used as the genetic transformation recipient material. Full rice seeds were selected, the husks were removed, and blackened seeds were discarded.
[0076] (2) Soak the clean and intact seeds in 75% ethanol solution for 4-6 minutes for sterilization, then sterilize with 0.1% mercuric chloride for 15 minutes (can be done on a shaker), and finally rinse with sterile water 3-4 times.
[0077] (3) Place the rinsed seeds on sterile filter paper and let the water dry. Then place them in MS medium containing 1 mg / L abscisic acid (ABA) and culture in the dark for 12-15 days. Then place the seeds in MS+ABA medium containing 3 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and culture for 12-15 days to induce callus formation. Select high-quality callus for subculture.
[0078] 2) Cultivation of Agrobacterium tumefaciens in bacterial suspension
[0079] (1) Agrobacterium strain carrying the pCAMBIA3300-ShTIP1 vector was streaked in YEP solid medium containing 50 µg / mL rifampicin, 10 µg / mL streptomycin and 100 µg / mL kanamycin, and cultured upside down at 28 °C for 2 days. Single colonies were picked and inoculated into YEP liquid medium containing 50 µg / mL rifampicin, 10 µg / mL streptomycin and 100 µg / mL kanamycin, and cultured at 28 °C and 225 rpm for 12-16 h.
[0080] (2) Take the above bacterial culture and place it in 10 mL of YEP liquid medium containing 50 µg / mL rifampin, 10 µg / mL streptomycin and 100 µg / mL kanamycin. Incubate at 28 °C and 220 rpm until OD. 600 It reached 0.5.
[0081] (3) The bacterial culture was transferred to 100 mL of YEP liquid medium containing 50 µg / mL rifampin, 10 µg / mL streptomycin and 100 µg / mL kanamycin, and cultured at 28 °C and 220 rpm for 6-7 h with shaking until OD was reached. 600 It is approximately 0.5.
[0082] (4) Transfer the bacterial culture to a new sterile centrifuge tube, centrifuge at 4000 rpm for 5 min at 4℃, discard the supernatant, aspirate the remaining culture medium, add 120 mL of MR liquid medium (containing 90 µmol / L acetylsuccinone), resuspend the bacterial cells, and incubate at 28℃ and 200 rpm for 2 h to obtain Agrobacterium infection solution.
[0083] 3) Agrobacterium infects callus tissue and co-cultures it with callus tissue.
[0084] (1) Take out the embryogenic callus that has been subcultured for 12 days, put it into a sterilized culture dish, add the cultured Agrobacterium tumefaciens solution, and shake it continuously to ensure that the callus and Agrobacterium tumefaciens are in full contact and soak for 15 minutes.
[0085] (2) Remove the callus tissue and blot the surface moisture with sterile filter paper. Finally, inoculate the callus tissue into a solid co-culture medium (the solid co-culture medium is MS medium with 2 mg / L 2,4-dichlorophenoxyacetic acid, 0.6 g / L hydrolyzed casein, 0.6 g / L L-proline, 25 g / L sucrose and 5 g / L agar added, pH 5.5) and incubate in the dark at 28℃ for 3 days to obtain the co-cultured callus tissue.
[0086] 4) Screening of resistant callus and obtaining transgenic plants
[0087] The co-cultured callus tissue was placed in MS medium containing 150 mg / L carbenicillin for resistance screening, and then placed in differentiation medium (containing 300 mg / L hydrolyzed casein, 500 mg / L proline, 500 mg / L glutamine, 0.5 mg / L naphthaleneacetic acid, 2 mg / L 6-benzylaminopurine, 12 g / L agar powder, and 30 g / L sucrose) for differentiation culture. After the green shoots developed into seedlings 3 cm long, they were transferred to rooting medium for further culture. The rooting status of the seedlings was observed after 15-16 days. When the roots grew to about 2 cm, they were transplanted into flowerpots and cultured in a greenhouse to obtain ShTIP1 overexpressing transgenic rice plants.
[0088] Example 4: ShTIP1 overexpression and leaf phenotypic analysis
[0089] 1) Analysis of ShTIP1 gene expression level in sugarcane
[0090] Approximately 100 mg of fresh leaves from sugarcane and rice were taken and thoroughly ground into powder using liquid nitrogen. Total RNA was extracted using a plant total RNA extraction kit (Omega), and genomic DNA was digested using the kit's built-in DNase. The extracted RNA was then used to synthesize cDNA via reverse transcription using a Fermentas cDNA first-strand reverse transcription kit. The reaction system is as follows:
[0091] Table 3 Reaction System
[0092]
[0093] 65℃ for 5 minutes, then cool on ice.
[0094] Table 4 Reaction System
[0095]
[0096] The reaction was terminated at 42℃ for 60 min and 70℃ for 5 min. Store at -20℃ for later use.
[0097] ShTIP1 expression detection primers: ShTIP1-RT-F: 5'-CTGGGAGTGGGGATACCAGT-3'; ShTIP1-RT-R: 5'-AGCAGCTCGTAGATAACGCC-3'; Internal reference gene expression detection primers: GAPDH-F: 5'-CACGGCCACTGGAAGCA-3'; GAPDH-R: 5'-TCCTCAGGGTTCCTGATGCC-3'. qRT-PCR reaction system:
[0098] Table 5 qRT-PCR reaction system
[0099]
[0100] qRT-PCR amplification program: 95℃ for 3 min; 95℃ for 10 s, 58℃ for 30 s, 72℃ for 30 s; 40 cycles. After amplification, the ct values of the internal reference gene and the target gene were obtained separately. The method calculates the relative expression level of the target gene.
[0101] 2) Genetic transformation of sugarcane using the Ubi-ShTIP1-Flag overexpression vector
[0102] Three stable expression lines, ShTIP1#1, ShTIP1#2, and ShTIP1#3, were randomly selected from PCR-positive transgenic sugarcane plants overexpressing ShTIP1. The overexpression level of ShTIP1 was detected by quantitative qRT-PCR in step 1). The results are as follows: Figure 2 As shown in Figure b, ShTIP1 was successfully overexpressed in all three transgenic sugarcane strains.
[0103] 3) Genetic transformation of rice using ShTIP1 overexpression vector
[0104] When the ShTIP1-overexpressing transgenic rice seedlings in the seedling trays had produced a large number of leaves, three ShTIP1-overexpressing lines, ShTIP1#1, ShTIP1#2, and ShTIP1#3, were randomly selected. RNA was extracted from the tender leaves, and the expression of the ShTIP1 gene was detected using semi-quantitative RT-qPCR as described in step 1). The results are as follows: Figure 3 As shown in Figure b, all three lines are ShTIP1 gene-positive integration lines.
[0105] 4) ShTIP1 overexpression reduces sugarcane leaf size
[0106] The leaf width of three ShTIP1-overexpressing transgenic sugarcane was observed, with wild-type sugarcane XTT22 as a control. The results are as follows: Figure 4 As shown in Figure a, the leaf width of the ShTIP1-overexpressing transgenic sugarcane was significantly smaller than that of the wild-type sugarcane XTT22. To further investigate the effect of the ShTIP1 gene on sugarcane leaf growth, paraffin sections were prepared from cross-sections of wild-type sugarcane XTT22 and ShTIP1-overexpressing transgenic sugarcane leaves. The sectioning results are shown in Figure a. Figure 4 As shown in Figure b, the cross-sectional length of leaves from the ShTIP1-overexpressing transgenic sugarcane was significantly shorter than that of wild-type sugarcane XTT22. These results indicate that the ShTIP1 gene negatively regulates sugarcane leaf growth.
[0107] 5) ShTIP1 transgenic rice reduces leaf size
[0108] Three rice plants with positive ShTIP1 gene integration were observed, with wild-type rice ZH11 as a control. The results are as follows: Figure 5 As shown in Figure a, the leaf width of the rice plants with positive ShTIP1 gene integration was significantly smaller than that of wild-type rice ZH11. Further paraffin section cross-sections of leaves from both the rice plants with positive ShTIP1 gene integration and wild-type rice ZH11 were prepared, and the results are shown below. Figure 5 As shown in Figure b, the cross-sectional length of leaves in rice plants with positive ShTIP1 gene integration was significantly shorter than that in wild-type rice ZH11. These results indicate that the ShTIP1 gene negatively regulates rice leaf growth.
[0109] 6) Leaf phenotypic analysis of ShTIP1 transgenic plants
[0110] Given that the ShTIP1 gene regulates leaf growth in sugarcane and rice plants, this study further investigated the function of ShTIP1 in leaf growth of these two gramineous crops. The number of leaf veins, the number of interveinal epidermal cells, and the distance between leaf veins were statistically analyzed in wild-type and ShTIP1 transgenic plants, as detailed below:
[0111] 61) Counting the number of leaf veins in sugarcane and rice
[0112] (1) Select a healthy plant, cut the flag leaf from the leaf sheath, cut about 2cm from the middle of the leaf, gently scrape off the wax and hairs on the surface with a scalpel, and clean the leaf fragment with a brush dipped in water.
[0113] (2) Place the leaf fragment on a glass slide and place it under a low-power optical microscope (4x objective lens). The veins will appear as opaque dark lines.
[0114] (3) Starting from one edge of the field of view, use the microscope's sliding ruler or your hand to slowly move the slide and count the entries on the recording sheet one by one with the tip of a pen until you reach the other edge. Midribs must be counted.
[0115] (4) Repeat: Count the samples in three different fields of view (upper, middle and lower) of the same sample segment (but must be a continuous part of the middle section of the leaf) and take the average value.
[0116] 62) Counting the number of epidermal cells between leaf veins
[0117] (1) Select healthy plant leaves, cut the middle section of the leaves, and gently make a "well" shape in the area between the veins with a blade.
[0118] (2) Using tweezers and a dissecting needle, carefully peel the lower epidermis from the designated area. Try to keep the epidermal sheet intact.
[0119] (3) Place the torn epidermal flakes into a small petri dish, add an appropriate amount of chromic acid-nitric acid separation solution to the fume hood, and ensure that the epidermis is completely submerged. Separate at room temperature for about 2 hours until the epidermal flakes become slightly transparent and can be separated by light touch with tweezers.
[0120] (4) Discard the separation solution and rinse the epidermal sheet 5-6 times.
[0121] (5) Stain the separated epidermal slices with 1% safranin solution for 2 min and prepare glass slides.
[0122] (6) Place the prepared slide under an optical microscope. First, find well-dispersed cell areas under low magnification (10x). Then, observe under high magnification (40x) and randomly select multiple non-overlapping fields of view.
[0123] (7) Count all epidermal cells (long cells stained pink + stomatal complex) directly in each field of view. Count at least 5 fields of view.
[0124] 63) Measure the distance between leaf veins
[0125] (1) Select healthy plant leaves, cut off the middle section of the leaf (2cm), and clean the leaf fragment with a brush dipped in water.
[0126] (2) Use tweezers to tear off a small piece of the lower epidermis to make a glass slide.
[0127] (3) Place the prepared slide under an optical microscope, move the slide so that the graduations on the eyepiece micrometer are parallel to and aligned with the center lines of two adjacent leaf veins. Read the number of divisions (N) occupied on the eyepiece micrometer between the centers of the two leaf veins. Calculate the actual distance: interveinal distance (μm) = N divisions × actual length of each division on the eyepiece micrometer. Measure at least 10 different interveinal distances consecutively in each region and record all data.
[0128] The results showed that the distance between leaf veins in ShTIP1 transgenic sugarcane and ShTIP1 transgenic rice was significantly smaller than that in wild-type plants. Figure 6 Neither the ShTIP1 genetically modified sugarcane nor the ShTIP1 genetically modified rice showed any difference in the number of leaf veins or the number of interveinal epidermal cells compared to wild-type plants. Figure 7 and Figure 8 This indicates that ShTIP1 overexpression reduces the distance between leaf veins, thereby decreasing the leaf size of transgenic plants.
[0129] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An application of the ShTIP1 gene in reducing plant leaf size, characterized in that, The application involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to reduce plant leaf size; The sequence of the ShTIP1 gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The application involves transforming sugarcane or rice with a recombinant vector containing the ShTIP1 gene or a strain carrying the ShTIP1 gene, thereby overexpressing or over-expressing the ShTIP1 gene in the sugarcane or rice to reduce the size of the plant leaves.
3. The application according to claim 1 or 2, characterized in that, The application reduces leaf size by overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to decrease the distance between leaf veins.
4. The application according to claim 2, characterized in that, The recombinant vector containing the ShTIP1 gene is obtained by ligating the ShTIP1 gene into an overexpression vector.
5. The application according to claim 2, characterized in that, The strain carrying the ShTIP1 gene is Agrobacterium.
6. A method for reducing the size of plant leaves, characterized in that, The method involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to reduce plant leaf size. The sequence of the ShTIP1 gene is shown in SEQ ID NO:
1.
7. The method for reducing plant leaf size according to claim 6, characterized in that, The method involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to reduce the distance between leaf veins and thus decrease leaf size.
8. A method for breeding plants, characterized in that, The breeding method involves overexpressing or overexpressing the ShTIP1 gene in sugarcane or rice to obtain sugarcane or rice with reduced leaf size. The sequence of the ShTIP1 gene is shown in SEQ ID NO: 1.