Rice OsNAAT2 gene and application of rice OsNAAT2 gene in regulation and control of rice blast resistance of rice
By knocking out the rice OsNAAT2 gene and combining it with the chemical regulator Pip, the resistance of rice to rice blast was regulated using CRISPR/Cas9 technology, which solved the problem of low efficiency in existing technologies and achieved a significant enhancement of rice resistance to rice blast.
Patent Information
- Application Number
- CN202610033604.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-02-06
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In existing technologies, genetic engineering methods for rice resistance to rice blast are inefficient, the function of the OsNAAT2 gene in plant disease resistance regulation is unclear, and there is a lack of effective targeted improvement methods.
By knocking out the rice OsNAAT2 gene and combining it with the chemical regulator Pip, the resistance of rice to rice blast was regulated. An OsNAAT2 gene knockout vector was constructed using CRISPR/Cas9 technology to increase susceptibility to rice blast, and the expression of resistance-related genes OsPAL1, OsPR1a and OsNPR1 was detected.
It significantly improved the resistance of rice to rice blast. After spraying with rice blast fungus, the expression levels of OsPAL1, OsPR1a and OsNPR1 genes were upregulated in the OsNAAT2 gene knockout lines, which enhanced the rice's resistance to blast.
Smart Images

Figure CN121472316A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a rice gene OsNAAT2 and application thereof in regulating rice resistance to rice blast. BACKGROUND
[0002] Plant diseases are one of the important factors affecting the yield and quality of crops. Traditional disease-resistant breeding methods have long cycles and low efficiency, while genetic engineering technology provides an efficient approach for targeted improvement of plant disease resistance. Mining key genes related to plant disease resistance and analyzing their mechanisms are the core prerequisites for developing disease-resistant crop varieties. Rice genes such as Pi1, Pi2, Pi9, Pi54, Pigm and Piz-t have been confirmed to have resistance to rice blast, providing a good tool for rice disease-resistant breeding.
[0003] Fabiano et al. (2022) knocked out genes OsDjA 2 and OsERF 104 by CRISPR / Cas9, and the phenotype analysis of homozygous T1 mutant lines showed that not only the number of rice blast lesions was significantly reduced, but also the percentage of diseased leaf area was reduced, and the resistance to rice blast was significantly improved compared with the infected control plants. Li et al. constructed OCP gene knockout vectors using CRISPR / Cas9 genome editing technology, and transformed these vectors into callus by Agrobacterium-mediated transformation. Through screening, T0 offspring edited plants were obtained, and rice blast inoculation experiments showed that knockout of OCP enhanced the resistance of rice to rice blast.
[0004] Nicotinamide aminotransferase (NAAT) is a key enzyme in the nicotinamide biosynthesis pathway, and genes encoding NAAT enzymes have been characterized in grass monocotyledonous plants such as barley and rice. Two NAAT genes HvNAAT-A and HvNAAT-B in barley were cloned by enzyme purification from iron-deficient barley roots, and six rice NAAT genes (OsNAAT1-6) have been identified in rice. Under iron deficiency stress, the expression of OsNAAT 1 in roots and leaves was induced and up-regulated, and the transcript abundance of other OsNAAT genes (OsNAAT2, OsNAAT3, OsNAAT4, OsNAAT5 and OsNAAT6) showed no significant change in roots and leaves.
[0005] However, the function of OsNAAT2 gene in plant disease resistance regulation has not been clearly defined, and its synergistic effect with disease-resistant chemicals also needs to be explored. SUMMARY
[0006] The present application aims at the deficiencies of the prior art, and provides a method for regulating plant disease resistance based on OsNAAT2 gene, which realizes directional improvement of plant disease resistance by regulating expression of the gene and combining with chemical regulator Pip.
[0007] To achieve the above object, the technical scheme adopted by the present application is: application of rice OsNAAT2 gene (located on chromosome 2, accession number Os02g0302700) in regulating rice resistance to rice blast, and knocking out the OsNAAT2 gene increases the susceptibility of rice to rice blast.
[0008] In the implementation process of the present application, the OsNAAT2 gene knockout strain is sprayed with Magnaporthe grisea at the three-leaf-one-heart stage, and piperidine acid is sprayed after 10 hpi, and the expression amounts of resistance-related genes OsPAL1, OsPR1a and OsNPR1 are up-regulated.
[0009] Further, the nucleotide sequence of the OsNAAT2 gene is shown as SEQ ID No. 1, the CDS sequence of the OsNAAT2 gene is shown as SEQ ID No. 2, and the protein amino acid sequence encoded by the OsNAAT2 gene is shown as SEQ ID No. 3.
[0010] The second object of the present application is to provide a primer for amplifying the OsNAAT2 gene, and the primer sequence is as follows:
[0011] OsNAAT2-F: 5'-ATGCATTCGATCGCTTGGACACATCGTTTCGA-3';
[0012] OsNAAT2-R: 5'-AAAACAACCCGGCTTTCCATTGTATTGCACC-3.
[0013] The third object of the present application is to provide application of a knockout vector containing the OsNAAT2 gene in regulating rice resistance to rice blast.
[0014] The beneficial technical effects of the present application are: the present application knocks out the OsNAAT2 gene to increase the susceptibility of rice to rice blast, the OsNAAT2 gene knockout strain is sprayed with Magnaporthe grisea at the three-leaf-one-heart stage, and piperidine acid is sprayed after 10 hpi, and the expression amounts of resistance-related genes OsPAL1, OsPR1a and OsNPR1 are up-regulated, which further indicates that the gene OsNAAT2 can synergistically enhance the resistance of rice to rice blast with Pip. BRIEF DESCRIPTION OF DRAWINGS
[0015] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments or the prior art description will be briefly introduced. Obviously, the accompanying drawings described below are only some of the embodiments of the present application, and all other embodiments obtained by a person of ordinary skill in the art without any creative effort based on the embodiments in the present application shall fall within the protection scope of the present application.
[0016] Figure 1 is the disease investigation result of wild type (WT) and OsNAAT2 mutant plant in the embodiment 2 of the present application; A is the occurrence of rice blast after wild type (WT) and OsNAAT2 mutant plant (△Osnaat2 ko #2 and △Osnaat2 ko #21) are inoculated with Magnaporthe oryzae, and B is the disease index of the occurrence of rice blast.
[0017] Figure 2 is the expression result of the related resistance genes (OsPAL1, OsPR1a, OsNPR1 and OsCPK5) after wild type (WT) and OsNAAT2 mutant plant are infected with Magnaporthe oryzae in the embodiment 3 of the present application.
[0018] Figure 3 is the disease investigation result after wild type (WT) and OsNAAT2 mutant plant (△Osnaat2 ko #2 and △Osnaat2 ko #21) are inoculated with Magnaporthe oryzae combined with Pip application in the embodiment 4 of the present application; A is the occurrence of disease after OsNAAT2 mutant plant is inoculated combined with water or piperidine acid application, and B is the disease index of the occurrence of disease after OsNAAT2 mutant plant is inoculated combined with water or piperidine acid application.
[0019] Figure 4 is the expression result of the related resistance genes (OsPAL1, OsPR1a, OsNPR1 and OsCPK5) after wild type (WT) and OsNAAT2 mutant plant are inoculated with Magnaporthe oryzae combined with Pip application in the embodiment 4 of the present application. DETAILED DESCRIPTION
[0020] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, and all other embodiments obtained by a person of ordinary skill in the art without any creative effort based on the embodiments in the present application shall fall within the protection scope of the present application.
[0021] Embodiment 1: Obtaining of gene OsNAAT2 knockout strain
[0022] 1. Rice material and gene information
[0023] (1) Rice material: Lijiang Xintuanhegu (LTH) which is highly susceptible to rice variety as experimental material.
[0024] (2) Gene information: the nucleotide sequence length of gene OsNAAT2 (located in chromosome 2, accession number is Os02g0302700) is 4667 bp, as shown in SEQ ID No. 1, the length of coding region CDS is 1320 bp, the sequence is as shown in SEQ ID No. 2, the protein encoded by the sequence is 439 amino acids, and the sequence is as shown in SEQ ID No. 3.
[0025]
[0026]
[0027] SEQ ID No. 3: MEGVGGGKRRGDDGAEATPRWRFSRPSSQGGPLAAAGLTSIRAVLNRVNSSVDAAAAGGPRPVLRLGNGDPTASACYRTAPAAEDAVVDALRSGAHNGYSLTVGVLSARRAIAEYLSRDLPYELSANDIYLTSGCVQAIEVMISVLAQPGSNILLPKPGFPLYESRTTFSNLEVRHFDLIPERGWEVDLEGVQAIADENTVAIVVINPSNPCGSVYSYDHLAKIAETARKLGLLIIADEVYDHLAFGNNPFIPIGVFGKTVPVITLGSISKRWLVPGWRLGWIATCDPNGILKEAKVNQSIENYINISTDPATFVQGAIPQIIANTKEDYFNKILDQLRNAADLCYDKIKDIKGITCPHKPEGSMFVMVKLDLSYLDGFHDDMDFCCRLAKEESVIVLPGSALGLKNWVRITFAIDIPSLVDAFERIKSFCQRHGKLET
[0028] (3) Design primers OsNAAT2-F and OsNAAT2-R according to the full-length sequence SEQ ID No. 1 of OsNAAT2, and the primer sequences are as follows:
[0029] OsNAAT2-F: 5'-ATGCATTCGATCGCTTGGACACATCGTTTCGA-3' (SEQ ID No. 4);
[0030] OsNAAT2-R: 5'-AAAACAACCCGGCTTTCCATTGTATTGCACC-3' (SEQ ID No. 5);
[0031] The protection base CAGT and enzyme cutting site GCTCTC are added at the front end when the primer is synthesized.
[0032] (4) Cloning of OsNAAT2 gene
[0033] PCR amplification system: total volume 50 μL, including 25 μL Biorun Pfu PCR Mix, 2 μL of OsNAAT2-F / R primers respectively, 1 μL of cDNA template, 20 μL Nuclease-free Water.
[0034] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 12 s, 33 cycles, 72℃ final extension for 10 min, 16℃ for 30 min. PCR products were electrophoresed on a 1.5% agarose gel at 5 V / cm for 20 min. The electrophoretic fragments were excised and recovered from the gel, and ligated into the TA vector using enzyme digestion and ligation. Single clones were selected for colony PCR, followed by sequencing to obtain the correct TA-recombinant plasmid. The correct recombinant plasmid was digested with BasI / Eco31I, and the digested fragments were recovered and ligated into the k1-TV-Ng vector to obtain the recombinant plasmid k1-TV-OsNAAT2-Ng. The recombinant plasmid was transformed into Agrobacterium tumefaciens EHA105 and sent to a transgenic company for genetic transformation.
[0035] 2. Construction of OsNAAT2 gene knockout mutant
[0036] Using CRISPR / Cas9 gene editing technology, a gene knockout vector pYL-HU-U3-CCDB-tRNA(K1) was constructed targeting the OsNAAT2 gene (sgRNA1: TTCGATCGCTTGGACACATCCGG (SEQ ID No. 6); sgRNA2: ATACAATGGAAAGCCGGGTTTGG (SEQ ID No. 7)). This vector was then transformed into LTH using Agrobacterium-mediated transformation, and homozygous mutants were verified by Sanger sequencing to obtain gene knockout lines such as △Osnaat2 ko #2 and △Osnaat2 ko #21. The △Osnaat2 ko #2 mutant exhibited base deletions in the OsNAAT2 gene, while the △Osnaat2 ko #21 mutant showed both base deletions and insertions. These mutations all resulted in OsNAAT2 gene reading frame shifts, with the stop codon appearing earlier or later than expected, ultimately leading to the loss of OsNAAT2 gene function.
[0037] Example 2 Disease Resistance Detection Experiment
[0038] Wild-type (WT) and OsNAAT2 knockout plants were inoculated with pathogens. OsNAAT2 knockout lines #2 and #21 were selected for blast fungus spray inoculation. Rice seedlings at the three-leaf stage (approximately 14 days old) were inoculated with blast fungus, with a spore suspension concentration of 1×10⁻⁶. 5The spore suspension was uniformly sprayed on the rice, and samples were taken at 0 hpi, 24 hpi, 36 hpi, 48 hpi, 72 hpi and 96 hpi, and the expression of resistance-related genes was analyzed. Disease investigation was carried out at 168 hpi after inoculation. The investigation and disease index statistics refer to Xu Zhigang (2002), and the disease index is calculated as 100 x ∑ (number of leaves at each level x representative value at each level) / (total number of leaves surveyed x highest representative value).
[0039] The results are shown in Figure 1 Compared with wild type rice (WT), the rice blast symptoms of OsNAAT2 gene knockout lines #2 and #21 were more severe, and the disease index was higher.
[0040] Example 3: Analysis of expression of resistance-related genes
[0041] 1. The total RNA of rice was extracted by using GenStar (Beijing Kangrunchengrun Biological Technology Co., Ltd.) kit, and the extraction method was operated according to the instructions of the kit. The RNA was reverse transcribed into cDNA, as shown in Table 1:
[0042] Table 1: cDNA reverse transcription system
[0043]
[0044] According to the above table, the total system except RNA was prepared and divided into PCR tubes. Then the RNA was added one by one, mixed gently, incubated at 50℃ for 5 min, and heated at 85℃ for 2 min.
[0045] 2. Real-time fluorescent quantitative PCR detection of the expression of defense-related genes
[0046] The defense-related genes (Ubiqutin, OsNPR1, OsPR1a, OsPAL1 and OsCPK5) were selected, and the primers were designed according to the principles of primer design, and the sequences are shown in Table 2:
[0047] Table 2: Information of fluorescent quantitative primers
[0048]
[0049] According to the preparation of PCR 20.0 μL qRT-PCR reaction system as shown in Table 3:
[0050] Table 3: qRT-PCR reaction system
[0051]
[0052] The system is prepared according to the above table, gently mixed and then divided into 96-well PCR plates, 18 μL per well, finally 2 μL of cDNA is added, centrifuged at 1500 rpm for 1 min, then taken out and subjected to qRT-PCR in a CFX96 quantitative PCR instrument, two-step amplification is adopted, 40 cycles, the reaction program of qRT-PCR is as shown in Table 4:
[0053] Table 4 qRT-PCR reaction program
[0054]
[0055] Data analysis: the expression levels of the above genes are calculated and analyzed by 2 -△△Ct Method. The data is processed by IBM SPSS Modeler 27.0 and plotted by Origin 2021.
[0056] As Figure 2 shown, the relative expression levels of disease resistance genes (Ubiqutin, OsNPR1, OsPR1a, OsPAL1) of OsNAAT2 mutant plants (△Osnaat2 ko #2 and △Osnaat2 ko #21) are lower than those of wild type (WT).
[0057] Example 4 Statistical analysis of rice blast symptoms of OsNAAT2 gene knockout rice treated with chemical regulator Pip
[0058] 1. Disease investigation
[0059] Wild type (WT) and OsNAAT2 gene knockout rice (#2 and #21) treated with Pip 10 hpi after inoculation with Magnaporthe oryzae. The inoculation method is as described in 3.1, the Pip concentration used is 10 μmol / L, and the difference in disease resistance is evaluated by observing the plant disease phenotype (symptom map and disease index) at 168 hpi after inoculation.
[0060] The results are shown in Figure 3 As compared with the inoculation only (+ water) treatment (CK), spraying Pip after inoculation (10 hpi) reduces the severity of the disease and the disease index. The disease severity of OsNAAT2 gene knockout rice is reduced after spraying Pip.
[0061] 2. Detection of defense-related gene expression in rice after exogenous Pip treatment
[0062] Sampling at 10 hpi, 24 hpi, 36 hpi, 48 hpi, 72 hpi, and 96 hpi, and analyzing the expression of resistance-related genes, as described in 3.2.
[0063] The results are shown inFigure 4 As shown, compared with water treatment after inoculation with Magnaporthe 10 hpi, spraying Pip after inoculation 10 hpi mediates the up-regulated expression of resistance-related genes OsPAL1, OsPR1a and OsNPR1 in OsNAAT2 gene mutant rice (#2 and #21), while the resistance-related gene OsCPK5 has the same trend in water and Pip treatment after inoculation.
[0064] Finally, it should be noted that: the above examples are only used to illustrate and not limit the technical solutions of the present application, although the present application is described in detail with reference to the above examples, those skilled in the art should understand: the present application can still be modified or equivalent replaced, without departing from the spirit and scope of the present application, any modification or partial replacement, which should be covered in the scope of claims of the present application.
Claims
1. The application of the rice OsNAAT2 gene in regulating rice blast resistance, characterized in that, Knocking out the OsNAAT2 gene increases susceptibility to rice blast disease.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the OsNAAT2 gene is shown in SEQ ID No. 1, the CDS sequence of the OsNAAT2 gene is shown in SEQ ID No. 2, and the amino acid sequence of the protein encoded by the OsNAAT2 gene is shown in SEQ ID No.
3.
3. Primers for amplifying the OsNAAT2 gene as described in claim 1, characterized in that, The primer sequences are as follows: OsNAAT2-F: 5'-ATGCATTCGATCGCTTGGACACATCGTTTCGA-3'; OsNAAT2-R: 5'-AAAACAACCCGGCTTTCCATTGTATTGCACC-3.
4. The application of the knockout vector containing the OsNAAT2 gene as described in claim 1 in regulating rice blast resistance.
Citation Information
Patent Citations
Application of L-piperidine acid as disease-resistant activator in improving rice blast resistance of rice
CN120615566A
Full-length plant cDNA and uses thereof
US20060123505A1