Stable genetic transformation method of floating moss

Abstract

The invention discloses a stable genetic transformation method of floating moss. The genetic transformation method comprises the following steps: (1) crushing thallus tissues of the floating moss, (2) pre-culturing explants, (3) infecting and co-culturing, (4) screening and culturing for the first time, (5) screening and culturing for the second time, (6) enlarging and culturing, and (7) verifying transformation. According to the genetic transformation method, a thallus of floating moss is taken as a starting explant, an agrobacterium-mediated hygromycin and kanamycin screening transformation system of the floating moss is established for the first time, the blank of a floating moss genetic transformation system is filled, and experimental results show that after multi-generation culture, a transformed plant can still stably express a target gene. The method has the advantages of high transformation efficiency and simplicity in operation, and can be used for subsequent genetic transformation research of unknown floating moss genes. The method has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of genetic transformation technology, specifically relating to a stable genetic transformation method for algae. Background Technology

[0002] Plant genetic transformation utilizes molecular or cell biology methods to introduce exogenous DNA into plant cells, tissues, or organs, resulting in predictable and targeted genetic changes. The transferred exogenous gene is called a "transgenic gene," and the organism that develops after successful gene transfer is called a transgenic plant. This technology not only provides an effective tool for analyzing gene function but also offers molecular breeding strategies for crop improvement, significantly enhancing various agronomic traits, including but not limited to disease resistance, salt tolerance, and lodging resistance. Simultaneously, this technology has opened new avenues for studying the regulatory mechanisms of plant secondary metabolic pathways. Choosing a suitable transformation method is crucial for genetic transformation; Agrobacterium-mediated transformation is the most widely used method.

[0003] *Ricciocarpos natans*, the only species in the genus *Ricciocarpos*, belongs to the family Ricciaceae within the order Marchantiales. It is characterized by its global distribution and its complex hermaphroditic thallus structure. Previous studies have established a tissue culture system for *Ricciocarpos natans*, and its genome has been successfully sequenced and assembled. The establishment of this culture system ensures continued observation of *Ricciocarpos natans*, while the successful genome sequencing advances the research into its molecular mechanisms.

[0004] The genetic transformation system for algae is still lacking. The establishment of such a system and the acquisition of transgenic materials are of great significance for the research and application of algae cell and molecular biology. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a stable genetic transformation method for moss, filling the gap in the genetic transformation system of moss.

[0006] This invention utilizes an Agrobacterium-mediated genetic transformation method, employing homogenized young thallus plants of *Lycopodium clavatum* as explants, to successfully construct a stable genetic transformation method. This method boasts high transformation efficiency and a short transformation cycle, requiring only 7-8 weeks for the entire process. The establishment of this method provides technical support for in-depth research on *Lycopodium clavatum* in the fields of cell biology and molecular biology, and lays a methodological foundation for deciphering gene sequences with unknown functions in the *Lycopodium clavatum* genome. Through this technological platform, further research can be conducted on the functional verification and molecular regulatory mechanisms of *Lycopodium clavatum* genes, thereby promoting the in-depth development of *Lycopodium clavatum* biological research.

[0007] This invention provides a stable genetic transformation method for algae, specifically, the method includes the following steps:

[0008] 1. Pulverization of floating moss foliules: In a clean bench, sterile floating moss foliules are homogenized and pulverized into floating moss foliule fragments.

[0009] 2. Explant pre-culture: The floating moss thallus fragments described in the first step are inoculated on a pre-culture medium and pre-cultured under constant temperature and light conditions.

[0010] 3. Infection and co-culture: The pre-cultured moss thallus fragments from the second step are immersed in Agrobacterium infection solution containing the transformation vector, which contains acetylsuccinone, etc. After infection, the thallus fragments are filtered out by a cell filter and placed in a co-culture medium for dark culture to obtain co-cultured moss thallus fragments.

[0011] 4. First screening culture: The co-cultured floating moss thallus fragments described in step 3 are transferred to a screening medium containing antibiotics and cultured under constant temperature and light conditions.

[0012] 5. Second screening culture: The newly grown green tissue on the screening medium of the first screening culture in step 4 is transferred to a new screening medium containing antibiotics for a second screening. The culture is continued under constant temperature and light conditions to obtain resistant seedlings.

[0013] 6. Expanded culture: The resistant seedlings obtained in step 5 are transferred to a propagation medium and further expanded cultured under constant temperature and light conditions.

[0014] 7. Transformation identification: Further identify the transgenic positive plants obtained after the expanded culture in step 6.

[0015] In step 1, the specific method for pulverizing the floating moss thallus is as follows: Floating moss thallus cultured under constant temperature and light conditions for 4-5 weeks (approximately 1 month) is selected, and mechanical homogenization is used to break it into fragments. Further, homogenization is performed at 24000 rpm for approximately 15 seconds using a homogenizer to uniformly fragment the floating moss thallus. The pulverized floating moss thallus fragments are then filtered using a 100 μm cell filter. The culture medium is 1 / 2 B5 medium, composed of: 1.605 g / L B5 medium powder (Phytotechlab), 10 g / L sucrose, and 10 g / L agar, adjusted to pH 5.7. The constant temperature and light conditions are: 22°C, a photoperiod of 16 hours of light / 8 hours of darkness, and a light intensity of 800 lux.

[0016] In step 2, the pre-culture medium is 1 / 2 B5 medium, which consists of: 1.605 g / L B5 medium powder (Phytotechlab), 10 g / L sucrose, 10 g / L agar, etc., and the pH is adjusted to 5.7.

[0017] In step 2, the pre-culture time is 1-7 days; preferably, it is 5 days.

[0018] In step 2, the constant temperature and light cultivation conditions are 22℃ constant temperature, photocycle of 16h light / 8h darkness, and light intensity of 800 lux.

[0019] In step 2, the purpose of pre-culturing the tissue fragments prepared in step 1 is to restore their physiological activity.

[0020] In step 3, the infecting Agrobacterium strain includes GV3101, EHA105, etc.; preferably, it is EHA105.

[0021] In step 3, the OD of the Agrobacterium infection solution 600 The value is 0.5-2.1, preferably 1.8.

[0022] In step 3, the composition of the Agrobacterium infection solution is: Agrobacterium, MS medium powder (Phytotechlab) 2.215 g / L, sucrose 30 g / L, acetylsuccinone 100 μM, etc., and the pH is adjusted to 5.2.

[0023] In step 3, the co-culture medium consists of: MS medium powder (Phytotechlab) 2.215 g / L, sucrose 30 g / L, acetylsuccinone 100 μM, agar 10 g / L, etc., and the pH is adjusted to 5.7.

[0024] Step 3 also includes using Agrobacterium without the transformation vector as a negative control.

[0025] In step 3, the infection of Agrobacterium is carried out in a shaker at 25°C and 110 rpm (light intensity is the natural light intensity in the environment).

[0026] In step 3, the infection time is 2 hours.

[0027] In step 3, the co-culture is carried out in a completely dark incubator at 22°C.

[0028] In step 3, the dark culture time is 3 days.

[0029] Step 3 also includes using Agrobacterium without the transformation vector as a negative control.

[0030] In step 3, in a preferred embodiment, the transformation vector is a recombinant overexpression vector pUBQ10::RnH2B-GFP, wherein the nucleotide sequence of the RnH2B coding sequence is shown in SEQ ID NO:1.

[0031] SEQ ID NO:1

[0032] ATGGCGCCCAAGGCAGCAGTCGACGCTGAGAACAAGGCCGGGAAGGGGAAGGGAGAGAAGAAGCCCCGAGGAAGACCGAAGGCCGAGAAGAAGCCGGCGAAGGAAGGAGGTGCGAAGGAAGGATCGACGAAGAAGAAGAAGGCCAAGAGGAATCGAGACCTACAAGATCTACATTTACAAGGTGTTGAAACAAGTTCATCCCGAGTTTGGA ATTTCGTCTAAGGCGATGGGAATTATGAACTCGTTCATAAACGACATTTTCGAGAAACTAGCGCAAGAGGCCGCGAGACTGGCTCGGTACAACAAGAAACCCACGATCGCTTCGAGAGATCCAAACGGCAGTGAGGCTAATTCTGCCTGGCGAGCTTGCCAAGCATGCTGTTTCTGAAGGAACCAAAGCAGTGACGAAATTCACAAGCGCT

[0033] In step 4, the screening medium consists of: 1.605 g / L Phytotechlab B5 medium powder, 10 g / L sucrose, 10 g / L agar, 100 μg / mL cefotaxime sodium, 10 μg / mL hygromycin, etc.; or the screening medium consists of: 1.605 g / L Phytotechlab B5 medium powder, 10 g / L sucrose, 10 g / L agar, 100 μg / mL cefotaxime sodium, 50 μg / mL kanamycin, etc.

[0034] In step 4, the purpose of cefotaxime sodium is to remove Agrobacterium.

[0035] In step 4, the screening medium is specifically selected based on the resistance gene of the vector.

[0036] In step 4, the constant temperature and light cultivation conditions are 22℃ constant temperature, 16h light / 8h dark photoperiod, and 800 lux light intensity, etc.

[0037] In step 4, the culture time is 3-4 weeks.

[0038] In step 5, the screening medium consists of: 1.605 g / L of B5 medium powder (Phytotechlab), 10 g / L of sucrose, 10 g / L of agar, 10 μg / mL of hygromycin, etc.; or, the screening medium consists of: 1.605 g / L of B5 medium powder (Phytotechlab), 10 g / L of sucrose, 10 g / L of agar, 50 μg / mL of kanamycin, etc.

[0039] In step 5, the screening medium is specifically selected based on the resistance gene of the vector.

[0040] In step 5, the constant temperature and light cultivation conditions are 22℃ constant temperature, photocycle of 16h light / 8h darkness, and light intensity of 800 lux, etc.

[0041] In step 5, the continuous culture period is 3-4 weeks.

[0042] In step 6, the propagation culture medium is the same as the pre-culture medium in step 2.

[0043] In step 6, the culture conditions of the constant temperature and light incubator are constant temperature of 22℃, photocycle of 16h light / 8h darkness, and light intensity of 800 lux.

[0044] In step 6, the expansion culture time is 4-12 weeks.

[0045] In step 7, the identification method includes one or more of the following: PCR, fluorescence observation, Western blot, etc.

[0046] In the described method, after the first screening culture, small, dark green thallus tissues are clearly visible on the screening plate. Upon magnification, numerous rhizoids are observed on the thallus tissues. The presence of rhizoids on the tissue fragments is considered a reliable indicator of successful transformation.

[0047] In the method, the transformed tissues of plants that survive and regenerate after the first screening culture are subjected to a second round of antibiotic selection to ensure that false positives are eliminated. After the second screening culture is completed, they can be transferred to a normal culture medium for rapid propagation.

[0048] In a preferred embodiment of the present invention, the method specifically includes the following steps:

[0049] 1. Construction of genetic transformation expression vectors

[0050] The UBQ10 promoter of Arabidopsis thaliana and the H2B coding sequence of Flourishing Moss were cloned and constructed into the pCambia1300 backbone through homologous recombination to construct the recombinant overexpression vector pUBQ10::RnH2B-GFP, wherein the nucleotide sequence of the RnH2B coding sequence is shown in SEQ ID NO:1.

[0051] 2. Agrobacterium-mediated transformation

[0052] Take EHA105 Agrobacterium competent cells stored at -80℃, thaw them on ice, and briefly centrifuge to allow the competent cells attached to the EP tube wall to settle to the bottom. Under aseptic conditions, add 3 μL of pUBQ10::RnH2B-GFP plasmid to the competent cell suspension, gently pipette to mix, and incubate on ice for 5 min. Quickly freeze the centrifuge tube in liquid nitrogen for 5 min. Immediately place the centrifuge tube in a 37℃ water bath for 5 min. Add 200 μL of antibiotic-free LB broth in a clean bench and incubate at 28℃ with shaking for 2-4 h to allow the cells to recover and express resistance. Spread the culture onto LB solid medium containing the appropriate antibiotic and incubate upside down at 28℃ for 2 days. Pick single colonies from the plates for PCR identification; positive colonies are then used for plant transformation.

[0053] The LB liquid culture medium consists of 25 g / L LB powder, with the pH adjusted to 7.0.

[0054] The LB solid culture medium consists of 25 g / L LB powder, 10 g / L agar, and pH adjusted to 7.0.

[0055] 3. Specific steps of genetic transformation

[0056] (1) After the floating moss thallus was cultured in a constant temperature and light incubator for 30 days in 1 / 2 B5 solid medium, it was broken into fragments by mechanical homogenization. Specifically, about 0.5g of floating moss thallus and 10mL of sterile water were added to a 15mL conical centrifuge tube and homogenized at 24000rpm for about 15s to make the floating moss uniformly fragmented. The fragmented floating moss thallus was filtered through a 100μm cell filter.

[0057] (2) These floating moss thallus fragments were evenly distributed on the surface of 1 / 2B5 solid culture medium and pre-cultured in a constant temperature and light incubator for 5 days to restore their physiological activity.

[0058] (3) Five days later, Agrobacterium EHA105 strain containing pCambia1300 plasmid (the transformed Agrobacterium obtained in step 2) and Agrobacterium without transformation vector were used as negative controls to infect the pre-cultured floating moss thallus fragments in Agrobacterium infection solution and were shaken on a shaker at 25°C for 2 hours.

[0059] (4) Remove the thallus fragments of floating moss, transfer them to a co-culture medium, and co-culture them with recombinant Agrobacterium at 22°C in the dark for 3 days.

[0060] (5) The thallus fragments of the floating moss were spread evenly on a solid screening medium and subjected to the first screening in a constant temperature and light incubator. After the first screening, small pieces of dark green thallus tissue were clearly visible on the screening plate. Upon magnification, many rhizoids were observed on the thallus fragments. The presence of rhizoids on the thallus fragments was considered a reliable indicator of successful transformation.

[0061] (6) After 3-4 weeks, the surviving and regenerated transformed tissues were transferred to a secondary solid screening medium and screened for the second time in a constant temperature and light incubator to ensure that false positives were eliminated. After the second screening, the tissues were transferred to 1 / 2 B5 medium for rapid propagation in a constant temperature and light incubator.

[0062] The culture conditions of the constant temperature and light incubator are as follows: constant temperature of 22℃, photocycle of 16h light / 8h darkness, and light intensity of 800 lux.

[0063] 3. Identification of transgenic plants

[0064] Transgenic *Leptochloa crus-galli* plants were identified by PCR, Western blotting, and fluorescence observation to verify that the exogenous gene was successfully integrated into the *Leptochloa crus-galli* genome and was stably expressed.

[0065] The present invention also provides a method for preparing genetically transformed floating moss plants, wherein the method obtains genetically transformed floating moss plants through the stable genetic transformation method of floating moss as described above.

[0066] The present invention also provides a genetically transformed floating moss plant prepared according to the genetic transformation method described above.

[0067] The present invention also provides the application of the method described above, or the genetically transformed moss plants described above, in the genetic transformation of moss, improving the stability of genetic transformation of moss, improving the efficiency of genetic transformation of moss, research on moss cells, molecular biology research, etc.

[0068] Beneficial effects compared to existing technologies: The stable genetic transformation method for algae established in this invention fills a gap in the genetic transformation system of algae. This invention optimizes the treatment methods and culture conditions during the transformation process through experiments, using hygromycin and kanamycin as screening agents to obtain transgenic positive lines, successfully establishing a stable Agrobacterium-mediated genetic transformation system for algae. The genetic transformation method of this invention has high transformation efficiency and a short transformation cycle, requiring only 7-8 weeks for the entire process. Attached Figure Description

[0069] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0070] Figure 1 This is a schematic diagram of the genetic transformation of *Lycopodium clavatum*. (1A-1C) After homogenization, *Lycopodium clavatum* grown for 1 month was transferred to a growth medium and pre-cultured for 5 days; (2-3B) *Agrobacterium* was used to infect the pre-cultured thallus fragments for 2 hours; (4A-4B) The thallus fragments and *Agrobacterium* were co-cultured in the dark for 3 days; (4C) The co-cultured thallus fragments were transferred to a resistance selection medium for the first screening; (5) After 3 weeks, thallus fragments that maintained green growth were selected and transferred to a new resistance selection medium for a second screening to eliminate false positives; (6) After 3 weeks, complete transformed plants with dichotomous branches were visible; (7) The plants after the second screening were transferred to a normal culture medium for propagation.

[0071] Figure 2 Fluorescence patterns of subcellular localization lines. (A) Expression of GFP protein. Immunoblot analysis was performed on the expressed protein using an anti-GFP antibody. The large Rubisco subunit stained with Ponceau S was used as a control for loading. (B) Fluorescence observation on thallus and scales of transgenic plants. Detailed Implementation

[0072] The present invention will be further described in detail below with reference to the specific embodiments and accompanying drawings. Except for the contents specifically mentioned below, the processes, conditions, and experimental methods for implementing the present invention are all common knowledge and general knowledge in the art, and the present invention does not have any particular limitations.

[0073] The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the invention or its application or use. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0074] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may have different values.

[0075] This invention discloses a stable genetic transformation method for *Ricciocarpos natans*. The transformation method includes the following steps: (1) fragmentation of *Ricciocarpos natans* thallus tissue, (2) explant pre-culture, (3) infection and co-culture, (4) first screening culture, (5) second screening culture, (6) expansion culture, and (7) transformation verification. This method uses *Ricciocarpos natans* thallus as the starting explant and establishes for the first time an Agrobacterium-mediated screening and transformation system for *Ricciocarpos natans* using hygromycin and kanamycin, filling a gap in the genetic transformation system of *Ricciocarpos natans*. The verification results show that after multiple generations of culture, the transformed plants can still stably express the target gene. This invention has the advantages of high transformation efficiency and simple operation, and can be used for subsequent genetic transformation research on unknown genes in *Ricciocarpos natans*.

[0076] Unless otherwise specified, the experimental materials used in the examples are all conventional biochemical reagents.

[0077] Example 1

[0078] 1. Construction of genetic transformation expression vectors

[0079] The UBQ10 promoter of Arabidopsis thaliana and the H2B coding sequence of Flourishing Moss were cloned and constructed into the pCambia1300 backbone through homologous recombination to construct the recombinant overexpression vector pUBQ10::RnH2B-GFP. The nucleotide sequence of the RnH2B coding sequence is shown in SEQ ID NO:1.

[0080] SEQ ID NO:1

[0081] ATGGCGCCCAAGGCAGCAGTCGACGCTGAGAACAAGGCCGGGAAGGGGAAGGGAGAGAAGAAGCCCCGAGGAAGACCGAAGGCCGAGAAGAAGCCGGCGAAGGAAGGAGGTGCGAAGGAAGGATCGACGAAGAAGAAGAAGGCCAAGAGGAATCGAGACCTACAAGATCTACATTTACAAGGTGTTGAAACAAGTTCATCCCGAGTTTGGA ATTTCGTCTAAGGCGATGGGAATTATGAACTCGTTCATAAACGACATTTTCGAGAAACTAGCGCAAGAGGCCGCGAGACTGGCTCGGTACAACAAGAAACCCACGATCGCTTCGAGAGATCCAAACGGCAGTGAGGCTAATTCTGCCTGGCGAGCTTGCCAAGCATGCTGTTTCTGAAGGAACCAAAGCAGTGACGAAATTCACAAGCGCT

[0082] 2. Agrobacterium-mediated transformation

[0083] Take EHA105 Agrobacterium competent cells stored at -80℃, thaw them on ice, and briefly centrifuge to allow the competent cells attached to the EP tube wall to settle to the bottom. Under aseptic conditions, add 3 μL of pUBQ10::RnH2B-GFP plasmid to the competent cell suspension, gently pipette to mix, and incubate on ice for 5 min. Quickly freeze the centrifuge tube in liquid nitrogen for 5 min. Immediately place the centrifuge tube in a 37℃ water bath for 5 min. Add 200 μL of antibiotic-free LB liquid medium to a clean bench and incubate at 28℃ with shaking for 2-4 h to allow the cells to recover and express resistance. Spread the culture onto LB solid medium containing the appropriate antibiotic and incubate upside down in a 28℃ incubator for 2 days. Single colonies were picked from the plate for PCR identification (the primers used were HygR-F: CTATTTCTTTGCCCTCGG (SEQ ID NO:2); HygR-R: TCCGGAAGTGCTTGACATTG (SEQ ID NO:3)). Once the identification was positive, the colonies could be used to transform plants.

[0084] The LB liquid culture medium consists of 25 g / L LB powder, with the pH adjusted to 7.0.

[0085] The LB solid culture medium consists of 25 g / L LB powder, 10 g / L agar, and pH adjusted to 7.0.

[0086] 3. Specific steps of genetic transformation ( Figure 1 (As shown)

[0087] (1) After the floating moss thallus was cultured in a constant temperature and light incubator for 30 days in 1 / 2 B5 solid medium, it was broken into fragments by mechanical homogenization. Specifically, about 0.5g of floating moss thallus and 10mL of sterile water were added to a 15mL conical centrifuge tube and homogenized at 24000rpm for about 15s to make the floating moss uniformly fragmented. The fragmented floating moss thallus was filtered through a 100μm cell filter.

[0088] The composition of 1 / 2 B5 solid culture medium is: 1.605 g / L B5 culture medium powder (Phytotechlab), 10 g / L sucrose, 10 g / L agar, and the pH is adjusted to 5.7.

[0089] The culture conditions of the constant temperature and light incubator are a constant temperature of 22℃, a photocycle of 16h light / 8h darkness, and a light intensity of 800 lux.

[0090] (2) These floating moss thallus fragments were evenly distributed on the surface of 1 / 2B5 solid culture medium and pre-cultured in a constant temperature and light incubator for 5 days to restore their physiological activity.

[0091] The composition of the 1 / 2B5 solid culture medium is the same as that of the 1 / 2B5 solid culture medium in step (1).

[0092] The culture conditions of the constant temperature and light incubator are a constant temperature of 22℃, a photocycle of 16h light / 8h darkness, and a light intensity of 800 lux.

[0093] (3) After 5 days of pre-culture, Agrobacterium EHA105 strain containing pCambia1300 plasmid (the transformed Agrobacterium obtained in step 2) and Agrobacterium without transformation vector were used as negative controls to infect the thallus fragments after 5 days of pre-culture in Agrobacterium infection solution. The fragments were then shaken for 2 hours at 25°C, 110 rpm and light intensity equal to the natural light intensity of the environment.

[0094] The components of the Agrobacterium infection solution were: Agrobacterium strain, MS medium powder (Phytotechlab) 2.215 g / L, sucrose 30 g / L, acetylsuccinone 100 μM, and pH adjusted to 5.2.

[0095] (4) Remove the thallus fragments of floating moss, transfer them to a co-culture medium, and co-culture them with recombinant Agrobacterium at 22°C in the dark (dark culture) for 3 days.

[0096] The co-culture medium consisted of: 2.215 g / L MS medium powder (Phytotechlab), 30 g / L sucrose, 100 μM acetylsalicylic acid, and 10 g / L agar, with the pH adjusted to 5.7.

[0097] (5) The thallus fragments of the floating moss were spread evenly on a solid screening medium and subjected to the first screening in a constant temperature and light incubator. After the first screening, small pieces of dark green thallus tissue were clearly visible on the screening plate. Upon magnification, many rhizoids were observed on the thallus fragments. The presence of rhizoids on the thallus fragments was considered a reliable indicator of successful transformation.

[0098] The solid screening medium consisted of: 1.605 g / L of B5 medium powder (Phytotechlab), 10 g / L of sucrose, 10 g / L of agar, 100 μg / mL of cefotaxime sodium, and 10 μg / mL of hygromycin.

[0099] The culture conditions of the constant temperature and light incubator are a constant temperature of 22℃, a photocycle of 16h light / 8h darkness, and a light intensity of 800 lux.

[0100] (6) After 3-4 weeks, the surviving and regenerated transformed tissues were transferred to a secondary solid screening medium and cultured in a constant temperature and light incubator for 3-4 weeks for a second screening to ensure that false positives were eliminated. After the second screening, the tissues were transferred to 1 / 2 B5 medium and rapidly propagated in a constant temperature and light incubator for 4-12 weeks to obtain transgenic floating moss plants.

[0101] Composition of the secondary solid screening medium: B5 medium powder (Phytotechlab) 1.605 g / L, sucrose 10 g / L, agar 10 g / L, hygromycin 10 μg / mL.

[0102] The culture conditions of the constant temperature and light incubator are all 22℃ constant temperature, photocycle of 16h light / 8h dark, and light intensity of 800 lux.

[0103] The composition of the 1 / 2B5 culture medium is the same as that of the 1 / 2B5 solid culture medium in step (1).

[0104] 3. Identification of transgenic plants

[0105] The transgenic moss plants obtained in step 2 were subjected to PCR (hygromycin resistance gene identification, using primers HygR-F: CTATTTCTTTGCCCTCGG (SEQ ID NO:2); HygR-R: TCCGGAAGTGCTTGACATTG (SEQ ID NO:3)), Western blotting, and fluorescence observation to verify that the exogenous gene was successfully integrated into the moss genome and stably expressed.

[0106] This embodiment also employed immunoblotting analysis and fluorescence observation to identify transgenic plants, and the results are shown in [Figure number missing]. Figure 2 The results showed that the H2B-GFP protein was successfully integrated into the algae genome and stably expressed, and its presence could be successfully detected using a GFP antibody. Figure 2 A), and the nuclear localization green fluorescence in the thallus and scales can be clearly seen under a fluorescence microscope. Figure 2 B).

[0107] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0108] As used in this invention, the term "about" when applied to a value indicates that a slight degree of imprecision is permissible in the calculation or measurement of the value (the accuracy of the value by some means; approximately or reasonably close to the value; almost). If, for some reason, the imprecision specified by "about" is not understood in this conventional sense in the art, then "about" as used in this invention at least indicates variation that may be caused by conventional methods of measuring or using such parameters.

[0109] As used in this invention, the terms "comprising" and "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0110] As used in this invention, the term "and / or" includes any one or more of the related listed items and all combinations thereof.

[0111] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for stable genetic transformation of floating algae, characterized in that, The method includes the following steps: The first step is to crush the floating moss foliage: In a clean bench, the sterile floating moss foliage is homogenized and crushed into floating moss foliage fragments. The second step, explant pre-culture: The homogenized thallus fragments from the first step are inoculated onto a pre-culture medium and pre-cultured under constant temperature and light conditions. The third step, infection and co-culture: The floating moss thallus fragments pre-cultured in the second step were immersed in Agrobacterium infection solution containing the transformation vector. After infection, the floating moss thallus fragments were filtered out by cell filter and placed in co-culture medium for dark culture to obtain co-cultured floating moss thallus fragments. Step 4, First screening culture: The co-cultured floating moss thallus fragments from Step 3 are transferred to a screening medium containing antibiotics and cultured under constant temperature and light conditions; Step 5, Second screening culture: The newly grown green tissue on the screening medium of the first screening culture in step 4 is transferred to a new screening medium containing antibiotics for a second screening. The culture is continued under constant temperature and light conditions to obtain resistant seedlings. Step 6, Expanding the culture: The resistant seedlings obtained in Step 5 are transferred to a propagation medium and further expanded under constant temperature and light conditions. Step 7, Transformation Identification: Further identification of the transgenic positive plants obtained after the expanded culture in Step 6.

2. The method as described in claim 1, characterized in that, In the first step, the specific method for crushing the floating moss thallus is as follows: select floating moss thallus that has been cultured for 4-5 weeks under constant temperature and light conditions, and crush it into floating moss thallus fragments using a mechanical homogenization method. The culture medium is 1 / 2 B5 medium, which consists of 1.605 g / L B5 medium powder, 10 g / L sucrose, and 10 g / L agar, with the pH adjusted to 5.7; and / or the constant temperature and light culture conditions are a constant temperature of 22°C, a photoperiod of 16 h light / 8 h dark, and a light intensity of 800 lux.

3. The method as described in claim 1, characterized in that, In the second step, the pre-culture medium is 1 / 2 B5 medium, composed of: 1.605 g / L B5 medium powder, 10 g / L sucrose, and 10 g / L agar, adjusted to pH 5.7; and / or, The pre-culture time is 1-7 days; and / or, The constant temperature and light cultivation conditions were 22℃, with a photocycle of 16h light / 8h darkness and a light intensity of 800 lux.

4. The method as described in claim 1, characterized in that, In the third step, the infecting Agrobacterium strains include GV3101 and EHA105; and / or, The OD of the Agrobacterium infection solution 600 For 0.5-2.1; and / or, The composition of the Agrobacterium infection solution is: Agrobacterium, MS medium powder 2.215 g / L, sucrose 30 g / L, acetylsuccinone 100 μM, adjusted to pH 5.2; and / or, The co-culture medium consisted of: 2.215 g / L MS medium powder, 30 g / L sucrose, 100 μM acetylsalicylic acid, and 10 g / L agar, adjusted to pH 5.7; and / or, The infection is carried out in a shaker at 25°C, 110 rpm, and with a light intensity equal to the ambient natural light intensity; and / or, The infection time is 2 hours; and / or, The co-culture was carried out in a completely dark incubator at 22°C; and / or, The dark culture time is 3 days.

5. The method as described in claim 1, characterized in that, In the third step, the transformation vector is a recombinant overexpression vector pUBQ10::RnH2B-GFP, wherein the nucleotide sequence of RnH2B is shown in SEQ ID NO:1; and / or, The third step also includes using Agrobacterium without the transformation vector as a negative control.

6. The method as described in claim 1, characterized in that, In the fourth step, the selection medium comprises: 1.605 g / L B5 medium powder, 10 g / L sucrose, 10 g / L agar, 100 μg / mL cefotaxime sodium, and 10 μg / mL hygromycin; or, the selection medium comprises: 1.605 g / L B5 medium powder, 10 g / L sucrose, 10 g / L agar, 100 μg / mL cefotaxime sodium, and 50 μg / mL kanamycin; wherein the cefotaxime sodium is used to remove Agrobacterium; and / or, the selection medium is selected according to the resistance gene of the transformed vector; and / or, The constant temperature and light cultivation conditions are: constant temperature of 22℃, photoperiod of 16h light / 8h dark, and light intensity of 800 lux; and / or, The culture period is 3-4 weeks.

7. The method as described in claim 1, characterized in that, In the fifth step, the selection medium consists of: 1.605 g / L B5 medium powder, 10 g / L sucrose, 10 g / L agar, and 10 μg / mL hygromycin; or, the selection medium consists of: 1.605 g / L B5 medium powder, 10 g / L sucrose, 10 g / L agar, and 50 μg / mL kanamycin; wherein the selection medium is selected based on the resistance gene of the transformed vector; and / or, The constant temperature and light cultivation conditions are: constant temperature of 22℃, photoperiod of 16h light / 8h dark, and light intensity of 800 lux; and / or, The continuous culture period is 3-4 weeks.

8. The method as described in claim 1, characterized in that, In the sixth step, the propagation medium is 1 / 2 B5 medium, the components of which are: 1.605 g / L B5 medium powder, 10 g / L sucrose, 10 g / L agar, and pH adjusted to 5.7; and / or, The constant temperature and light cultivation conditions are: constant temperature of 22℃, photoperiod of 16h light / 8h dark, and light intensity of 800 lux; and / or, The extended culture period is 4-12 weeks; and / or, In the seventh step, the identification method includes one or more of PCR, fluorescence observation, and Western blot.

9. The method as described in claim 1, characterized in that, After the first screening culture, small, dark green thallus tissues were clearly visible on the screening plate. Upon magnification, many rhizoids were observed on the thallus. The presence of rhizoids on the tissue fragments was considered a reliable indicator of successful transformation.

10. The method as described in claim 1, characterized in that, The plant tissues that survived and regenerated after the first screening culture were subjected to a second round of antibiotic selection to ensure that false positives were eliminated. After the second screening culture was completed, they could be transferred to a normal culture medium for propagation.

Images