Vector for improving gene knock-in efficiency and method for verifying accurate gene knock-in efficiency

By combining the Cas9 nuclease and the dCas12iMax system, an innovative vector was developed that solved the problems of low HDR efficiency and chromatin shrinkage, achieving a significant improvement in gene knock-in efficiency and providing an efficient method and evaluation tool for precise gene knock-in.

CN121472328APending Publication Date: 2026-02-06BEIJING LAB ANIMAL RES CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511691302.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

In existing gene knock-in technologies, homology-directed repair (HDR) is inefficient, non-homologous end joining (NHEJ) is dominant, chromatin condensation hinders the approach of the Cas9 protein complex, and the efficiency and stability of donor template delivery are insufficient, resulting in low gene knock-in efficiency.

Method used

We employed an innovative vector system, combining the Cas9 nuclease and the cleavage enzyme-inactivated Cas12iMax (dCas12iMax) knock-in system, to improve the cleavability of SpCas9 and the accessibility of donor templates by mediating local chromatin opening through dCas12iMax. This resulted in the construction of a novel bimolecular synergistic vector, which was then used in conjunction with a flow cytometry fluorescence reporter system to quantitatively assess gene knock-in efficiency.

Benefits of technology

It significantly improves gene knock-in efficiency, achieving a breakthrough in the efficiency of precise gene knock-in, increasing the efficiency by 2-3 times, and providing a more efficient and reliable technical platform for gene function research and gene therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472328A_ABST
    Figure CN121472328A_ABST
Patent Text Reader

Abstract

The invention relates to a vector for improving gene knock-in efficiency and a method for verifying accurate gene knock-in efficiency. The vector comprises a gene knock-out vector, an auxiliary knock-in vector and a donor template vector, the gene knockout vector comprises sgRNA and a knockout vector skeleton, the sgRNA comprises a sequence complementary to a target gene, and the skeleton comprises a sequence for coding a Cas protein and has cleavage activity; the auxiliary knock-in vector comprises crRNA of a 5'and / or 3 'homologous arm of a targeted donor template and an auxiliary knock-in vector skeleton, the crRNA comprises a sequence complementary to the homologous arm, the skeleton comprises a sequence for coding nickase inactivation type Cas protein, and the crRNA and the sequence form a ribonucleoprotein complex to realize an auxiliary knock-in function; the donor template carrier comprises a donor template and a donor template carrier skeleton. The method realizes breakthrough improvement of the gene accurate knock-in efficiency, can quantitatively evaluate the gene accurate knock-in efficiency, and shows important potential in the field of gene therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to vectors for improving gene knock-in efficiency and methods for verifying the efficiency of precise gene knock-in. Background Technology

[0002] Gene knock-in is a valuable research tool in both basic research and clinical applications. Homologous targeted repair (HDR)-mediated CRISPP / Cas9 gene editing is a crucial method for achieving gene knock-in. However, the low efficiency of HDR hinders its application. Studies have shown that the low efficiency of HDR is due to the dominance of non-homologous end joining (NHEJ) caused by the inherent DNA damage repair pathway preference of cells, resulting in low HDR efficiency. The compact state of chromatin also hinders the physical proximity of the Cas9 protein complex and the donor template to the target site. Furthermore, the donor template has significant limitations in terms of delivery efficiency, nucleic acid stability, and adaptation to homologous arm length. To address the limitations of current research, researchers have attempted to improve gene knock-in efficiency by regulating repair pathways (such as inhibiting DNA-PK or Polθ), optimizing the donor template form (such as single-stranded oligonucleotides), or using high-fidelity Cas9 variants. However, these methods still have significant shortcomings in terms of universality, reproducibility, and ease of operation.

[0003] In view of this, the present invention is proposed. Summary of the Invention

[0004] The primary objective of this invention is to provide a vector and method for improving gene knock-in efficiency, achieving a breakthrough improvement in the efficiency of precise gene knock-in.

[0005] The second objective of this invention is to provide a method for verifying the efficiency of precise gene knock-in, which can quantitatively assess gene knock-in efficiency.

[0006] In a first aspect, the present invention provides a vector for improving gene knock-in efficiency, comprising: a gene knockout vector, an assist knock-in vector, and a donor template vector; The gene knockout vector includes an sgRNA targeting a non-human animal gene and a knockout vector backbone; the sgRNA contains a nucleotide sequence complementary to the non-human animal gene; the knockout vector backbone contains a sequence encoding a Cas protein, which has cleavage activity. The assist knock-in vector comprises: crRNA targeting the 5' homologous arm and / or 3' homologous arm of the donor template and an assist knock-in vector backbone; the crRNA contains a nucleotide sequence complementary to the 5' homologous arm and / or 3' homologous arm of the donor template; the assist knock-in vector backbone contains a sequence encoding a cleavage enzyme-inactivating Cas protein, the cleavage enzyme-inactivating Cas protein forming a ribonucleoprotein complex with the crRNA to achieve the assist knock-in function. The donor template carrier includes: a donor template containing a 5' homologous arm and a 3' homologous arm, and a donor template carrier skeleton.

[0007] Preferably, in the knockout vector backbone, the Cas protein is a SpCas9 nuclease with cleavage activity, and its amino acid sequence is shown in SEQ ID NO:19.

[0008] Preferably, the knockout vector backbone is PX459, the gene knockout vector is PX459-sgRNA, and the PX459 vector backbone contains a puromycin resistance gene for screening successfully transfected cells.

[0009] In one specific embodiment, the gene knockout vector includes SpCas9, sgRNA, and a puromycin resistance gene, used to generate double-strand breaks in the genome.

[0010] In one specific embodiment, the non-human animal target gene is the mouse β-actin gene, and the gene knockout vector includes a PX459 vector backbone and an sgRNA targeting the sixth exon region of the mouse β-actin gene, wherein the sgRNA contains a nucleotide sequence complementary to the sixth exon of the mouse β-actin gene, preferably, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0011] Preferably, the sgRNA is expressed by the U6 promoter.

[0012] Preferably, the cleavage enzyme-inactivated Cas protein in the knock-in vector backbone is dCas12iMax, and contains the E833A inactivation mutation (the 833rd amino acid is changed from E to A, and the corresponding codon is changed from GAG to GCG), and its amino acid sequence is shown in SEQ ID NO: 20.

[0013] Preferably, the auxiliary knock-in vector backbone is pCAG-dCas12iMax-T2A-BSD-U6, and the auxiliary knock-in vector is pCAG-dCas12iMax-T2A-BSD-U6-crRNA.

[0014] Preferably, the lengths of the 5' and 3' homologous arms of the donor template are 20-2000 bp, more preferably 500-800 bp.

[0015] In one specific embodiment, the 5' homologous arm sequence of the donor template is shown in SEQ ID NO: 10, and the 3' homologous arm sequence of the donor template is shown in SEQ ID NO: 18.

[0016] Preferably, the crRNA is screened by predicting all possible crRNA binding sites within the 5' and 3' homologous arm regions of the donor template.

[0017] In one specific embodiment, the crRNA sequence targeting the 5' homologous arm of the donor template is any one of SEQ ID NO: 2 (crRNA2), SEQ ID NO: 3 (crRNA3), SEQ ID NO: 4 (crRNA4), and SEQ ID NO: 5 (crRNA5); and the crRNA sequence targeting the 3' homologous arm of the donor template is any one of SEQ ID NO: 6 (crRNA6), SEQ ID NO: 7 (crRNA7), SEQ ID NO: 8 (crRNA8), and SEQ ID NO: 9 (crRNA9).

[0018] Preferably, the helper knock-in vector comprises any group of the following crRNAs: (1) SEQ ID NO: 2 (crRNA2) and SEQ ID NO: 6 (crRNA6); (2) SEQ ID NO: 2 (crRNA2) and SEQ ID NO: 7 (crRNA7); (3) SEQ ID NO: 2 (crRNA2) and SEQ ID NO: 8 (crRNA8); (4) SEQ ID NO: 2 (crRNA2) and SEQ ID NO: 9 (crRNA9); (5) SEQ ID NO: 3 (crRNA3) and SEQ ID NO: 6 (crRNA6); (6) SEQ ID NO: 3 (crRNA3) and SEQ ID NO: 7 (crRNA7); (7) SEQ ID NO: 3 (crRNA3) and SEQ ID NO: 8 (crRNA8); (8) SEQ ID NO: 3 (crRNA3) and SEQ ID NO: 9 (crRNA9); (9) SEQ ID NO: 4 (crRNA4) and SEQ ID NO: 6 (crRNA6); (10) SEQ ID NO: 4 (crRNA4) and SEQ ID NO: 7 (crRNA7); (11) SEQ ID NO: 4 (crRNA4) and SEQ ID NO: 8 (crRNA8); (12) SEQ ID NO: 4 (crRNA4) and SEQ ID NO: 9 (crRNA9); (13) SEQ ID NO: 5 (crRNA5) and SEQ ID NO: 6 (crRNA6); (14) SEQ ID NO: 5 (crRNA5) and SEQ ID NO: 7 (crRNA7); (15) SEQ ID NO: 5 (crRNA5) and SEQ ID NO: 8 (crRNA8); (16) SEQ ID NO: 5 (crRNA5) and SEQ ID NO: 9 (crRNA9); (17)crRNA2 (crRNA2); (18)crRNA3 (crRNA3); (19)crRNA4 (crRNA4); (20)crRNA5 (crRNA5); (21)crRNA6 (crRNA6); (22)crRNA7 (crRNA7); (23)crRNA8 (crRNA8); (24)crRNA9 (crRNA9).

[0019] In one specific implementation, the helper knock-in vector targeting the 5' homologous arm can be any one of pCAG-dCas12iMax-T2A-BSD-U6-crRNA2, pCAG-dCas12iMax-T2A-BSD-U6-crRNA3, pCAG-dCas12iMax-T2A-BSD-U6-crRNA4, and pCAG-dCas12iMax-T2A-BSD-U6-crRNA5.

[0020] In one specific implementation, the helper knock-in vector targeting the 3' homologous arm can be any one of pCAG-dCas12iMax-T2A-BSD-U6-crRNA6, pCAG-dCas12iMax-T2A-BSD-U6-crRNA7, pCAG-dCas12iMax-T2A-BSD-U6-crRNA8, and pCAG-dCas12iMax-T2A-BSD-U6-crRNA9.

[0021] Preferably, the crRNA is expressed by a U6 or H1 promoter.

[0022] Preferably, the helper knock-in vector backbone contains the blast fungicide S resistance gene (BSD) for screening successfully transfected cells.

[0023] Preferably, the donor template containing a 5' homologous arm and a 3' homologous arm includes either a donor template for verifying the dual function of precise and random integration or a donor template for verifying the single function of precise integration.

[0024] Preferably, the donor template for verifying the dual function of precise and random integration comprises the following elements from the 5' to 3' ends: a 5' homologous arm (SEQ ID NO: 10), a self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), a red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), a stop signal (SV40 polyA, SEQ ID NO: 13), a promoter (hPGK, SEQ ID NO: 14), a hygromycin resistance gene (HygR, SEQ ID NO: 15), a self-cleaving peptide coding sequence (T2A, SEQ ID NO: 16), an enhanced green fluorescent protein coding sequence (EGFP, SEQ ID NO: 17), a stop signal (SV40 polyA, SEQ ID NO: 13), and a 3' homologous arm (SEQ ID NO: 18).

[0025] Preferably, the donor template for verifying precise integration of a single-function control comprises, from the 5' to the 3' end, the following elements in sequence: a 5' homologous arm (SEQ ID NO: 10), a self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), a red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), a termination signal (SV40 polyA, SEQ ID NO: 13), a 3' homologous arm (SEQ ID NO: 18), a promoter (hPGK, SEQ ID NO: 14), a hygromycin resistance gene (HygR, SEQ ID NO: 15), and a termination signal (SV40 polyA, SEQ ID NO: 13).

[0026] Preferably, the donor template carrier skeleton is pMD-19T (19T) (SEQ ID NO: 29).

[0027] A second aspect of the present invention provides a method for improving gene knock-in efficiency, comprising the following steps: Design and screen sgRNAs that target genes in non-human animals, and construct gene knockout vectors; Design and screen crRNAs within the 5' and / or 3' homologous arms of the donor template vector, and construct helper knock-in vectors; Construct a donor template carrier for knock-in; Gene knockout vector, helper knock-in vector and donor template vector were co-transfected into recipient cells, and gene knock-in was verified by flow cytometry after antibiotic screening.

[0028] The gene knockout vectors, helper knock-in vectors, and donor template vectors involved in this section are the same as those in the first aspect of this invention, and will not be repeated here.

[0029] A third aspect of the present invention provides a method for verifying the efficiency of precise gene knock-in, comprising the following steps: Design and screen sgRNAs that target genes in non-human animals, and construct gene knockout vectors; Design and screen crRNAs within the 5' and / or 3' homologous arms of the donor template, and construct helper knock-in vectors; Construct a donor template carrier for validating both precise and random integration functions; Construct a donor template vector for validating precise integration of single-function controls; Gene knockout vector, helper knock-in vector, and donor template vector for verifying both precise and random integration or donor template vector for verifying precise integration as a single-function control are co-transfected into recipient cells (preferably B16-F10, HEK293T, or HeLa cells). The medium is changed the next day, followed by antibiotics for screening for 48 hours and then the medium is changed to ordinary medium. After culturing for 10 days, the gene knock-in efficiency is verified by flow cytometry.

[0030] In one specific embodiment, the donor template in the donor template vector (19T-Donor1 vector) used to verify the dual function of precise and random integration contains the following elements sequentially from the 5' to the 3' end: a 5' homologous arm (SEQ ID NO: 10), a self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), a red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), a termination signal (SV40 polyA, SEQ ID NO: 13), a promoter (hPGK, SEQ ID NO: 14), a hygromycin resistance gene (HygR, SEQ ID NO: 15), a self-cleaving peptide coding sequence (T2A, SEQ ID NO: 16), an enhanced green fluorescent protein coding sequence (EGFP, SEQ ID NO: 17), a termination signal (SV40 polyA, SEQ ID NO: 13), and a 3' homologous arm (SEQ ID NO: 18).

[0031] In one specific embodiment, the donor template in the donor template vector (19T-Donor2 vector) used to verify the precise integration of a monofunctional control contains the following elements sequentially from the 5' to 3' ends: a 5' homologous arm (SEQ ID NO: 10), a self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), a red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), a termination signal (SV40 polyA, SEQ ID NO: 13), a 3' homologous arm (SEQ ID NO: 18), a promoter (hPGK, SEQ ID NO: 14), a hygromycin resistance gene (HygR, SEQ ID NO: 15), and a termination signal (SV40 polyA, SEQ ID NO: 13).

[0032] Preferably, the helper knock-in vector expresses nickase-inactivated Cas12iMax (E833A) protein and crRNA, wherein the crRNA targets sequences in the homologous arm regions of the 19T-Donor1 and 19T-Donor2 vectors.

[0033] In one specific embodiment, the helper knock-in vector includes dCas12iMax (E833A), crRNA, and the blast fungicide S resistance gene. The crRNA targets sequences within the homologous arm regions of the 19T-Donor1 and 19T-Donor2 vectors to recruit the Donor template to the genomic breakpoint. Preferably, in the 19T-Donor1 vector, the co-expression of mCherry, EGFP, and HygR depends on precise homologous recombination between the 5' and 3' homologous arms and the target gene site within the cell. This co-expression serves as a validation indicator of precise knock-in efficiency.

[0034] Preferably, in the 19T-Donor1 vector, the co-expression of mCherry and HygR, or the co-expression of EGFP and HygR, is not dependent on homologous recombination mechanisms, but is driven by the promoter contained in the vector sequence randomly inserted into the host genome. This individual expression serves as a verification indicator of the efficiency of random insertion.

[0035] Preferably, in the 19T-Donor2 vector, the co-expression of mCherry and HygR depends on the precise homologous recombination of the 5' and 3' homologous arms with the target gene site in the cell. This co-expression serves as a verification indicator of precise knock-in efficiency.

[0036] In one specific implementation, highly efficient and specific crRNAs are first designed and screened in the 5' and 3' homologous arm regions of the donor template. Subsequently, a CRISPR-Cas9 gene knockout vector targeting the target gene site, an auxiliary knock-in vector based on the dCas12iMax system, a 19T-Donor1 vector for validating both precise and random integration, and a 19T-Donor2 vector for validating a single-function control for precise integration are constructed. Finally, the gene knockout vector + auxiliary knock-in vector + 19T-Donor1 vector or the gene knockout vector + auxiliary knock-in vector + 19T-Donor2 vector are co-transfected into B16-F10 cells. Multicolor flow cytometry analysis after 48 hours allows for simultaneous and quantitative precise knock-in.

[0037] Preferably, antibiotic screening is performed after transfection, and the antibiotics used include blastomycin S, puromycin and hygromycin B.

[0038] Preferably, the antibiotic used in the 19T-Donor1 and 19T-Donor2 carriers is hygromycin B.

[0039] Preferably, the transfection molar ratio of the three vectors is: Gene knockout vector: helper knock-in vector: 19T-Donor1 or 19T-Donor2 vector = 1 : 1 : 2.

[0040] Preferably, after co-transfecting the gene knockout vector, helper knock-in vector, and Donor1 vector into cells, flow cytometry verification includes: (1) Detect the cell population that is double positive for mCherry and EGFP, which represents cells that have undergone precise homologous recombination knock-in; (2) Detect EGFP-only and mCherry-only single-positive cell populations, which represent cells that have undergone random integration; (3) Accuracy in keying efficiency (%) = [mCherry + EGFP + Cell count / (mCherry) + EGFP + + mCherry — EGFP + + mCherry + EGFP — + mCherry — EGFP — [Total cell count] × 100%; (4) Inaccurate keying efficiency (%) = [(mCherry — EGFP + + mCherry + EGFP — ) Cell count / (mCherry + EGFP + + mCherry — EGFP + + mCherry + EGFP — + mCherry — EGFP — [Total cell count] × 100%; (5) The percentage of precise typing in total typing (%) = Precision typing efficiency (%) / [Inaccurate typing efficiency (%) + Precision typing efficiency (%)].

[0041] Preferably, after co-transfecting the gene knockout vector, helper knock-in vector, and 19T-Donor1 vector into cells, the flow cytometry verification results include: a double-positive cell population of mCherry and EGFP, a single-positive cell population of EGFP only, a single-positive cell population of mCherry only, and a negative cell population.

[0042] Preferably, after co-transfecting the gene knockout vector, helper knock-in vector, and 19T-Donor2 vector into cells, flow cytometry verification includes: (1) Detect only mCherry positive cell populations, which represent cells that have undergone precise homologous recombination knock-in; (2) Accuracy of keying (%) = [mCherry + Cell count / (mCherry) + + mCherry — [Total number of cells] × 100%.

[0043] Preferably, after co-transfecting the gene knockout vector, the helper knock-in vector, and the Donor2 vector into the cells, the flow cytometry verification results include: a single positive cell population of mCherry only, and a negative cell population.

[0044] In one specific implementation, using the mouse β-actin gene as the target gene, a vector to improve gene knock-in efficiency and a method to verify the precise gene knock-in efficiency are designed, including the following steps: (1) For the coding sequence of the β-actin gene, design and screen sgRNAs that can guide SpCas9 to achieve efficient cleavage and have the lowest off-target potential. Define the left sequence of the expected cleavage site of the sgRNA as the 5' homologous arm and the right sequence as the 3' homologous arm. Based on the dCas12iMax system, design and screen crRNAs that can specifically bind to genomic DNA and have targeting stability in the above-mentioned 5' and 3' homologous arm regions respectively. (2) Construct px459-sgRNA with cleavage function and dCas12iMax(E833A)-T2A-BSD-U6-crRNA vector with knock-in function; (3) Construct the 19T-Donor1 vector for precise and random integration of dual functions, and construct the 19T-Donor2 vector for verifying the precise integration of single function control; (4) PX459-sgRNA+dCas12iMax(E833A)-T2A-BSD-U6-crRNA+19T-Donor1 and PX459-sgRNA+19T-Donor1, as well as PX459-sgRNA+dCas12iMax(E833A)-T2A-BSD-U6-crRNA+19T-Donor2 and PX459-sgRNA+19T-Donor2, were co-transfected into B16-F10 cells. After 48 h, puromycin, hygromycin B, and blastomycin S were added for screening. After 48 h, the culture medium was changed to ordinary medium. After 10 days of culture, the knock-in efficiency was verified by flow cytometry.

[0045] In a fourth aspect, the present invention provides a host cell comprising the gene knockout vector and the helper knock-in vector, the two vectors existing in the genome of the cell in a precise knock-in manner.

[0046] In a fifth aspect, the present invention provides a host cell comprising the gene knockout vector, the helper knock-in vector, and a donor template vector for verifying both precise and random integration / a donor template vector for verifying a single-function control of precise integration, wherein the three vectors exist in the genome of the cell in a precise knock-in manner.

[0047] The present invention has at least the following beneficial effects: This invention constructs a novel, highly efficient, and precise gene knock-in vector with bimolecular synergy. This vector innovatively combines the Cas9 nuclease system with a cleavage enzyme-inactivated Cas12iMax (dCas12iMax) assistive knock-in system. Through dCas12iMax-mediated local chromatin opening, it significantly improves the cleavability of SpCas9 and the accessibility of the donor template vector, promoting the efficiency of both small and large SpCas9-based gene knock-in. To quantitatively assess gene knock-in efficiency, this invention utilizes a P2A / T2A tandem red-green-fluorescence-resistance gene module vector system, combined with a flow cytometry fluorescence reporter system, to achieve quantitative analysis of precise knock-in and random insertion efficiency. Experimental data show that this invention can improve precise knock-in efficiency by 2-3 times, providing a more efficient and reliable technical platform for gene function research and gene therapy development. Attached Figure Description

[0048] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0049] Figure 1 A schematic diagram of a gene knock-in efficiency verification system; Figure 2 Schematic diagram of the knock-in vector and crRNA location; Figure 3 The effect diagram for validating dual-function vector cells with precise knock-in and non-precise insertion; Figure 4 The percentage of precise keystrokes in total keystrokes (%) Figure 5 The image shows the effect of accurately inserting single-function vector cells. Detailed Implementation

[0050] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0051] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0052] definition The term "CRISPR / Cas9" as used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for specifically modifying the DNA of target genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as hematological diseases, cancer, and other genetic disorders. This technology has already been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0053] As used herein, the term "sgRNA" (single-guide RNA) refers to the single-stranded guide RNA used in the CRISPR / Cas9 gene editing system. This RNA molecule is the functional guide component of the Cas9 nuclease, responsible for specifically recognizing and hybridizing with target DNA sites in the host genome through its 5' spacer sequence via base complementarity pairing. This mediates the targeted cleavage of the Cas9 protein at the target site, making it a core molecular tool for achieving precise gene knockout, knock-in, and modification. The sgRNA's spacer sequence hybridizes (partially or completely complementary) with the target DNA sequence in the host cell genome. The length of the sgRNA's spacer sequence or a portion thereof that hybridizes with the target DNA sequence can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the sgRNA sequence that hybridizes with the target DNA sequence can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the sgRNA sequence that hybridizes with the target DNA sequence is between 10-30 or 15-25 nucleotides in length. In a preferred embodiment, the sgRNA described in this application is a chimeric RNA molecule comprising a 3' trans-activating CRISPR RNA sequence and a 5' crRNA (CRISPR RNA). These domains together constitute the complete sgRNA molecule, which can form a stable ribonucleoprotein complex (RNP) with the Cas9 protein and effectively mediate its recognition and cleavage of the target DNA.

[0054] In this application, the "guide sequence" refers to a sequence of approximately 17-20 bp specifying a target site, and can be used interchangeably with "guide sequence" or "spacer." In the context of CRISPR complex formation, the "target sequence" is a sequence designed to be complementary to the guide sequence. Hybridization between the target sequence and the guide sequence (a portion of the crRNA sequence) promotes CRISPR complex formation. This hybridization requires sufficient complementarity between the "target sequence" and the "guide sequence" to induce hybridization and promote CRISPR complex formation; complete complementarity is not mandatory.

[0055] The "CRISPR / Cas12 family" involved in this application belongs to the Class 2, Type V CRISPR-Cas system effector proteins. Compared with the widely used Cas9 (Type II-A) system, the CRISPR / Cas12 system differs significantly in molecular structure, cleavage mechanism, and PAM recognition. Its most significant characteristic is that these proteins typically contain only one RuvC nuclease domain, responsible for catalyzing DNA strand cleavage, and lack the HNH domain similar to that found in Cas9. In terms of the cleavage mechanism, after binding to target DNA, the RuvC domain of Cas12 proteins sequentially cleaves both the target and non-target strands, and the cleavage site is usually located at a specific position distal to the PAM sequence. This mechanism is distinctly different from the dual-domain coordinated cleavage of Cas9. This family has a rich diversity, including Cas12a (formerly Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j (CasΦ). Different isoforms exhibit diversity in protein size, PAM preference, crRNA structure, and the type of cleavage product ends. For example, Cas12a recognizes thymine-rich PAMs (such as 5′-TTTV-3′) and produces sticky ends with 5′ overhangs; Cas12b maintains activity over a wide temperature range; while isoforms such as Cas12f and Cas12j, due to their extremely small protein size (approximately 700 amino acids or less), are more suitable for in vivo delivery applications.

[0056] The "Cas12imax" in this application is an ultra-high-fidelity gene editing tool obtained through directed evolution of the natural Cas12a (also known as Cpf1) enzyme via protein engineering. This variant retains highly efficient on-target activity while significantly reducing off-target effects, and is widely considered one of the best-performing and most specific engineered Cas12a variants currently available. Its core molecular mechanism lies in the rational substitution and optimization of key amino acid residues, enhancing its stringency in recognizing target sequences without affecting its binding to crRNA and DNA recognition capabilities. Compared to Cas12a and other high-fidelity variants (such as AsCas12a-HF1), Cas12iMax exhibits near-background off-target editing activity across multiple cell types and genomic sites, while simultaneously improving editing efficiency at most target sites.

[0057] The “dCas12iMax” in this application is a nickase-inactivating Cas12 effector protein (dead Cas12iMax) constructed by inactivating a key amino acid site (E833A) in the RuvC nuclease domain of the ultra-high fidelity gene-editing protein Cas12iMax through molecular biology techniques. This variant completely loses its DNA cleavage activity but retains its efficient and precise DNA targeting ability, and can specifically bind to specific genomic sites guided by crRNA, thus serving as a multifunctional and high-precision gene regulation and chromatin engineering platform.

[0058] The “crRNA (CRISPR RNA)” in this application is a single-stranded RNA molecule of about 40-45 nucleotides in length. Its 5' end contains a 21-24 nt spacer sequence, and its 3' end folds into a conserved stem-loop structure, which is responsible for specifically binding to the Cas12iMax protein and stabilizing the ribonucleoprotein complex (RNP).

[0059] In this application, "donor template" refers to a foreign DNA template designed to mediate homology-directed repair (HDR). Its core function is to provide homologous sequences to guide cellular repair machinery to achieve precise genome modification. From a molecular mechanism perspective, the donor must contain the following key elements: homology arms homologous to the target site, the length of which directly affects HDR efficiency; the target modification sequence; and protective mutations against specific nuclease systems (such as disrupting the PAM sequence to prevent duplicate cleavage). In specific implementations, the donor design in the CRISPR-Cas12 system must meet the requirement of homology arm length of 500-800 bp. The term "gene knock-in" used herein is a gene editing technology that precisely integrates a foreign target sequence into a specific site in the genome through the homology-directed repair (HDR) mechanism. Unlike gene knockout, knock-in adds or alters genetic information in the genome. This technology utilizes the cell's endogenous repair system to achieve targeted genome modification at CRISPR-Cas and other nuclease-induced double-strand break (DSB) sites using a designed donor as a template. This technology has been widely used in fields such as gene function research, disease model construction, and gene therapy. In particular, variants based on the Cas12 system (such as Cas12iMax) provide new tools for clinical-grade gene knock-in by reducing off-target effects and enhancing HDR efficiency.

[0060] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0061] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0062] Example Instruments used in this application: Electrophoresis apparatus (BiO-RAD, PowerPac™ Basic), ultra-micro spectrophotometer (Dinghaoyuan, NanoPro2010), ProFlex PCR System (Thermo Fisher Scientific, ProFlex 3×32 well PCR system), chemiluminescence gel imaging analysis system (Bio-Rayet, Universal HoodⅡ), precision constant temperature incubator (Yiheng, BPH-9162), snowflake ice maker (Xiamen Guoyi, GYXH-35), high-speed refrigerated centrifuge (Thermo Fisher Scientific, Sorvall Legend Micro 21R), carbon dioxide constant temperature incubator (Reward, D180-P), constant temperature low speed centrifuge (Eppendorf, 5702R), inverted fluorescence microscope (Olympus, IX51), constant temperature water bath (Shanghai Senxin, DKS24), cell counter (Reward, C100), double-person biosafety cabinet (Shandong Boke, BSC-1360IIA2).

[0063] Reagents used in this application: Small-volume kit (TIANGEN, DP118), 1640 medium (Gibco, C11875500BT), PBS solution (Soluble, P1010), fetal bovine serum (Anwei-sci, AW-FO601), trypsin (Anwei-sci, AW-YM-001), lipo8000 transfection reagent (Beyotime, C0533), puromycin (Pusitan, P70025), cyprodinil S (Pusitan, B10300), hygromycin B (Pusitan, H50003).

[0064] 1. Design of sgRNA and crRNA A sgRNA for nicking was designed targeting the sixth exon region (SEQ ID NO: 30) of the β-actin gene. The sgRNA sequence is: AGTCCGCCTAGAAGCACTTG (SEQ ID NO: 1).

[0065] sgRNA cleavage site ( Figure 1 In B), the left sequence is defined as the 5' homologous arm, and the right sequence is defined as the 3' homologous arm.

[0066] Four crRNAs each were designed for localization targeting the 5' and 3' homologous arms of the Donor1 and Donor2 vectors, namely crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, and crRNA9. The crRNA2 sequence is: CTCCTCCTGAGCGCAAGTAC (SEQ ID NO: 2), 114 bp to the left of the sgRNA cleavage site; The crRNA3 sequence is: AGCAGAGTGTGGATCAGCAA (SEQ ID NO: 3), 49 bp to the left of the sgRNA cleavage site; The crRNA4 sequence is: CTTTCTTCAGATCATTGCTC (SEQ ID NO: 4), 131 bp to the left of the sgRNA cleavage site; The crRNA5 sequence is: CTGATCCACATCTGCTGGAA (SEQ ID NO: 5), 58 bp to the left of the sgRNA cleavage site; The crRNA6 sequence is: GACAAAACCTAACTTGCGCA (SEQ ID NO: 6), 61 bp to the right of the sgRNA cleavage site; The crRNA7 sequence is: TACAAATGTGGCTGAGGACT (SEQ ID NO: 7), 270 bp to the right of the sgRNA cleavage site; The crRNA8 sequence is: TCAAAAGAAAGGGTGTAAAAC (SEQ ID NO: 8), located 33 bp to the right of the sgRNA cleavage site; The crRNA9 sequence is: CTCCAACCAACTGCTGTCGC (SEQ ID NO: 9), 225 bp to the right of the sgRNA cleavage site.

[0067] 2. Carrier System Construction This section describes the construction of three core vectors: First, sgRNA was ligated to the px459 vector backbone to construct the px459-sgRNA vector; second, crRNA was ligated to the pCAG-dCas12iMax-T2A-BSD-U6 vector backbone to construct the pCAG-dCas12iMax-T2A-BSD-U6-crRNA vector; finally, the Donor1 vector was constructed by sequentially ligating the 5' homologous arm, P2A, mCherry, SV40 polyA, hPGK, HygR, T2A, EGFP, SV40 polyA, and 3' homologous arm in 5'-3' order; the Donor2 vector was constructed by sequentially ligating the 3' homologous arm, P2A, mCherry, SV40 polyA, 5' homologous arm, hPGK, HygR, and SV40 polyA in 5'-3' order. All vectors underwent rigorous Sanger sequencing to ensure sequence accuracy.

[0068] 2.1 Construction of px459-sgRNA vector Using NCBI Primer-BLAST, a pair of primers for amplifying sgRNA were designed, namely F: GAATCCCAGCACCCAGAGAG (SEQ ID NO: 21) and R: CTTTTGGGAGGGTGAGGGAC (SEQ ID NO: 22). The amplified products were then analyzed by 1% agarose gel electrophoresis using these primers. The results showed that there were no single nucleotide mutations at the location of the sgRNA.

[0069] The sgRNA-F (CACCGAGTCCGCCTAGAAGCACTTG, SEQ ID NO: 23) and sgRNA-R (AAACAGTCCGCCTAGAAGCACTTGC, SEQ ID NO: 24) synthesized by Qingke Company were mixed and annealed according to the procedure in Table 1. A suitable cloning site was selected, and the PX459 vector (SEQ ID NO: 25) was linearized by enzyme digestion, as shown in Table 2. The enzyme digestion system was used as shown in Table 3. The ligation was performed according to the enzyme ligation system in Table 3. The ligation product was transformed, plated, and single clones were picked. Finally, the successful construction of the vector PX459-sgRNA was confirmed by bacterial PCR.

[0070] Table 1 sgRNA / crRNA annealing procedure

[0071] Table 2. Enzyme digestion system of px459 vector / pCAG-dCas12iMax-T2A-BSD-U6 vector

[0072] Table 3 Enzyme ligation system

[0073] 2.2 Construction of pCAG-dCas12iMax-T2A-BSD-U6-crRNA vector Using NCBI Primer-BLAST, a pair of primers for amplifying crRNA was designed, namely F: GAATCCCAGCACCCAGAGAG (SEQ ID NO: 26) and R: CTTTTGGGAGGGTGAGGGAC (SEQ ID NO: 27). The amplified products were then analyzed by 1% agarose gel electrophoresis using these primers. The results showed that there were no single nucleotide mutations at the location of the crRNA.

[0074] The crRNA-F and crRNA-R synthesized by Qingke Company (crRNA-F is formed by adding ACGG to the corresponding sequences of crRNA2-9; crRNA-R is formed by adding AAAA to the corresponding sequences of crRNA2-9) were mixed and annealed according to the program in Table 1; a suitable cloning site was selected, and the pCAG-dCas12iMax-T2A-BSD-U6 vector (SEQ ID NO: 28) was linearized by enzyme digestion, and the enzyme digestion system is shown in Table 2; ligation was performed according to the enzyme ligation system in Table 3, the ligation product was transformed, plated, single clones were picked, and finally the successful construction of the vector pCAG-dCas12iMax-T2A-BSD-U6-crRNA was confirmed by bacterial PCR.

[0075] 2.3 Construction of 19T-Donor1 and 19T-Donor2 vectors The 5' homologous arm (SEQ ID NO: 10), the self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), the red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), the stop signal (SV40 polyA, SEQ ID NO: 13), the promoter (hPGK, SEQ ID NO: 14), the hygromycin resistance gene (HygR, SEQ ID NO: 15), the self-cleaving peptide coding sequence (T2A, SEQ ID NO: 16), the enhanced green fluorescent protein coding sequence (EGFP, SEQ ID NO: 17), the stop signal (SV40 polyA, SEQ ID NO: 13), and the 3' homologous arm (SEQ ID NO: 18) were sequentially ligated in the 5'-3' direction to form the Donor1 vector (e.g., ...). Figure 2 As shown in A), the DNA was sequenced and identified, and the results showed that the Donor1 vector was successfully constructed.

[0076] The 5' homologous arm (SEQ ID NO: 10), the self-cleaving peptide coding sequence (P2A, SEQ ID NO: 11), the red fluorescent protein coding sequence (mCherry, SEQ ID NO: 12), the stop signal (SV40 polyA, SEQ ID NO: 13), the 3' homologous arm (SEQ ID NO: 18), the promoter (hPGK, SEQ ID NO: 14), the hygromycin resistance gene (HygR, SEQ ID NO: 15), and the stop signal (SV40 polyA, SEQ ID NO: 13) were sequentially ligated in the 5'-3' direction to form the Donor2 vector (e.g., ...). Figure 2 As shown in B in the figure, the DNA was sequenced and identified, and the results showed that the Donor2 vector was successfully constructed.

[0077] The 19T vector was linearized using an enzyme digestion method, and the enzyme digestion system is shown in Table 2. The 19T vector and Donor1 / Donor2 were ligated according to the enzyme ligation system in Table 3. The ligation products were transformed, plated, and single clones were picked. Finally, the successful construction of vectors 19T-Donor1 and 19T-Donor2 was confirmed by bacterial PCR.

[0078] 3. Culture, transfection, and flow cytometry sorting of B16 cells for nuclease-positive cells Resuscitated B16 cells were cultured in a 37°C incubator containing 5% CO2 in a medium of 90% 1640, 10% FBS, and 1% 100 μg / mL penicillin-streptomycin. When the cell density reached approximately 80%, the cells were passaged. After stable growth and good morphology, transfection was performed using Lipo8000. 24 h before transfection, cells were seeded in 48-well plates. When the cell density reached 80%, the vectors listed in Tables 4-9 were co-transfected into B16 cells. Subsequent cell transfection experiments were performed using 48-well plates, with four replicates for each treatment group. 48 h after transfection, the culture medium was removed, and the cells were washed with phosphate buffered saline (PBS) and discarded. The cells were then digested with 50 μl of EDTA-free trypsin for 30 s and discarded. Digestion was stopped with 100 μl of culture medium. The cells were collected into PCR tubes, centrifuged at 1000 r / min for 5 min, and the supernatant was discarded. The cells were resuspended in 200 μL of PBS, filtered into 1.5 mL tubes, and the proportion of red and green fluorescent cells was determined by flow cytometry.

[0079] Table 4 Transfection System 1

[0080] Note: crRNA can be composed of crRNA2 and crRNA6; crRNA2 and crRNA7; crRNA2 and crRNA8; crRNA2 and crRNA9; crRNA3 and crRNA6; crRNA3 and crRNA7; crRNA3 and crRNA8; crRNA3 and crRNA9; crRNA4 and crRNA6; crRNA4 and crRNA7; crRNA4 and crRNA8; crRNA4 and crRNA9; crRNA5 and crRNA6; crRNA5 and crRNA7; crRNA5 and crRNA8; crRNA5 and crRNA9; crRNA2; crRNA3; crRNA4; crRNA5; crRNA6; crRNA7; crRNA8; and crRNA9.

[0081] Table 5 Transfection System 2

[0082] Table 6 Transfection System 3

[0083] Table 7 Transfection System 4

[0084] Note: crRNA can be composed of crRNA2 and crRNA6; crRNA2 and crRNA7; crRNA2 and crRNA8; crRNA2 and crRNA9; crRNA3 and crRNA6; crRNA3 and crRNA7; crRNA3 and crRNA8; crRNA3 and crRNA9; crRNA4 and crRNA6; crRNA4 and crRNA7; crRNA4 and crRNA8; crRNA4 and crRNA9; crRNA5 and crRNA6; crRNA5 and crRNA7; crRNA5 and crRNA8; crRNA5 and crRNA9; crRNA2; crRNA3; crRNA4; crRNA5; crRNA6; crRNA7; crRNA8; and crRNA9.

[0085] Table 8 Transfection System 5

[0086] Table 9 Transfection System 6

[0087] 4. Verification of gene knock-in efficiency The efficiency of precise and non-precise gene knock-in was evaluated using the 19T-Donor1 vector in the transfection system listed in Table 4-6, which was used to verify the dual function of precise and non-precise integration. + EGFP + Double-positive cells represent precise knock-in, mCherry — EGFP + or mCherry + EGFP — Cell-indicator non-precise knock-in ( Figure 1 (A and C in the original text). Flow cytometry analysis showed that, compared to the Cas9 single system, the combination of dCas12iMax and Cas9 dual systems significantly improved the precise knock-in efficiency, and the most significant improvement in precise knock-in efficiency was observed in the crRNA5+crRNA8 group within the dual system. + EGFP + The cell percentage increased to 10.59% compared to the control group (3.3%), mCherry + EGFP + mCherry — EGFP + and mCherry + EGFP —The cell percentage increased to 25.46% compared to the control group (SpCas9+Donor), indicating that the combination of dCas12iMax and the Cas9 system can improve the precision knock-in efficiency by approximately 3.2 times and the overall knock-in efficiency by 2.25 times compared to the Cas9 single system. Figure 3 ).

[0088] Based on the above results, the proportion of precise knock-in efficiency in the total knock-in efficiency was further calculated. The results showed that the precise knock-in efficiency and total knock-in efficiency of the crRNA4+crRNA7 group were lower than those of the crRNA5+crRNA8 group, but the proportion of precise knock-in efficiency in the total knock-in efficiency of the crRNA4+crRNA7 group was higher than that of the crRNA5+crRNA8 group. This indicates that the dCas12iMax and Cas9 dual system is mainly used to improve precise knock-in efficiency. Figure 4 ).

[0089] To further validate the advantages of this system, we constructed a Donor2 vector, which is used in the transfection system listed in Table 7-9 to verify precise integration of single-function genes and assess gene knock-in efficiency. + Positive cells represent precise knock-in, mCherry — Representing negative cells. Flow cytometry analysis showed that, compared to the Cas9 single-system, the combination of dCas12iMax and Cas9 significantly improved the precise knock-in efficiency, with the crRNA2+crRNA7 group showing the most significant improvement in precise knock-in efficiency. + The cell percentage increased to 14.9% compared to the control group (11.3%), indicating that the combination of dCas12iMax and the Cas9 system improves precise knock-in efficiency by approximately 1.32 times compared to the Cas9 single system. Figure 5 ).

[0090] In summary, the Cas9+dCas12iMax system developed in this invention achieves a breakthrough improvement in the efficiency of precise gene knock-in, providing a powerful tool for gene function research and disease model construction, and showing significant potential in the field of gene therapy.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A vector for improving gene knock-in efficiency, characterized in that, include: Gene knockout vectors, helper knock-in vectors, and donor template vectors; The gene knockout vector includes an sgRNA targeting a non-human animal gene and a knockout vector backbone; the sgRNA contains a nucleotide sequence complementary to the non-human animal gene; the knockout vector backbone contains a sequence encoding a Cas protein, which has cleavage activity. The assist knock-in vector comprises: crRNA targeting the 5' homologous arm and / or 3' homologous arm of the donor template and an assist knock-in vector backbone; the crRNA contains a nucleotide sequence complementary to the 5' homologous arm and / or 3' homologous arm of the donor template; the assist knock-in vector backbone contains a sequence encoding a cleavage enzyme-inactivating Cas protein, the cleavage enzyme-inactivating Cas protein forming a ribonucleoprotein complex with the crRNA to achieve the assist knock-in function. The donor template carrier includes: a donor template containing a 5' homologous arm and a 3' homologous arm, and a donor template carrier skeleton.

2. The vector for improving gene knock-in efficiency according to claim 1, characterized in that, The Cas protein is a SpCas9 nuclease with cleavage activity; the cleavage enzyme-inactivated Cas protein is dCas12iMax, and contains the E833A inactivation mutation.

3. The vector for improving gene knock-in efficiency according to claim 1, characterized in that, The knockout vector backbone is PX459, and the gene knockout vector is PX459-sgRNA; the helper knock-in vector backbone is pCAG-dCas12iMax-T2A-BSD-U6, and the helper knock-in vector is pCAG-dCas12iMax-T2A-BSD-U6-crRNA.

4. The vector for improving gene knock-in efficiency according to claim 1, characterized in that, The donor template containing a 5' homologous arm and a 3' homologous arm includes either a donor template for validating the dual function of precise and random integration or a donor template for validating the single function of precise integration. The donor template used to verify the dual function of precise and random integration contains the following elements from the 5' to 3' ends in sequence: a 5' homologous arm, a self-cleaving peptide coding sequence, a red fluorescent protein coding sequence, a termination signal, a promoter, a hygromycin resistance gene, a self-cleaving peptide coding sequence, an enhanced green fluorescent protein coding sequence, a termination signal, and a 3' homologous arm; The donor template used to verify the precise integration of the monofunctional control contains the following elements from the 5' to 3' ends in sequence: a 5' homologous arm, a self-cleaving peptide coding sequence, a red fluorescent protein coding sequence, a termination signal, a 3' homologous arm, a promoter, a hygromycin resistance gene, and a termination signal; The donor template carrier skeleton is pMD-19T.

5. The vector for improving gene knock-in efficiency according to claim 1, characterized in that, The non-human animal target gene is the mouse β-actin gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1; the crRNA sequence targeting the 5' homologous arm of the donor template is any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5; the crRNA sequence targeting the 3' homologous arm of the donor template is any one of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO:

9.

6. The vector for improving gene knock-in efficiency according to claim 5, characterized in that, The 3' homologous arm sequence of the donor template is shown in SEQ ID NO: 18, and the 5' homologous arm sequence of the donor template is shown in SEQ ID NO:

10.

7. A method for improving gene knock-in efficiency, characterized in that, Includes the following steps: Design and screen sgRNAs that target genes in non-human animals, and construct gene knockout vectors; Design and screen crRNAs within the 5' and / or 3' homologous arms of the donor template, and construct helper knock-in vectors; Construct a donor template carrier for knock-in; Gene knockout vector, helper knock-in vector and donor template vector were co-transfected into recipient cells, and gene knock-in was verified by flow cytometry after antibiotic screening.

8. A method for verifying the efficiency of precise gene knock-in, characterized in that, Includes the following steps: Design and screen sgRNAs that target genes in non-human animals, and construct gene knockout vectors; Design and screen crRNAs within the 5' and / or 3' homologous arms of the donor template, and construct helper knock-in vectors; Construct a donor template carrier for validating both precise and random integration functions; Construct a donor template vector for validating precise integration of single-function controls; Gene knockout vector, helper knock-in vector, and donor template vector for verifying both precise and random integration or donor template vector for verifying precise integration as a single-function control were co-transfected into recipient cells. After antibiotic screening, gene knock-in efficiency was verified by flow cytometry.

9. The method for verifying the efficiency of precise gene knock-in according to claim 8, characterized in that, The donor template used to validate the dual function of precise and random integration contains the following elements sequentially from the 5' to the 3' end: a 5' homologous arm, a self-cleaving peptide coding sequence, a red fluorescent protein coding sequence, a termination signal, a promoter, a hygromycin resistance gene, a self-cleaving peptide coding sequence, an enhanced green fluorescent protein coding sequence, a termination signal, and a 3' homologous arm.

10. The method for verifying the efficiency of precise gene knock-in according to claim 8, characterized in that, The donor template used to validate the precise integration of the monofunctional control contains the following elements sequentially from the 5' to the 3' end: a 5' homologous arm, a self-cleaving peptide coding sequence, a red fluorescent protein coding sequence, a termination signal, a 3' homologous arm, a promoter, a hygromycin resistance gene, and a termination signal.