System, kit and detection method for rapidly detecting helicobacter pylori by one-pot method

Abstract

The invention provides a system, a kit and a detection method for rapidly detecting helicobacter pylori by a one-pot method, the kit integrates RPA amplification, transcription of product DNA into RNA, transcription of a T7 / crDNA hybrid chain into crRNA and CRISPR / Cas13a cis-cleavage reaction, and a one-step reaction system is established. The kit disclosed by the invention can specifically recognize helicobacter pylori within 30 minutes without independently preparing crRNA, so that the reagent cost is reduced, the experimental process is simplified, uncovering operation is not needed, and cross contamination is avoided; the detection limit of the kit is 1 copies / [mu] L, no cross reaction exists, and the result of the kit is consistent with that of a Sanger sequencing method in a clinical sample.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a system, kit, and detection method for rapid one-pot detection of Helicobacter pylori. Background Technology

[0002] Helicobacter pylori (H. pylori or HP) is a highly contagious Gram-negative spiral-shaped bacterium that is primarily transmitted from person to person via oral-oral and fecal-oral routes. In my country, the infection rate of H. pylori is approximately 50%–60%, varying by region; in less developed areas, the infection rate may exceed 60%. Most patients infected with H. pylori do not experience obvious clinical symptoms. However, some patients may develop gastrointestinal lesions, leading to chronic gastritis, peptic ulcers, gastric mucosa-associated lymphoid tissue lymphoma, and even gastric cancer. It has been classified as a carcinogen by the International Agency for Research on Cancer.

[0003] Currently, the main methods used clinically for H. pylori detection are culture and sequencing. Culture requires culturing H. pylori, which is complex, time-consuming, and not always successful. Sequencing is complex, has a long detection cycle, and relatively low sensitivity. Real-time quantitative PCR (qPCR) is one of the most important and widely used techniques for DNA detection. It is stable, reproducible, and has high sensitivity and specificity; however, this method typically requires trained professionals to operate specialized, large-scale equipment, hindering its widespread adoption in grassroots testing.

[0004] In recent years, CRISPR / Cas technology has shown great promise in pathogen diagnosis, personalized molecular detection of tumors, SNP identification, and detection of genetic diseases. Combining isothermal amplification techniques such as RPA with CRISPR / Cas technology can meet the needs of rapid on-site detection. In the CRISPR / Cas13 system, CRISPR RNA (crRNA) is the core guiding element and activation switch. However, due to the high degradation rate of RNA, it is difficult to preserve it for long periods after addition to the reaction system, which is a major challenge and pain point in the practical application of CRISPR / Cas technology. Therefore, there is an urgent need for a simple, stable, reliable, and highly sensitive method for detecting H. pylori. Summary of the Invention

[0005] This invention proposes a one-pot rapid detection system, kit, and detection method for Helicobacter pylori. This method eliminates the need for separate preparation of crRNA. Instead, it utilizes the T7 transcription system in the one-pot system to simultaneously transcribe the T7 / crDNA hybrid strand into crRNA, performing transcription and detection simultaneously. This simplifies the operation and also solves the problem of crRNA instability.

[0006] The technical solution of the present invention is implemented as follows: a one-pot rapid detection system for Helicobacter pylori includes RPA amplification primers for detecting the H. pylori 16S rRNA gene and a T7 / crDNA hybrid strand for transcribing the crRNA that recognizes the H. pylori 16S rRNA gene; The RPA amplification primers for detecting the H. pylori 16S rRNA gene include an upstream primer RPA-F and a downstream primer RPA-R. The nucleotide sequence of the upstream primer RPA-F is any one of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, and the nucleotide sequence of the downstream primer RPA-R is any one of SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6.

[0007] The T7 / crDNA hybrid strand is formed by mixing T7 primer (T7 promoter primer) and crDNA in a 1:1 molar ratio and then denaturing and annealing at high temperature. The nucleotide sequence of the T7 primer is SEQ ID NO. 7, and the nucleotide sequence of the crDNA is any one of SEQ ID NO. 8, SEQ ID NO. 9, or SEQ ID NO. 10.

[0008] Furthermore, the nucleotide sequence of the upstream primer RPA-F is SEQ ID NO. 2, the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO. 5, and the nucleotide sequence of the crDNA is SEQ ID NO. 8.

[0009] A kit for rapid detection of Helicobacter pylori using a one-pot method, comprising the aforementioned system.

[0010] Furthermore, it also includes U5, whose nucleotide sequence is SEQ ID NO. 11. U5 has the fluorescent gene FAM at its 5' end and the quencher group BHQ1 at its 3' end.

[0011] The downstream primer RPA-R is based on the conventional RPA primer, with a T7 promoter complementary sequence added to the 5' end, so that during amplification, the T7 RNA polymerase can transcribe the amplified product DNA into RNA, which can be recognized by CRISPR / Cas13a and trans-cleaved by U5.

[0012] Furthermore, the detection kit includes 200-800 nM upstream primer RPA-F, 200-800 nM downstream primer RPA-R, 500 nM U5, 0.25-2 U / μL T7 RNA polymerase, 25-200 nM Cas13a, 0.375-12 nM T7 / crDNA hybrid strand, 0.5-4 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

[0013] Furthermore, the detection kit includes 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM T7 / crDNA hybrid strand, 2 mM rNTPmix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

[0014] The one-pot rapid detection method for Helicobacter pylori includes the following steps: Nucleic acid is extracted from the sample to be tested as a DNA template. The DNA template is mixed with the detection kit and then incubated. During the incubation process, the signal is collected at set time intervals. The signal acquisition method is as follows: FAM fluorescence signals are acquired at a wavelength of 465-510 nm. By observing the FAM fluorescence, the type of the sample to be tested is determined. If it is green fluorescence and there is a significant difference compared with the negative control, it is determined that the sample contains H. pylori DNA. If it does not emit light and the fluorescence value is not significantly different from the negative control, it is determined that the sample does not contain H. pylori DNA.

[0015] Furthermore, the incubation conditions are: 37 ℃ for 30-60 min.

[0016] Furthermore, the time is set to 30-60 seconds.

[0017] The beneficial effects of this invention are: This invention proposes a one-pot rapid detection system, kit, and method for H. pylori. It integrates RPA amplification, transcription of product DNA into RNA, transcription of T7 / crDNA hybrid strands into crRNA, and CRISPR / Cas13a cis-cleavage reaction into a single step-by-step reaction system. This method eliminates the need for separate crRNA preparation; instead, it utilizes the T7 transcription system within the one-pot system to simultaneously transcribe the T7 / crDNA hybrid strand into crRNA, allowing for simultaneous transcription and detection. This simplifies the operation and also solves the problem of crRNA instability.

[0018] This invention allows for simultaneous RPA amplification, target gene RNA transcription, crRNA transcription, and CRISPR detection within a single tube after the extracted DNA template is added to the detection system, eliminating the need for opening the tube. It eliminates the need for sophisticated and expensive instruments, and H. pylori samples can be detected within 30 minutes at 37 °C. This achieves rapid, simple, highly sensitive, and highly specific detection, reduces reagent costs, simplifies the experimental procedure, and avoids cross-contamination by eliminating the need for opening the tube.

[0019] The detection system of the present invention has a detection limit of 1 copies / μL, no cross-reactivity, and is 100% consistent with the results of Sanger sequencing in clinical samples. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a schematic diagram illustrating the principle of the one-pot rapid detection of H. pylori according to the present invention; Figure 2 The image shows the RPA primers and crRNA screening results for detecting the H. pylori 16S rRNA gene. Figure 3 Figure showing the results of T7 / crDNA concentration optimization and detection performance comparison; Figure 4 The figure shows the sensitivity and specificity test results of the kit for detecting the H. pylori 16S rRNA gene. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0024] In the following examples, Cas13a is a product of Tolo Harbour Company, with product number 32117-01.

[0025] The T7 RNA polymerase used in the following examples is a product of New England Biolabs, catalog number M0251.

[0026] The rNTP mix used in the following examples is a product of New England Biolabs, catalog number N0466L.

[0027] The recombinant RNase inhibitor used in the following examples is a product of Wuhan Saiweier Biotechnology Co., Ltd., catalog number G3414.

[0028] The RPA lyophilized powder, RPA resuspension (RPA Basic E-mix), and 280 mM magnesium acetate (MgOAc) in the following examples are TwistDx TM Product number: TABAS03KIT.

[0029] The U5 in the following embodiments was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0030] The primers and crRNA preparation templates used in the following examples were synthesized by Jiangsu Saisofi Company.

[0031] Note: The crRNA described in this invention is prepared by in vitro transcription. Specifically, the in vitro transcription of crRNA mainly includes three steps: annealing hybridization reaction, transcription, and RNA purification, as follows: (1) Preparation of T7 / crDNA hybrid strand: The 10 µL annealing reaction system contained 1 µL of chemically synthesized crDNA (100 µM), 1 µL of T7 primer (sequence: GAAATTAATACGACTCACTATAGGG) (100 µM) or 1 µL of crDNA complementary strand (100 µM), 1 µL of Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7 µL of enzyme-free sterile water (purchased from Solarbio, catalog number R1600); the reaction system was denatured at 95 °C for 5 min on an ABI PCR instrument (Thermo, model: Veriti96), and then annealed to 4 °C at a cooling rate of 0.1 °C / s.

[0032] (2) Transcription of crRNA: The HiScribe™ T7 Rapid and Efficient RNA Synthesis Kit (purchased from New England Biolabs, catalog number E2040) was used to transcribe the annealing reaction product according to the manufacturer's instructions and incubate it in a metal bath at 37 °C for 8-12 h.

[0033] (3) RNA purification: Deoxyribonuclease (purchased from Promega, catalog number M6101) was used to degrade excess DNA in the transcription product. Subsequently, according to the manufacturer's instructions, the RNA obtained from transcription was purified using the RNA Clean & Concentrator-5 Kit (purchased from ZYMO, catalog number R1013) to complete the preparation of crRNA. The prepared crRNA was quantified using a NanoDrop™ One ultra-micro spectrophotometer (Thermo, model: NanoDrop One) and stored at -80 ℃ for long-term use.

[0034] Preparation of double-stranded crDNA: Double-stranded crDNA annealing hybridization reaction: The 10 µL annealing reaction system contained 1 µL of chemically synthesized crDNA (100 µM), 1 µL of T7 primer (sequence: GAAATTAATACGACTCACTATAGGG) (100 µM) or 1 µL of crDNA complementary strand (100 µM) (the nucleotide sequence of the crDNA1 complementary strand is SEQ ID NO. 12), 1 µL of Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7 µL of enzyme-free sterile water (purchased from Solarbio, catalog number R1600); the reaction system was denatured at 95 °C for 5 min on an ABI PCR instrument (Thermo, model: Veriti96), and then annealed to 4 °C at a cooling rate of 0.1 °C / s.

[0035] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0036] The following examples used GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The Two-tailed Student's t test was used. P < 0.0001 (****), P < 0.001 (***), P < 0.01 (**), P < 0.05 (*), and NS indicates that P > 0.05 is not statistically significant.

[0037] I. Design and synthesis of target crRNA The 16S rRNA gene sequence of *H. pylori* was obtained from GenBank (GenBank ID: OQ748123). Detection sites were selected from the conserved sequence of the 16S rRNA gene to design multiple crRNAs for the Cas13a protein. As shown in Table 1, the crRNAs of the 16S rRNA gene are: SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10 in Sequence Listing 2.

[0038] Table 1. crRNA prepared by in vitro transcription

[0039] II. Design and synthesis of RPA amplification primers Based on the above-mentioned H. pylori 16S rRNA gene sequence, upstream primer RPA-F and downstream primer RPA-R were designed for RPA amplification. A T7 promoter complementary sequence was added to the 5' end of the downstream primer to generate an ssRNA sequence that can be recognized and cleaved by Cas13a. The upstream primer pair RPA-F for the 16S rRNA gene is SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 in Sequence Listing 2; the downstream primer pair RPA-R for the 16S rRNA gene is SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6 in Sequence Listing 2.

[0040] Table 2 RPA primer sequences and crRNA sequences

[0041] Note: The straight line represents the repeating sequence, and the wavy line represents the complementary sequence of the T7 promoter.

[0042] III. Rapid DNA Extraction H. pylori DNA was extracted using a rapid nucleic acid extraction kit (KAPA, catalog number: KK7101) following the kit instructions. The extracted DNA was stored at -20 °C.

[0043] IV. RPA-crRNA-CRISPR / Cas13a reaction The 10 μL reaction system for detecting the H. pylori 16S rRNA gene (referred to as the crRNA system) included 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 100 nM crRNA, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc. Afterwards, DNA template was added to the detection kit, and the reaction was carried out at 37 °C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0044] V. RPA-double-stranded crDNA-CRISPR / Cas13a reaction The reaction system for detecting the H. pylori 16S rRNA gene (referred to as the double-stranded crDNA system) in 10 μL consisted of 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM double-stranded crDNA, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc. Afterward, DNA template was added to the detection kit, and the reaction was carried out at 37°C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0045] VI. RPA-T7 / crDNA-CRISPR / Cas13a reaction The reaction system for detecting the H. pylori 16S rRNA gene (referred to as the T7 / crDNA hybridization system) consisted of 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nM T7 / crDNA hybridization strand, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc. DNA template was then added to the detection kit, and the reaction was performed at 37°C for 30 min on a Bio-Rad CFX96 real-time PCR instrument. FAM fluorescence signals were collected every 1 min at wavelengths of 465-510 nm.

[0046] VII. Result Interpretation The type of sample to be tested is determined by observing the FAM fluorescence. If there is FAM fluorescence and it is significantly different from the negative control, the sample is judged to contain H. pylori DNA. If there is no fluorescence and the fluorescence value is not significantly different from the negative control, the sample is judged not to contain H. pylori DNA.

[0047] The RPA-crRNA-CRISPR / Cas13a reaction system was used to screen RPA amplification primers and crRNA: The RPA amplification primers F1~F3, R1~R3 ​​and crRNA1-3 of the prepared H. pylori 16S rRNA were screened (sequences are shown in Table 2). Figure 2The image shows the RPA primer and crRNA screening results for detecting the H. pylori 16S rRNA gene; F1~F3 are abbreviations for RPA-F1~F3, and R1~R3 ​​are abbreviations for RPA-R1~R3, as shown below. Figure 2 As shown, the highest endpoint fluorescence value (30 min) was obtained in the combination of RPA amplification primer pair F2 / R2 and crRNA1 for detecting H. pylori positive samples, while no fluorescence signal was observed in negative samples. Therefore, SEQ ID NO. 8 and primer pair F2 / R2 (SEQ ID NO. 2 / SEQ ID NO. 5) were selected for the RPA-CRISPR / Cas13a reaction of H. pylori 16S rRNA.

[0048] T7 / crDNA Concentration Optimization and Performance Comparison: In the RPA-CRISPR / Cas13a detection system, CRISPR activation requires two RNA components: target RNA and crRNA. T7 transcription provides target RNA using a double-stranded DNA template with a sequence complementary to the T7 promoter. We investigated whether the same mechanism could be used for crRNA preparation, which would further link T7 transcription with the CRISPR reaction.

[0049] Therefore, a hybrid strand of crDNA and T7 primers, containing a crRNA targeting H. pylori and a complementary sequence to the T7 promoter, was introduced into the RPA-CRISPR / Cas13a system, suggesting that T7 transcription can directly utilize the T7 / crDNA template to synthesize crRNA. Figure 3 A). Literature reports that the T7 transcription system can also provide target region crRNA by using double-stranded DNA templates (crDNAds) with complementary sequences to the T7 promoter. Figure 3 B), and a performance comparison was performed simultaneously here.

[0050] Without the addition of crRNA, we tested RPA-CRISPR / Cas13a detection with different concentrations of T7 / crDNA hybrid strands, and all of them produced signal amplification. Figure 3 C), Figure 3 C represents the detection result of the T7 / crDNA hybridization system. Figure 3 The left image (C) shows the fluorescence curve of H. pylori 16S rRNA detected by RPA-CRISPR / Cas13a. Figure 3 The right figure (C) shows the endpoint relative fluorescence units obtained after 30 min of RPA-CRISPR / Cas13a detection of H. pylori 16S rRNA. The results indicate that the RPA-CRISPR / Cas13a reaction system exhibits optimal detection performance under the 1.5 nMT7 / crDNA hybridization strand condition.

[0051] Figure 3 D represents the fluorescence detection results for the crRNA system (corresponding to crRNA), double-stranded crDNA system (corresponding to crDNAds), and T7 / crDNA hybrid system (corresponding to T7 / crDNA). NTC represents the control group, and HP represents the experimental group. Under the optimal concentration conditions selected from the T7 / crDNA hybrid system, [the following is a continuation of the process]. Figure 3 As shown in D, the T7 / crDNA hybrid strand and double-stranded crDNA exhibited higher fluorescence signals in the RPA-CRISPR / Cas13a reaction for detecting the H. pylori 16SrRNA gene.

[0052] The results indicate that T7 / crDNA can serve as a functional substitute for crRNA in the presence of T7 transcription. In the RPA-CRISPR / Cas13a system, the T7 / crDNA strategy thus establishes a new positive synergistic effect between T7 transcription and CRISPR. More broadly, the advantage of achieving in-situ real-time generation and supply of crRNA via T7 / crDNA can be applied to all CRISPR detection systems compatible with T7 transcription. Compared to crRNA and crDNAds, this technology promises to reduce the operational difficulty, complexity, and cost associated with RNA use, while improving the ease of detection and user experience.

[0053] Sensitivity and specificity tests of the detection kit (one-pot RPA-T7 / crDNA-CRISPR / Cas13a) To determine the sensitivity of the one-pot RPA-T7 / crDNA-CRISPR / Cas13a reaction for H. pylori 16S rRNA, H. pylori positive samples (H. pylori DNA concentration determined by digital PCR) were serially diluted to the set concentrations and detected according to the optimized detection system. Results are as follows: Figure 4 As shown in Figure A, for the detection of H. pylori 16S rRNA, the fluorescence signal after 30 min amplification of templates with a concentration of 1 copeis / μL or higher was significantly higher than that of the negative control group NTC. This indicates that the H. pylori detection system based on the one-pot RPA-T7 / crDNA-CRISPR / Cas13a established in this invention can detect samples with a concentration of 1 copeis / μL or higher and has high sensitivity.

[0054] To determine the specificity of the one-pot RPA-T7 / crDNA-CRISPR / Cas13a reaction for detecting H. pylori, the optimal formulation of the H. pylori 16S rRNA detection reagent established in this study was used to specifically detect H. pylori samples, Escherichia coli, Staphylococcus aureus, Salmonella, Campylobacter jejuni, enteric adenovirus (EAdv), rotavirus, and norovirus stored in our laboratory. The results are as follows: Figure 4 As shown in B, the method established in this study detected no positive reactions in other common bacteria and virus samples from the digestive tract, indicating that the method has good specificity and will not produce false positive fluorescence signals.

[0055] Clinical sample validation of the detection kit (one-pot RPA-T7 / crDNA-CRISPR / Cas13a) To explore the clinical applicability of this method, 48 clinical samples were collected in this application and tested according to the optimized detection system. The results are shown in Table 3. The results show that all samples were accurately identified. The detection results of the clinical samples by the method described in this application are completely consistent with those of the Sanger sequencing method, indicating that this method can not only meet the clinical testing needs, but also has the advantages of short detection time and convenient operation.

[0056] Table 3. Validation results of clinical samples detected by Sanger sequencing and the one-pot method of this application for detecting H. pylori.

[0057] The Sanger sequencing method used in this study to detect H. pylori 16S rRNA served as a control for the one-pot RPA-T7 / crDNA-CRISPR / Cas13a detection method. Sanger sequencing of 48 H. pylori samples was commissioned to Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0058] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A system for rapid one-pot detection of Helicobacter pylori, characterized in that: This includes RPA amplification primers for detecting the H. pylori 16S rRNA gene and T7 / crDNA hybrid strands for transcribing the crRNA that recognizes the H. pylori 16S rRNA gene.

2. The system according to claim 1, characterized in that: RPA amplification primers include upstream primer RPA-F and downstream primer RPA-R. The nucleotide sequence of upstream primer RPA-F is any one of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, and the nucleotide sequence of downstream primer RPA-R is any one of SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO.

6.

3. The system according to claim 2, characterized in that: The T7 / crDNA hybrid strand is formed by mixing T7 primer and crDNA in a 1:1 molar ratio and then denaturing and annealing at high temperature. The nucleotide sequence of the T7 primer is SEQ ID NO. 7, and the nucleotide sequence of the crDNA is any one of SEQ ID NO. 8, SEQ ID NO. 9, or SEQ ID NO.

10.

4. The system according to claim 3, characterized in that: The nucleotide sequence of the upstream primer RPA-F is SEQ ID NO.2, the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO.5, and the nucleotide sequence of the crDNA is SEQ ID NO.

8.

5. A kit for rapid one-pot detection of Helicobacter pylori, characterized in that: Includes the system described in any one of claims 1-4.

6. The reagent kit according to claim 5, characterized in that: The kit also includes U5, whose nucleotide sequence is SEQ ID NO.

11. U5 has the fluorescent gene FAM at its 5' end and the quencher group BHQ1 at its 3' end.

7. The reagent kit according to claim 6, characterized in that: The kit includes 200-800 nM upstream primer RPA-F, 200-800 nM downstream primer RPA-R, 500 nM U5, 0.25-2 U / μL T7 RNA polymerase, 25-200 nM Cas13a, 0.375-12 nM T7 / crDNA hybrid strand, 0.5-4 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

8. The reagent kit according to claim 7, characterized in that: The detection kit includes 400 nM upstream primer RPA-F, 400 nM downstream primer RPA-R, 500 nM U5, 1 U / μL T7 RNA polymerase, 50 nM Cas13a, 1.5 nMT7 / crDNA hybrid strand, 2 mM rNTP mix, 1 U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix, and 14 mM MgOAc.

9. A one-pot rapid detection method for Helicobacter pylori, characterized in that, Includes the following steps: Nucleic acid is extracted from the sample to be tested as a DNA template, the DNA template is mixed with the detection kit according to any one of claims 5-8, and then incubated. During the incubation process, the signal is collected at set time intervals. The signal acquisition method is as follows: FAM fluorescence signals are acquired at a wavelength of 465-510 nm. By observing the FAM fluorescence, the type of the sample to be tested is determined. If it is green fluorescence and there is a significant difference compared with the negative control, it is determined that the sample contains H. pylori DNA. If it does not emit light and the fluorescence value is not significantly different from the negative control, it is determined that the sample does not contain H. pylori DNA.

10. The detection method according to claim 9, characterized in that, The incubation conditions are: 37 ℃ for 30-60 min.

Images