Screening of tanshinone IIA-responsive transcriptome biomarker and application of tanshinone IIA-responsive transcriptome biomarker in sepsis diagnosis and treatment kit

Abstract

The invention discloses screening of transcriptome biomarkers responsive to tanshinone IIA and application of the transcriptome biomarkers in sepsis diagnosis and treatment kits. Tanshinone IIA (TSA) inhibits an SAMSN1 gene in a targeted manner by up-regulating expression of mmu-miR-1896, so that an NRF2 / KEAP1 antioxidant pathway is activated, and GSDMD-mediated pyroptosis is inhibited, thereby reducing multi-organ injury. 10-20 mg / kg of TSA can significantly improve the alveolar structure of the LPS model and reduce inflammatory factors. A kit which is developed on the basis of the mechanism and is used for detecting the expression levels of mmu-miR-1896, SAMSN1 and NRF2-Kea1-GSDMD can be used for evaluating the curative effect.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to the screening of transcriptomic biomarkers for tanshinone IIA response and their application in sepsis diagnostic kits. Background Technology

[0002] The pathogenesis of sepsis-induced acute lung injury (S-ALI) is complex, involving multiple pathological processes such as excessive inflammation, oxidative stress, and pyroptosis. Its exact therapeutic targets remain unclear, which seriously affects clinical efficacy and research progress. There is an urgent need to explore new and effective intervention strategies and molecular targets.

[0003] Tanshinone IIA (TSA), the core active ingredient of tanshinone, has been shown to have significant anti-inflammatory and multi-organ protective effects. However, the specific mechanism by which it alleviates septic lung injury—especially the pathway through which it regulates signaling pathways via microRNA (miRNA)—still needs further in-depth analysis.

[0004] MicroRNAs (miRNAs) are key post-transcriptional regulators of gene expression, participating in the regulation of various biological processes such as cell proliferation, differentiation, and apoptosis by inducing mRNA degradation or translational repression. Previous studies have shown that the pharmacological effects of TSA are closely related to the miRNA regulatory network. Specifically:

[0005] TSA can reduce lung tissue inflammation by inhibiting miR-155 and thus inhibiting NLRP3 inflammasome activation.

[0006] TSA can downregulate miR-21 expression through the SIRT1 / Sestrin2 / HO-1 signaling axis, thereby alleviating hepatocyte oxidative stress and apoptosis.

[0007] TSA can also modulate apoptosis-related miRNAs targeting the Bcl-2 / Bax / p53 pathway to improve sepsis-related multiple organ dysfunction.

[0008] Sepsis-related ALI is a high-mortality complication in intensive care. Existing treatments (such as antibiotics and glucocorticoids) have two major shortcomings: insufficient targeting: broad-spectrum antibiotics cannot accurately suppress excessive inflammatory responses, and patients are prone to developing drug resistance; traditional anti-inflammatory drugs only block downstream factors such as TNF-α / IL-6, without addressing the core pathology of the vicious cycle of "oxidative stress-pyroptosis". Summary of the Invention

[0009] The purpose of this invention is to provide a transcriptomic biomarker screening method for tanshinone IIA response and its application in sepsis diagnostic kits. This invention identifies differentially expressed genes Irak3, SAMSN1, Trbc1, and Tmt1b in sepsis-induced acute lung injury through bioinformatics analysis. Further experimental verification confirmed that SAMSN1 is a key target gene. Candidate miRNAs targeting the SAMSN1 3'UTR were screened using TargetScan and the miRBase database, including miR-1896, miR-1892, and miR-302c-5p. Dual-luciferase reporter gene assays and qPCR verification confirmed that miR-1896 specifically binds to the SAMSN1 3'UTR. Transfection with miR-1896 mimic significantly inhibited SAMSN1 expression and activated the NRF2 pathway, indicating that we have successfully constructed the miR-1896 / SAMSN1 / NRF2 signaling axis. By constructing a lipopolysaccharide (LPS)-induced acute lung injury (ALI) model and a RAW264.7 macrophage inflammation model in mice, and after successful model establishment, intervention with gradient concentrations of tanshinone IIA (TSA) was administered. The results demonstrated that TSA antagonizes the LPS-induced macrophage inflammatory cascade by activating mmu-miR-1896 → targeting and inhibiting SAMSN1 → regulating the NRF2 / Keap1 / GSDMD signaling axis.

[0010] To achieve the above objectives, the present invention employs the following technical means:

[0011] This invention provides a biomarker for detecting sepsis-induced acute lung injury (ALI), the biomarker being SAMSN1. The biomarker encompasses its gene, mRNA, and protein.

[0012] The present invention also provides a kit for detecting the expression level of the SAMSN1 gene, the kit comprising primers and / or probes for detecting the expression level of the SAMSN1 gene, and reagents for extracting and amplifying RNA.

[0013] The kit also includes primers and / or probes for detecting the expression level of mmu-miR-1896, as well as reagents for extracting and amplifying miRNA.

[0014] Use of tanshinone IIA in the preparation of drugs for the treatment of sepsis-induced acute lung injury (ALI).

[0015] A pharmaceutical composition for improving sepsis-induced acute lung injury, the pharmaceutical composition comprising tanshinone IIA as the active ingredient, and a pharmaceutically acceptable carrier or excipient; the dosage range of tanshinone IIA is 10 mg / kg to 20 mg / kg.

[0016] The pharmaceutical composition also includes other active ingredients that can enhance mmu-miR-1896 expression or inhibit SAMSN1 expression.

[0017] A method for detecting and evaluating biomarkers for sepsis-induced acute lung injury, the method comprising detecting the expression levels of the SAMSN1 gene and / or mmu-miR-1896 in a sample.

[0018] The sample is the patient's blood, tissue, or other biological sample.

[0019] The method also includes detecting the expression levels of NRF2, Keap1, and GSDMD.

[0020] The beneficial effects obtained by this invention are:

[0021] 1. The differentially expressed gene SAMSN1 in sepsis-induced acute lung injury was identified.

[0022] 2. It was confirmed that mmu-miR-1896 can specifically bind to the 3'UTR of SAMSN1, and transfection with its mimic significantly inhibits SAMSN1 expression and activates the NRF2 pathway, thereby constructing the mmu-miR-1896 / SAMSN1 / NRF2 signaling axis.

[0023] 3. It was found that TSA antagonizes the LPS-induced macrophage inflammatory cascade by activating mmu-miR-1896 → targeting and inhibiting SAMSN1 → regulating the NRF2 / Keap1 / GSDMD signaling axis. Attached Figure Description

[0024] Figure 1 It is a bioinformatics screening and validation process for differentially expressed genes.

[0025] Figure 2 It is a comparison of the intersection of differentially expressed genes in newborns, children and adults.

[0026] Figure 3 It is a Venn diagram of the intersection of differentially expressed genomes among newborns, children, and adults.

[0027] Figure 4 This is the screening result for |log2FC|>1 among 64 differentially expressed genes (this result is the screening result for p<0.05 and |log2FC|>1).

[0028] Figure 5 These are the results of expression detection of the preselected genes SAMSN1, TRBC1, and TMTIB.

[0029] Figure 6This is the overlap and difference results of the predictions from Targetscan and miRwalk.

[0030] Figure 7 This is the predicted affinity of miRNA to SAMSN1.

[0031] Figure 8 The effect of different concentrations of tanshinone IIA on the viability of RAW264.7 cells.

[0032] Figure 9 These are the results of detecting RAW264.7 cells in each treatment group using the DCFH-DA fluorescent probe method.

[0033] Figure 10 This is a graph showing the effect of tanshinone IIA on the apoptosis level of RAW264.7 cells.

[0034] Figure 11 This figure shows the effect of different concentrations of tanshinone IIA on the level of LPS-induced apoptosis in RAW264.7 cells.

[0035] Figure 12 This image shows the results of live and dead staining of RAW264.7 cells treated with LPS at different concentrations of tanshinone IIA.

[0036] Figure 13 These are the results of LPS-induced JC-1 staining experiments on RAW264.7 cells treated with different concentrations of tanshinone IIA.

[0037] Figure 14 The results are from a live-dead cell staining experiment performed on RAW264.7 cells from the same batch at a concentration of 5-15 μg / μL tanshinone.

[0038] Figure 15 Tanshinone upregulates the expression of the SAMSN1 gene in RAW264.7 cells.

[0039] Figure 16 This is the result of TSA upregulating miR-1896 expression in RAW264.7 cells stimulated by LPS.

[0040] Figure 17 This is a statistical result of the effect of dose-gradient tanshinone IIA on the expression of IL-1β, IL-6, and TNF-α in LPS-induced RAW264.7 cells.

[0041] Figure 18 This is the statistical result of the effect of tanshinone IIA on the dose-gradient expression of miR-1896 and SAMSN1 in LPS-induced RAW264.7 cells.

[0042] Figure 19This study investigated the effect of dose-gradient tanshinone IIA (Tan IIA) on the expression of the Keap1-Nrf2-GSDMD pathway in an LPS-induced sepsis model.

[0043] Figure 20 The effect of miR-1896 mimics on its own expression and the target gene SAMSN1.

[0044] Figure 21 This refers to the regulatory effect of miR-1896 mimics on the expression of Keap1, Nrf2, and Gsdmd genes. Detailed Implementation

[0045] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings.

[0046] 1. Clinical mRNA microarray bioinformatics analysis of sepsis

[0047] This part of the study is based on 14 clinical mRNA microarray datasets for sepsis (GEO database). Bioinformatics analysis was used to screen differentially expressed genes between the normal group and the sepsis group (threshold: p<0.05 and |log2FC|>1), and four candidate genes, Irak3, SAMSN1, Trbc1 and Tmt1b, were identified. Subsequently, in the LPS-induced RAW264.7 cell model, qPCR and Western blotting were used to confirm that SAMSN1 is the key target gene. Further analysis using TargetScan and the miRBase database predicted miRNAs targeting the SAMSN1 3'UTR, identifying three miRNAs: mmu-miR-1896, mmu-miR-1892, and mmu-miR-302c-5p. Dual-luciferase reporter gene assays and subsequent qPCR experiments confirmed that mmu-miR-1896 specifically binds to the SAMSN1 3'UTR, and transfection with its mimic significantly inhibited SAMSN1 expression and activated the NRF2 pathway, thus constructing the mmu-miR-1896 / SAMSN1 / NRF2 signaling axis. The bioinformatics screening and validation process is as follows: Figure 1 As shown.

[0048] The 14 sepsis clinical research gene sets in the GEO database are: GSE32707, GSE26440, GSE25504, GSE10361, GSE69686, GSE131761, GSE4607, GSE28750, GSE9692, GSE40012, GSE13904, GSE54514, GSE26378, and GSE57065.

[0049] By comparing gene expression data between sepsis patients and healthy controls, genes with significantly different expression in sepsis were screened. Ultimately, 192 differentially expressed genes were obtained from the neonatal group, 807 from the pediatric group, and 4157 from the adult group. Taking the intersection of these differentially expressed genes, 64 differentially expressed genes shared by the neonatal, pediatric, and adult groups were identified (e.g., ...). Figure 2 , Figure 3 (As shown).

[0050] The 64 differentially expressed genes were selected based on a threshold of p < 0.05 and |log2FC| > 1, identifying four candidate genes: Irak3, SAMSN1, Trbc1, and Tmt1b. Partial screening results for |log2FC| > 1 are shown below. Figure 4 As shown.

[0051] Differentially expressed genes were analyzed using GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) methods to understand the biological processes and signaling pathways they may be involved in. The results suggest that these genes may be related to the KEAP1-NRF2-GSDMD signaling pathway.

[0052] To validate the above candidate genes, we performed qPCR and Western blotting in an LPS-induced RAW264.7 cell model:

[0053] (1) Cell culture and model establishment

[0054] The mouse mononuclear macrophage leukemia cell line (RAW264.7 cells) used was purchased from Wuhan Pronosei Biotechnology Co., Ltd. Cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. A sepsis cell model was established by stimulation with LPS (1 μg / mL) for 24 hours.

[0055] Before starting the cell resuscitation process, pre-set and maintain the temperature of the constant temperature water bath at 37°C. Then prepare the sterile centrifuge tubes and pre-cooled complete culture medium needed for subsequent operations. Carefully remove the target cryovial from the liquid nitrogen container, immediately use sterilized forceps to hold the top of the tube cap, and quickly transfer and completely immerse it in the preheated 37°C water bath. During the warming process, gently and continuously agitate the cryovial for about 1 minute to ensure the cell cryopreservation solution is uniformly and rapidly heated until completely thawed. After thawing, quickly use a sterile pipette to aspirate all the cell suspension and add it to a 15 mL sterile centrifuge tube containing preheated complete culture medium. Immediately centrifuge at 800 rpm for 5 minutes to allow the cells to clump together. After centrifugation, carefully and steadily remove the centrifuge tube, and carefully discard the supernatant containing the cryopreservation solution in a biosafety cabinet, retaining only the cell pellet at the bottom. Next, add warm, freshly prepared complete culture medium to the cell pellet, and use a sterile pipette to gently aspirate several times until the cell clumps are completely dispersed. Add the cell suspension to a brand new sterile cell culture dish, and gently shake the dish horizontally in multiple directions or in a cross-shaped motion to ensure the cells are distributed as evenly as possible at the bottom. Immediately and clearly label the cell names and detailed resuscitation date and time on the culture dish, and as soon as possible observe the initial state of the cells under an inverted microscope (including morphology, density, and presence of significant fragmentation) to assess their viability.

[0056] After cell resuscitation, the culture dishes were gently transferred to a humidity-controlled incubator set at 37°C with 5% CO2 for static culture. Approximately 24 hours after cell resuscitation, the culture dishes were removed again and carefully examined under an inverted microscope to check cell adhesion and growth. Once it was confirmed that most healthy cells had adhered, the old culture medium containing floating dead cells and debris was carefully aspirated. The cells were then washed with preheated PBS solution, being careful not to apply excessive force and to avoid touching the adherent cells. Then, an equal volume of preheated fresh complete culture medium was slowly added to perform a medium exchange. After the medium exchange, the culture dishes were returned to the 37°C, 5% CO2 incubator for continued routine culture.

[0057] RAW264.7 cells were cultured routinely in a 37°C, 5% CO2 incubator. When the cells reached approximately 90% confluence, they were digested with trypsin for passage or collected for subsequent experiments.

[0058] Collect the mixture of the rinsed cell suspension and the rinsing solution into a 15 mL sterile centrifuge tube, balance the liquid, and then centrifuge the tube at 800 rpm at room temperature for 3 minutes. After centrifugation, carefully remove the centrifuge tube and discard the supernatant containing PBS and impurities in a biosafety cabinet. Add 2 mL of fresh complete culture medium (components: DMEM high-glucose basal medium + 10% heat-inactivated fetal bovine serum + 1% penicillin and antibiotics) to the cell pellet before it is warmed to 37°C in a water bath. Gently resuspend the cells using a 1 mL sterile pipette by repeatedly and slowly pipetting and aspirating 30-40 times. Accurately measure 500 μL of the resuspended cell suspension and inject it into a brand-new culture dish pre-coated with 2 mL of fresh complete culture medium. Then, gently shake the container in a cross-shaped motion 8-10 times on the horizontal surface to ensure that the cells are evenly distributed on the growth surface. Finally, clearly label the cell line name (RAW264.7), passage date, and passage ratio on the outer wall of the container. Transfer the container smoothly into an incubator at 37°C, 5% CO2, and saturated humidity for further culture to obtain a cell population with good proliferation activity and uniform condition.

[0059] Accurately weigh 5 mg of LPS crystals, dissolve them in 5 ml of PBS, vortex thoroughly to prepare 5 ml of LPS stock solution with a concentration of 1 mg / ml. Add RAW264.7 cells at a concentration of 1 × 10⁻⁶. 5 The cells were seeded at a density in 6-well plates and incubated at 37°C in a 5% CO2 incubator. After adhesion was complete, LPS was added 24 hours later to bring the total LPS concentration to 1 μg / ml. After incubation, the cells in each well were observed under a microscope, and the morphological changes of the cells before and after LPS stimulation were recorded, including cell morphology, degree of extension, pseudopodia formation, and cell integrity.

[0060] RAW264.7 cells in good growth condition and logarithmic growth phase were selected and arranged at a density of 2×10⁻⁶ cells / cells. 4Cells were seeded at a density of 10 cells / well in 6-well cell culture plates. Preheated RAW264.7 complete medium was added to each well. The plates were gently shaken horizontally in a cross pattern to ensure even cell distribution. After seeding, the plates were incubated at 37°C with 5% CO2 for 12-16 hours. Once cell confluence reached approximately 60%, experiments could begin. Three groups were set up: a control group (normal complete medium), a model group (1 μg / mL LPS stimulation), and an experimental group (1 μg / mL LPS + gradient concentration TSA treatment). Before modeling and drug treatment, the original medium was discarded. The cell monolayer was gently rinsed twice along the well walls with PBS. Immediately afterward, live / dead cell staining was performed: Staining working solution was prepared according to the instructions of the Calcein AM / PI Animal Cell Viability / Toxicity Assay Kit. 100 μL of staining solution was added to each well to evenly cover the cell layer under light-protected conditions. The plates were then incubated at 37°C for 30 minutes in the dark. After staining, aspirate the staining solution and gently wash the cells 2-3 times with pre-warmed PBS (soaking for 30 seconds each time to thoroughly remove unbound dye). Replace the PBS in each well with 1 mL of PBS and quickly observe under a fluorescence microscope. Select a field of view with good imaging to acquire images and record changes in cell morphology (LPS-activated macrophages typically show pseudopodia extension and spindle-shaped changes). Fluorescence observation should be performed within 1 hour after staining to avoid fluorescence quenching.

[0061] (2) RNA extraction and qPCR validation

[0062] For each well in a six-well plate, administer 1 ml of Trizol reagent at a concentration of 5-10 × 10⁻⁶ ml. 6 Add Trizol reagent to the cells and collect them when they reach approximately 80% confluence in a six-well plate. Add Trizol reagent at a ratio of 1 ml Trizol reagent to 50-100 mg tissue. The tissue can be pre-frozen in liquid nitrogen and then homogenized, or processed using a homogenizer or tissue homogenizer. Add 200 μL of chloroform to each 1 ml Trizol (half the ratio for animal samples). After capping the EP tube, vigorously invert and mix for about 15 seconds, then incubate at room temperature for 2-3 minutes. Centrifuge at 12000g for 15 minutes at 2-8°C. The solution will separate into three layers; transfer the aqueous phase (RNA) to a new EP tube. Add 500 μL of isopropanol to each 1 ml Trizol, invert and mix, then incubate at room temperature for 10 minutes. Centrifuge at 12000g for 10 minutes at 2-8°C. The resulting white precipitate is the RNA precipitate. Discard the supernatant, add 1 ml of 75% ethanol (per 1 ml Trizol) to wash the RNA precipitate, and centrifuge at 7500g for 5 minutes at 2-8°C. Discard the supernatant, dry the RNA precipitate in a fume hood for 5-10 minutes, and resuspend the precipitate in about 50 μL of enzyme-free water to obtain the RNA solution.

[0063] RNA quality assessment: The 260 / 280 ratio of RNA was measured using a micro spectrophotometer, and the integrity and purity of RNA were checked by agarose gel electrophoresis. The final RNA sample was then sealed and stored at -80 degrees Celsius.

[0064] Using the extracted RNA as a template, reverse transcriptase was used to transcribe the RNA into cDNA:

[0065] Pour out the culture medium from the 6-well plate, wash three times with PBS, and add 1 mL of Trizol lysis buffer to each well (per 10 cm²). 2 Add 1 mL to the surface of the cell and place it horizontally for 1 min to allow the lysis buffer to be evenly distributed on the cell surface and to fully lyse the cells. Then, use a 1 mL pipette to thoroughly pipette the cells to detach them. Aspirate the lysate containing cells and transfer it to a 1.5 mL RNase-free EP tube. Pipette repeatedly until no obvious precipitate is observed in the lysate. Let it stand at room temperature for 5 minutes, then add 0.2 mL of chloroform and vortex vigorously for 30 seconds. Incubate at room temperature for 3 minutes. Centrifuge at 12000 rpm and 4°C for 15 minutes. The solution will separate into a colorless aqueous phase, an intermediate layer, and a pink organic phase. Transfer the upper aqueous phase to a new RNase-free EP tube, add 1 / 3 of its volume of isopropanol, gently invert and mix. Transfer the entire volume to an RNA Spin Column tube, let stand for 10 minutes, centrifuge at 12000 rpm at room temperature for 10 minutes, and retain the effluent. Transfer to a clean EP tube, add 1.25 times its volume of anhydrous ethanol, mix again, centrifuge at 12000 rpm at room temperature for 30 seconds each time, and discard the effluent (repeat if the volume is too large). Wash twice with 500 μL WB10 (discard the effluent after each centrifugation), then centrifuge at 12000 rpm. Centrifuge at 12000 rpm for 2 minutes to completely remove any residual ethanol. Then, transfer the miRNA Spin Column to a new EP tube, add 30 μL of RNase-free water to the center of the column, incubate at room temperature for 1 minute, and centrifuge to collect the purified RNA solution. Place the miRNA Spin Column tube into a 1.5 mL RNase-free EP tube, add 30 μL of RNase-free water to the center of the column, and incubate at room temperature for 1 minute. Then, centrifuge at 12000 rpm for 1 minute at room temperature to completely elute the miRNA. Finally, store the miRNA at -80°C.

[0066] The reverse transcription reaction solution is prepared as shown in Table 1:

[0067] Table 1. Reverse transcription reaction solution preparation table

[0068] Reagent Volume mRQ Buffer 5 RNA sample 3.75 mRQ Enzyme 1.25

[0069] The reaction system was set to react at 37°C for 1 hour, then at 85°C for 5 minutes. 90 μL of enzyme-free water was added to obtain 100 μL of cDNA for later use, which was then stored at -20°C.

[0070] The target gene amplification system is shown in Table 2:

[0071] Table 2 Target Gene Amplification System

[0072] Reagent Volume (μl) <![CDATA[ddH2O]]> 9 TB Green Advantage Premix (2X) 12.5 ROX Dye (50X) 0.5 miRNA-specific primer (10 μM) 0.5 mRQ 3′ Primer (10 μM) 0.5

[0073] The reverse transcription amplification system of internal control U6 is shown in Table 3:

[0074] Table 3 Internal control U6 reverse transcription amplification system

[0075] Reagent Volume (μl) <![CDATA[ddH2O]]> 9 TB Green Advantage Premix (2X) 12.5 ROX Dye (50X) 0.5 U6 Forward Primer (10 μM) 0.5 U6 Reverse Primer (10 μM) 0.5

[0076] The reverse-transcribed cDNA was placed in a pre-prepared system for processing. The qPCR program was designed as follows: 95℃ pretreatment for 5 min, 1 cycle; 95℃ denaturation for 10 s, 58℃ annealing for 20 s, 72℃ extension for 20 s, 40 cycles, with 3 replicates per group.

[0077] Using GAPDH as an internal reference, the relative expression level is calculated using the formula: RQ = 2 －（△Ｃｔｑ－ΔＣｔｃｂ） ,

[0078] △Ctq = Average Ct value of target gene in test group - Average Ct value of internal reference gene in test group;

[0079] △Ctcb = Average Ct value of target gene in control group - Average Ct value of internal reference gene in control group.

[0080] The results showed that SAMSN1 expression was significantly upregulated after LPS stimulation (p<0.01).

[0081] (3) Western blotting was used to verify protein expression. The results showed that SAMSN1 protein expression was consistent with the mRNA level and was significantly upregulated after LPS stimulation. Finally, the differentially expressed gene was identified as SAMSN1.

[0082] (4) Prediction and validation of targeted miRNAs

[0083] miRNAs targeting the SAMSN1 3'UTR were predicted using TargetScan and the miRBase database, and three candidate miRNAs, mmu-miR-1896, mmu-miR-1892, and mmu-miR-302c-5p, were screened. Dual-luciferase reporter gene assays confirmed that mmu-miR-1896 specifically binds to the SAMSN1 3'UTR. Transfection with mmu-miR-1896 mimics showed significant inhibition of SAMSN1 expression and activation of the NRF2 pathway after qPCR and Western blotting, thus constructing the mmu-miR-1896 / SAMSN1 / NRF2 signaling axis.

[0084] 2. In vitro model investigation of the effect of TSA on LPS-induced RAW264.7 inflammation model response

[0085] In this study, a mouse acute lung injury (ALI) model induced by lipopolysaccharide (LPS) and a RAW264.7 macrophage inflammation model were established, and tanshinone IIA (TSA) was administered at gradient concentrations after successful model establishment.

[0086] (1) In vitro cell experiments

[0087] In vitro experiments showed that TSA dose-dependently increased the viability of LPS-damaged RAW264.7 cells within the 0-15 μM concentration range using the CCK-8 assay. Live and dead cell staining, JC-1 mitochondrial membrane potential assay, and DCFH-DA reactive oxygen species probe assay further confirmed that TSA significantly inhibited LPS-induced apoptosis and excessive ROS production.

[0088] qPCR and Western blot analysis showed that TSA intervention dose-dependently downregulated the levels of inflammatory factors such as TNF-α, IL-6, and IL-1β in LPS-stimulated RAW264.7 cells, while upregulating the expression of mmu-miR-1896, inhibiting the expression of SAMSN1, and activating the NRF2 pathway.

[0089] To elucidate the miRNA-mediated mechanism, transfection with mmu-miR-1896 mimic / inhibitor revealed that overexpression of mmu-miR-1896 significantly inhibited SAMSN1 gene expression and reversed LPS-induced increases in inflammatory factors and oxidative stress damage. Conversely, inhibition of mmu-miR-1896 upregulated SAMSN1 expression and exacerbated the inflammatory response.

[0090] RNA content determination

[0091] Using a micropipette, 1 μL of enzyme-free water was first transferred and spotted onto the detection base of a NanoDrop™ 2000c ultra-micro spectrophotometer (Thermo Scientific) to measure a blank control. Following this, 1 μL of total RNA sample from lung tissue was precisely transferred. The full-wavelength scan mode was activated, and the absorbance value (A260) of the sample at 260 nm was measured. The RNA concentration (μg / μL) was calculated, and the A260 / A280 ratio was recorded simultaneously.

[0092] live and dead cell staining

[0093] RAW264.7 cells in good growth condition and logarithmic growth phase were selected and arranged at a density of 2×10⁻⁶ cells / cells. 4 Cells were seeded at a density of 10 cells / well in 6-well cell culture plates. Preheated RAW264.7 complete medium was added to each well. The plates were gently shaken horizontally in a cross pattern to ensure even cell distribution. After seeding, the plates were incubated at 37°C with 5% CO2 for 12-16 hours. Once cell confluence reached approximately 60%, experiments could begin. Three groups were set up: a control group (normal complete medium), a model group (1 μg / mL LPS stimulation), and an experimental group (1 μg / mL LPS + gradient concentration TSA treatment). Before modeling and drug treatment, the original medium was discarded. The cell monolayer was gently rinsed twice along the well walls with PBS. Immediately afterward, live / dead cell staining was performed: Staining working solution was prepared according to the instructions of the Calcein AM / PI Animal Cell Viability / Toxicity Assay Kit. 100 μL of staining solution was added to each well to evenly cover the cell layer under light-protected conditions. The plates were then incubated at 37°C for 30 minutes in the dark. After staining, aspirate the staining solution and gently wash the cells 2-3 times with pre-warmed PBS (immersing for 30 seconds each time to thoroughly remove unbound dye). Replace the PBS in each well with 1 mL of PBS and quickly observe under a fluorescence microscope. Select a field of view with good imaging to acquire images and record changes in cell morphology (LPS-activated macrophages typically show pseudopodia extension and spindle-shaped changes). Fluorescence observation should be performed within 1 hour after staining to avoid fluorescence quenching.

[0094] Tanshinone cytotoxicity test

[0095] RAW264.7 mouse mononuclear macrophages in logarithmic growth phase and in good condition were digested with 0.25% trypsin-EDTA and then adjusted to a cell density of 1×10⁻⁶ cells in DMEM high-glucose complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. 4Cells were seeded per well in 96-well cell culture plates, with 100 μL of liquid added to each well. The plates were gently shaken horizontally in a cross shape to ensure even distribution of cells. After marking the seeding time, the plates were incubated at 37°C with 5% CO2 saturated humidity for 24 hours. Cell density after adhesion was observed, with 70% being considered optimal. The following groups were set up: negative control group, blank group, 5 μg / ml TSA group, 10 μg / ml TSA group, 15 μg / ml TSA group, 20 μg / ml TSA group, 40 μg / ml TSA group, and 80 μg / ml TSA group. After adhesion of each group, the original culture medium in each well was carefully aspirated in a biosafety cabinet, and the cell monolayer was gently washed once with pre-warmed calcium- and magnesium-free PBS. Subsequently, the cell concentration gradient was set according to the experimental design. After drug treatment, the culture plates were returned to the incubator and cultured in the dark for another 24 hours. After 24 hours, the culture medium was thoroughly aspirated, and the cells were gently washed once with pre-warmed PBS. 100 μL of serum-free DMEM medium containing 10% CCK-8 reagent was added to each well. The plates were then placed in a constant temperature cell culture incubator. The absorbance (OD) of each well was measured at 450 nm using a microplate reader at time points of 1 h, 1.5 h, and 2 h. 450 Simultaneously, 650 nm reference wavelength data was read and non-specific absorption was subtracted; the blank control was corrected using the OD value of the control group (containing 0.1% DMSO) without TSA as the 100% cell viability benchmark, and the relative cell viability of the TSA-treated group was calculated using the formula: Cell viability (%) = (Experimental group OD value) / (TSA-treated ... 450 - Blank Group OD 450 ) / (control group OD 450 - Blank group OD 450 The dose-response ratio was calculated as 100%; the half-maximal inhibitory concentration (IC50) of TSA was finally determined by dose-response curve analysis using Gradphism 9.0 software. 50 Set the 95% confidence interval and preserve the experimental results. Confirm the experimental results by combining cell morphology observations (such as pseudopodia retraction and cell body shrinkage).

[0096] CCK8-KIT

[0097] RAW264.7 cells in good growth condition were selected and cultured at a concentration of 1×10⁻⁶ cells. 4Cells were seeded at a density of 10 cells / well in 96-well plates and incubated overnight at 37°C with 5% CO2 until fully adherent. The next day, the original culture medium was discarded, and 100 μl of fresh culture medium was added to each well according to the experimental groups (control group, LPS-stimulated model group, and different concentrations of tanshinone II treatment groups), and the cells were incubated for 24 hours. After incubation, the old culture medium was carefully aspirated from each well, and 100 μl of serum-free culture medium containing 10% CCK-8 was added to each well. The cells were then incubated at 37°C with 5% CO2 in the dark for 1 hour. After incubation, the absorbance (OD) value of each well was measured at 450 nm using a microplate reader, with the blank culture medium wells used as a zero control. Cell viability (%) was calculated according to the formula "(Experimental group OD value - Blank group OD value) / (Control group OD value - Blank group OD value) × 100%", thereby quantitatively assessing the effect of different treatment conditions on the proliferation activity of RAW264.7 cells.

[0098] Mitochondrial membrane potential detection

[0099] RAW264.7 mouse mononuclear macrophages in good growth condition and in the logarithmic growth phase were selected at a ratio of 2 × 10⁻⁶. 4 Cells were seeded at a density of 1 cell / well in 6-well cell culture plates, with 2 mL of RAW264.7 complete culture medium per well. The plates were gently shaken horizontally in a cross-hatching manner to ensure even distribution of cells. After seeding, the plates were incubated at 37°C and 5% CO2 for 24 hours. Once the cells had stabilized, they were subjected to group intervention in a clean bench: a control group (normal complete culture medium), an LPS model group, and an LPS + tanshinone experimental group. All groups were incubated at 37°C and 5% CO2 in the dark for 24 hours. After intervention, the culture medium was discarded, and the cell monolayer was gently washed twice with pre-warmed calcium- and magnesium-free PBS. Mitochondrial membrane potential was then measured: working solution (final concentration 5 μg / mL) was prepared according to the JC-1 staining kit instructions. 1 mL of working solution was added to each well to completely cover the cell layer in the dark. The culture plate was gently shaken horizontally to ensure even dye distribution. The plates were then incubated at 37°C and 5% CO2 in the dark. Incubate in a CO2 incubator in the dark for 30 minutes. After incubation, completely aspirate the staining solution and gently wash the cells three times with pre-cooled JC-1 buffer. Immediately after washing, proceed to the fluorescence microscopy imaging stage: place the culture plate on a preheated fluorescence microscope mount, first detect green fluorescent monomers with 488 nm excitation light, and then switch to 585 nm excitation light to detect red fluorescent polymers. Acquire dual-channel images for each field of view (avoid dwelling on a single field of view for more than 15 seconds to prevent fluorescence quenching), and calculate the red / green fluorescence intensity ratio using image analysis software (such as ImageJ).

[0100] Flow cytometry

[0101] RAW264.7 mouse mononuclear macrophages in good growth condition and in the logarithmic growth phase were selected at a ratio of 2 × 10⁻⁶. 4 Cells were seeded at a density of 1 cell / well in 6-well cell culture plates, with 2 mL of RAW264.7 complete medium per well. The plates were gently shaken horizontally in a cross pattern to ensure even distribution of cells. After seeding, the plates were incubated at 37°C with 5% CO2 for 24 hours. Once cell adhesion was stable, the plates were divided into three groups under a clean bench: a control group (normal complete medium), an LPS model group, and an LPS + tanshinone experimental group. All groups were incubated at 37°C with 5% CO2 in the dark for 24 hours. Cells were collected intact from the culture dishes, washed with PBS, and resuspended in PBS. The resuspended cells were then divided into 1.5 mL EP tubes, each containing FITC and PE reagents, respectively. After adding the reagents to the cell suspension, the tubes were incubated for 20 minutes. Finally, the cells were resuspended again, and the prepared cell samples were analyzed using flow cytometry to detect early and late apoptosis in each treatment group and the model group.

[0102] ROS content detection

[0103] An experiment was conducted to detect reactive oxygen species (ROS) levels. RAW264.7 cells were cultured at a concentration of 5 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of [number] cells / well in 24-well plates. Experimental groups included a control group, an LPS group, and LPS plus different concentration gradients. Cells were cultured for 12 hours in each group. After culture, the culture medium was discarded, and cells were washed with PBS. Then, 500 μl of DCFH-DA reactive oxygen species probe diluted 1:1000 with basal medium was added to each well, and the plates were incubated in the dark for 20 minutes, with gentle shaking every 5 minutes to ensure adequate contact between the probe and cells. After incubation, the culture medium was discarded, and cells were washed again with PBS. The cells were visualized and observed using an inverted fluorescence microscope. Subsequently, the fluorescence intensity was quantitatively analyzed using flow cytometry (excitation wavelength 480 nm, emission wavelength 525 nm). Flow cytometry operation strictly followed laboratory standard operating procedures and instrument usage specifications.

[0104] Assess nucleic acid purity. Only RNA samples with an A260 / A280 ratio between 1.8 and 2.0 (indicating no significant protein or organic solvent contamination) are allowed into downstream experimental procedures. If the ratio is outside this range, the chloroform extraction procedure needs to be optimized again or a different lung tissue sample needs to be extracted.

[0105] For RNA samples that meet purity standards, each sample is serially diluted with nuclease-free ultrapure water based on concentration determination results, and finally adjusted to a standardized concentration of 500 ng / μL. The entire dilution process is carried out under ice bath conditions (0-4℃), and after aliquoting, the samples are numbered and immediately stored at -80℃ or transferred to the reverse transcription reaction system.

[0106] RNA reverse transcription to synthesize cDNA

[0107] The reverse transcription step was performed according to the manufacturer's instructions. The premix preparation was carried out on ice along with the cDNA kit, and the mixture was prepared in RNase-free reaction tubes. Reverse transcription was then performed according to the following reaction systems.

[0108] miRNA:

[0109] Reagent Volume mRQ Buffer 5 RNA sample 3.75 mRQ Enzyme 1.25

[0110] The reaction system was set to react at 37°C for 1 hour, then at 85°C for 5 minutes. After that, 90 μL of enzyme-free water (TaKaRa number 9012) was added to obtain 100 μL of cDNA for later use. The cDNA was stored at -20°C for subsequent qPCR.

[0111] Real-time quantitative PCR

[0112] After obtaining the corresponding full cDNA sequence of the gene from NCBI, the FORWARD and REVERSE sequences were synthesized online. The primers were provided by Shanghai Biotechnology Co., Ltd.

[0113] Where F represents the forward primer and R represents the reverse primer.

[0114] Primer name Primer sequence MMF-GAPDH GGGGTCCCAGCTTAGGTTC MMR-GAPDH CCAATACGGCCAAATCCGTT MM-IL6-F GGGACTGATGCTGGTGACAA MM-IL6-R CGCACTAGGTTTGCCGAGTA MM-TNFα-F ATGGCCTCCCTCTCATCAGT MM-TNFα-R ACCCTGAGCCATAATCCCCT MM-IL1B-F GAAATGCCACCTTTTGACAGTG MM-IL1B-R TGGATGCTCTCATCAGGACAG mmu-miR-1892 ATTTGGGGACGGGAGGGAGGGAGGAT mmu-miR-1896 TCTGATGGTGGGTGAGGAGAA mmu-miR-302c-5P TTTAACATGGGGTTACCTGCAA

[0115] Statistical analysis

[0116] All experimental data were statistically analyzed using GraphPad Prism 9.0 software (GraphPad Software Inc., San Diego, CA, USA). For continuous variable data that conform to a normal distribution (P>0.05 according to the Shapiro-Wilk test) and have homogeneity of variance (P>0.05 according to Levene's test), two-group comparisons were performed using a two-tailed Student's t-test (with Welch correction to address slight variance inequality). For comparisons among multiple groups, one-way ANOVA was first performed. If the differences between groups were statistically significant (F-value, P<0.05), Tukey's post-hoc test was further used to perform multiple comparison correction to control Type I error inflation. The statistical significance threshold was set to α=0.05, and the level of difference was indicated in the figures and tables using an asterisk system: * indicates P<0.05 (significant), ** indicates P<0.01 (highly significant), *** indicates P<0.001 (extremely significant), and **** indicates P<0.0001 (extremely significant). All data are presented as mean ± standard error (Mean ± SEM), and the sample size (n value) is clearly indicated in the figure and table legend.

Claims

1. A biomarker for detecting sepsis-induced acute lung injury, characterized in that, The biomarker is SAMSN1.

2. A kit for detecting SAMSN1 gene expression levels, characterized in that, The kit contains primers and / or probes for detecting SAMSN1 gene expression levels, as well as reagents for extracting and amplifying RNA.

3. The reagent kit according to claim 2, characterized in that, The kit also includes primers and / or probes for detecting the expression level of mmu-miR-1896, as well as reagents for extracting and amplifying miRNA.

4. Use of tanshinone IIA in the preparation of drugs for the treatment of sepsis-induced acute lung injury.

5. A pharmaceutical composition for improving sepsis-induced acute lung injury, characterized in that, The pharmaceutical composition comprises tanshinone IIA as the active ingredient, and a pharmaceutically acceptable carrier or excipient.

6. The pharmaceutical composition according to claim 5, characterized in that, The dosage range of the tanshinone IIA is 10 mg / kg to 20 mg / kg.

7. The pharmaceutical composition according to claim 5, characterized in that, The pharmaceutical composition also includes other active ingredients that can enhance mmu-miR-1896 expression or inhibit SAMSN1 expression.

8. A method for detecting and evaluating biomarkers for sepsis-induced acute lung injury, characterized in that, The method includes detecting the expression levels of the SAMSN1 gene and / or mmu-miR-1896 in the sample.

9. The detection method according to claim 8, characterized in that, The samples were derived from the patient's blood or lung tissue.

10. The detection method according to claim 8, characterized in that, The method also includes detecting the expression levels of NRF2, Keap1, and GSDMD.

Images