Application of 2-fluoroadenine in preparation of medicine for resisting porcine epidemic diarrhea virus
By inhibiting the ribosomal frameshift process of PEDV with 2-fluoroadenine, the problem of inhibiting PEDV replication and proliferation in existing technologies has been solved, achieving a broad-spectrum antiviral effect against multiple genotypes of PEDV and making it suitable for the preparation of anti-PEDV drugs.
Patent Information
- Application Number
- CN202511807021.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-10
AI Technical Summary
Existing technologies are insufficient to effectively inhibit the replication and proliferation of porcine epidemic diarrhea virus (PEDV), especially against multiple genotypes of the virus, and face the challenge of high viral mutation rates.
2-Fluoroadenine was used as an antiviral drug to block viral replication and proliferation by inhibiting the -1 ribosomal frameshift process of PEDV. By utilizing its targeting effect on ribosomal frameshift elements, it achieved broad-spectrum inhibition of multiple genotypes of PEDV.
2-Fluoroadenine significantly inhibits the replication and proliferation of PEDV, has a broad-spectrum antiviral effect against multiple genotypes, and is not sensitive to viral mutations, thus effectively preventing and treating porcine epidemic diarrhea.
Smart Images

Figure CN121489956A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of chemical medicine, and particularly relates to application of 2-fluoroadenine in preparation of an anti-porcine epidemic diarrhea virus drug. BACKGROUND
[0002] Porcine epidemic diarrhea virus (PEDV) is a highly infectious coronavirus belonging to the alpha genus of the Coronaviridae family, which mainly infects pigs, especially newborn piglets. The mortality rate of newborn piglets after infection is extremely high, which often brings huge economic losses to the breeding industry. The genome of PEDV is a single-stranded positive-sense RNA of about 28 kb, which encodes various structural proteins and non-structural proteins. In recent years, PEDV has continuously emerged in variant strains, and the pathogenicity and transmission ability of some strains have significantly increased, which further increases the difficulty of prevention and control. At present, the research on PEDV mainly focuses on viral receptor recognition, immune escape mechanism and vaccine development. Although some candidate vaccines have entered the experimental stage, the high mutation rate of the virus is still the main challenge for prevention and control. Therefore, it is urgent to develop an anti-viral drug that is not sensitive to virus mutation. SUMMARY
[0003] In view of the deficiencies in the prior art, the purpose of the present application is to provide application of 2-fluoroadenine in preparation of an anti-porcine epidemic diarrhea virus drug.
[0004] The technical solution adopted by the present application is as follows:
[0005] Application of 2-fluoroadenine in preparation of an anti-porcine epidemic diarrhea virus drug.
[0006] 2-Fluoroadenine is a purine antimetabolite, and the known effect thereof is mainly to inhibit tumor cell proliferation by interfering with RNA or protein synthesis, and the toxicity to non-proliferative cells is low.
[0007] The molecular formula of 2-fluoroadenine is C5H5FN5O.
[0008] The structural formula of 2-fluoroadenine is:
[0009] .
[0010] In an embodiment of the present application, the drug is a drug for preventing and / or treating porcine epidemic diarrhea disease caused by PEDV infection.
[0011] In an embodiment of the present application, the drug is a drug for inhibiting replication of PEDV.
[0012] In an embodiment of the present application, the drug is a drug for inhibiting proliferation of PEDV.
[0013] In an embodiment of the present application, the porcine epidemic diarrhea virus includes one or more genotypes of G1a, G1b, G2a, G2b, and G2c.
[0014] In an embodiment of the present application, the drug includes 2-fluoroadenine and a pharmaceutically acceptable excipient.
[0015] In an embodiment of the present application, the 2-fluoroadenine inhibits the replication, proliferation, or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosomal frameshifting process of the porcine epidemic diarrhea virus.
[0016] In an embodiment of the present application, the drug is an oral preparation or an injection.
[0017] Compared with the prior art, the present application has the following beneficial effects:
[0018] There is a ribosomal frameshifting element in the middle of the open reading frame 1 (ORF1) of the PEDV genome, and the virus precisely regulates the expression of genes in the rear part of the ORF1 through the element, and these genes contain the key component RdRP (RNA-dependent RNA polymerase) of the virus replication complex. Inhibition of ribosomal frameshifting can effectively prevent the amplification of PEDV, so the ribosomal frameshifting element is an ideal target for small molecule drugs, and the ribosomal frameshifting element has the characteristics of low mutation rate, so the inhibitors targeting the element are not sensitive to mutations.
[0019] The present application finds a new use of 2-fluoroadenine in inhibiting PEDV. Experiments prove that 2-fluoroadenine has a very significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, can effectively inhibit the replication of PEDV, and further inhibit the proliferation of PEDV; and it has an inhibitory effect on various genotypes of PEDV, that is, the process of 2-fluoroadenine inhibiting the proliferation of PEDV is not sensitive to mutations of PEDV. Therefore, 2-fluoroadenine can be used for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, for preparing an anti-PEDV drug, and for preparing a drug for treating and preventing porcine epidemic diarrhea disease caused by PEDV infection, which is a broad-spectrum antiviral drug, not sensitive to mutations of PEDV, and has a good application prospect.
[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (variant strain). Among them, G1 type is further divided into G1a and G1b two subgroups, and G2 type is divided into G2a, G2b and G2c three subgroups. The 2-fluoroadenine discovered in the application has a very significant inhibitory effect on the five subgroups of PEDV strains (G1a, G1b, G2a, G2b and G2c). BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows.
[0022] Figure 1 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of 2-fluoroadenine inhibiting PEDV ribosome frameshift process in luciferase reporter system.
[0023] Figure 2 The design principle schematic diagram (a), experimental process schematic diagram (b) and experimental results (c) of 2-fluoroadenine inhibiting PEDV ribosome frameshift process in fluorescent protein reporter system.
[0024] Figure 3 The experimental results of 2-fluoroadenine of different concentrations on the toxicity of Vero cells and the antiviral activity on PEDV in cells.
[0025] Figure 4 The experimental results of 2-fluoroadenine on the inhibition effect of Vero cell CPE (cytopathic effect) caused by PEDV G2c strain.
[0026] Figure 5 The experimental results of 2-fluoroadenine on the antiviral experiment of PEDV (G1a, G1b, G2a, G2b, G2c strains) detected by RT-PCR.
[0027] Figure 6 The experimental results of 2-fluoroadenine on the antiviral experiment of PEDV in vivo. DETAILED DESCRIPTION
[0028] The content of the present application will be described in detail through examples and test examples. The examples are used to better illustrate the content and advantages of the present application, but cannot be understood as limiting the content of the present application to the examples. The person skilled in the art can make non-essential improvements and adjustments to the implementation scheme according to the above content of the application, which still belongs to the protection scope of the present application.
[0029] Example 1
[0030] Evaluation of the inhibitory effect of 2-fluoroadenine on the -1 Ribosomal Frameshifting process of PEDV (luciferase reporter system).
[0031] 1. Experimental Methods
[0032] The inhibitory effect of a drug (2-fluoroadenine) on the -1 ribosomal frameshifting process of PEDV was investigated using in vitro cell culture. First, a lentiviral vector containing the PEDV viral genome sliding sequence was constructed, and the drug's effect was detected in the porcine kidney cell line PK15. The initial screening concentration of the drug was 10 μM.
[0033] 1.1. Construction of luciferase reporter gene vector
[0034] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.
[0035] (2) By homologous recombination, the luciferase of Renidae was constructed upstream of the -1 Ribosomal Frameshift region, and the luciferase of Firefly was constructed downstream of the -1 Ribosomal Frameshift region.
[0036] The specific method is as follows: The gene sequences of Renidae luciferase and firefly luciferase were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombination enzyme were added. The mixture was reacted at 37°C for 15 minutes.
[0037] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).
[0038] 1.2. Establishing a luciferase reporter gene screening cell system
[0039] (1) The viral backbone vector containing dual luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI (polyethyleneimine) in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.
[0040] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.
[0041] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.
[0042] (4) Genotyping of the cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Renilla-framshift-Firefly) containing the -1 Ribosomal Frameshift region.
[0043] 1.3. Drug screening based on luciferase reporter genes
[0044] (1) Five types of PK15 cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After 24 hours, different test compounds (control group: DMSO; experimental group: 2-fluoroadenine) were added to the plate, and the drug concentration was 10 μM.
[0045] (2) After culturing for 8 hours, the cells were lysed, and firefly luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.
[0046] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.
[0047] (4) The ratio of firefly luciferase to Renilla luciferase is used as a reference for the -1 Ribosomal Frameshift efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshift efficiency, and a lower ratio indicates a lower -1 Ribosomal Frameshift efficiency. In other words, a lower ratio indicates a higher efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and a better ability to inhibit the -1 Ribosomal Frameshift process.
[0048] 2. Experimental Results
[0049] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by 2-fluoroadenine in a luciferase reporter system. Specifically, Figure 1 In the 'a' section, the reporter gene design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla and Firefly are expressed. However, when ribosome frameshift is blocked, the reporter gene Renilla is expressed, while Firefly is not expressed. Figure 1 The workflow of the multivariate mixed screening reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine kidney cell line PK15) via a lentiviral vector. The mixed system of 5 positive monoclonal cells is then treated with compounds (control group: DMSO; experimental group: 2-fluoroadenine). The effects of the compounds on the PEDV ribosome frameshift process are determined by a dual-luciferase reporter gene assay kit and an ELISA reader. Figure 1 In the image, 'c' represents the results of the luciferase reporter gene screening experiment. (From...) Figure 1As shown in Figure c, 10 μM 2-fluoroadenine significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P < 0.05).
[0050] Example 2
[0051] Evaluation of the inhibitory effect of 2-fluoroadenine on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).
[0052] 1. Experimental Methods
[0053] 1.1. Construction of fluorescent protein reporter gene vector
[0054] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.
[0055] (2) By homologous recombination, ubiquitin-green fluorescent protein (Ub-GFP) was constructed upstream of the -1 Ribosomal Frameshift region, and red fluorescent protein (RFP) was constructed downstream of the -1 Frameshift region.
[0056] The specific method is as follows: The Ub-GFP and RFP gene sequences were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel-recovered products of Ub-GFP and RFP and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel-recovered products of Ub-GFP and RFP and the gel-recovered product of linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombinase was added. The mixture was reacted at 37°C for 15 minutes.
[0057] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).
[0058] 1.2. Establishing a fluorescent protein reporter gene screening cell system
[0059] (1) The viral backbone vector containing dual fluorescent protein and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.
[0060] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.
[0061] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.
[0062] (4) Genotyping of cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Ub-GFP-framshift-RFP) containing -1Ribosomal Frameshift region.
[0063] 1.3. Drug screening based on fluorescent protein reporter genes
[0064] (1) Five PK15 fluorescent reporter gene cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After the cells were plated for 24 hours, different test compounds (control group: DMSO; experimental group: 2-fluoroadenine) were added to the plates. The drug concentration was 10 μM for all groups, and autofluorescent compounds were excluded.
[0065] (2) After culturing for 8 hours, MG132 was added, and after culturing for 4 hours, the changes in fluorescence signal were observed under a high-content fluorescence microscope.
[0066] (3) The ratio of RFP to GFP is used as a reference for the efficiency of -1 Ribosomal Frameshift. The larger the ratio, the higher the efficiency of -1 Ribosomal Frameshift; the lower the ratio, the lower the efficiency of -1 Ribosomal Frameshift. In other words, the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better it can inhibit the -1 Ribosomal Frameshift process.
[0067] 2. Experimental Results
[0068] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by 2-fluoroadenine in a fluorescent protein reporter system. Specifically, Figure 2 In the design scheme of the fluorescent protein reporter system, when the ribosome is frameshifted, both the reporter genes GFP and RFP are expressed. When the ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2 In section b, the workflow of the fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (PK15 cell) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: 2-fluoroadenine). Fluorescence images are acquired using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PEDV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the experimental results of the fluorescent protein reporter system. Figure 2 As shown in Figure c, 10 μM 2-fluoroadenine significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, and G2c strains) (* indicates P < 0.05).
[0069] Example 3
[0070] Assess the in vitro antiviral activity and cytotoxicity of 2-fluoroadenine.
[0071] 1. Experimental Methods
[0072] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (2-fluoroadenine) was added at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM. Lesions were observed after 48 hours. Viral replication levels were detected using quantitative real-time PCR. The relationship between drug concentration and viral inhibition rate was calculated, and the viral inhibition rate (EC50) was determined by fitting a curve. 50 Cells were treated with drugs at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM individually. Cell viability was determined by the CCK8 assay, and the cytotoxicity rate (CC) was calculated using a fitted curve. 50 The calculation of the selection index SI is CC. 50 / EC 50 .
[0073] 2. Experimental Results
[0074] Experimental results are as follows Figure 3 As shown, the toxicity marker CC of 2-fluoroadenine in Vero cells 50 The concentration was 7.003 μM, which is the half-maximal cytotoxic concentration (CMC) of 2-fluoroadenine in Vero cells. 50 The concentration was 7.003 μM; 2-fluoroadenine inhibited the -1 ribosomal frashifting process of PEDV, with a half-maximal effective concentration (EC50) of 7.003 μM. 50 The concentration was 0.154 μM; the selectivity index (SI) was 45.47. An SI value greater than 5.00 indicates that the drug is effective and has high safety, and the larger the value, the wider the safety range of the drug.
[0075] Example 4
[0076] To evaluate the antiviral effect of 2-fluoroadenine in cultured cells in vitro.
[0077] 1. Experimental Methods
[0078] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (DMSO or 2-fluoroadenine) was added at a concentration of 1 μM. The images were taken under a bright-field microscope 48 hours later.
[0079] 2. Experimental Results
[0080] Experimental results are as follows Figure 4 As shown, Vero cells uninfected with PEDV exhibited good growth and no viral cytopathic effect (CPE). After PEDV infection, the solvent-treated group (DMSO) showed extensive CPE and extremely poor cell condition, while the 2-fluoroadenine-treated group showed significantly reduced CPE, with cell condition approaching that of the uninfected group. This indicates that 2-fluoroadenine has a significant inhibitory effect on PEDV G2c-induced CPE in Vero cells.
[0081] Example 5
[0082] To evaluate the antiviral efficacy of 2-fluoroadenine against different PEDV strains (G1a, G1b, G2a, G2b, and G2c).
[0083] 1. Experimental Methods
[0084] Experiments were conducted under P2 laboratory conditions. PEDV virus (G1a, G1b, G2a, G2b, and G2c strains) were cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (2-fluoroadenine) at a concentration of 1 μM was added. Viral replication levels were detected by quantitative real-time PCR after 48 hours.
[0085] The qPCR primers are as follows:
[0086] PEDV MF GGTTGCTACTGGCGTACAGGTA,
[0087] PEDV MR GAAGCATTGACTGAACGACCAACA;
[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,
[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.
[0090] 2. Experimental Results
[0091] Experimental results are as follows Figure 5 As shown. Figure 5 The antiviral results of 2-fluoroadenine against PEDV strains G1a, G1b, G2a, G2b, and G2c were determined by RT-PCR. Figure 5It is evident that 2-fluoroadenine exhibits highly significant antiviral effects against PEDV strains G1a, G1b, G2a, G2b, and G2c (*** indicates P < 0.001), demonstrating that 2-fluoroadenine possesses a broad-spectrum antiviral effect against PEDV.
[0092] Example 6
[0093] To evaluate the antiviral effect of 2-fluoroadenine against PEDV in vivo.
[0094] 1. Experimental Methods
[0095] 2-Fluoropurin was dissolved in DMSO. Ten 21-day-old PEDV antibody-negative weaned piglets were selected and divided into an experimental group (challenge + drug treatment), a positive control group (challenge + DMSO), and a negative control group (no challenge). After 7 days of pre-feeding, the piglets were orally inoculated with 10.0 TCID50 (median infectious dose of tissue culture) of PEDV-G2c strain. The administration method was intramuscular injection at a dose of 10 mg / kg body weight, once a day. Diarrhea score, body temperature, and feed intake were recorded. Seven days after challenge, jejunal tissue was collected to detect viral load. Biosafety measures (glutaraldehyde disinfection, protective clothing operation) were performed throughout the experiment.
[0096] 2. Experimental Results
[0097] Experimental results are as follows Figure 6 As shown, Figure 6 The viral load in the jejunal tissue of the experimental group and the positive control group was determined by... Figure 6 It is evident that 2-fluoroadenine has a highly significant antiviral effect against PEDV (*** indicates P < 0.001).
Claims
Application of 1,2-Fluoroadenine in the preparation of drugs against porcine epidemic diarrhea virus.
2. The application of 2-fluoroadenine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is a drug for the prevention and / or treatment of porcine epidemic diarrhea caused by porcine epidemic diarrhea virus infection.
3. The application of 2-fluoroadenine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the replication of porcine epidemic diarrhea virus.
4. The use of 2-fluoroadenine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the proliferation of porcine epidemic diarrhea virus.
5. The use of 2-fluoroadenine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The porcine epidemic diarrhea virus includes one or more genotypes of the strains G1a, G1b, G2a, G2b, and G2c.
6. The use of 2-fluoroadenine according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug comprises 2-fluoroadenine and pharmaceutically acceptable excipients.
7. The use of 2-fluoroadenine according to any one of claims 1 to 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The 2-fluoroadenine inhibits the replication, proliferation, or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosome frameshift process of the porcine epidemic diarrhea virus.
8. The use of 2-fluoroadenine according to any one of claims 1, 2, or 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The drug is an oral preparation or an injection.