Application of Ptbp2 accelerant in treatment of cerebral arterial thrombosis
By upregulating Ptbp2 expression with a Ptbp2 gene expression promoter, the problem of limited drug options for ischemic stroke treatment was solved, achieving the effects of reducing infarct volume and improving neurological function.
Patent Information
- Application Number
- CN202511778193.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-02-10
AI Technical Summary
The existing drug options for ischemic stroke are limited, making it difficult to fully cover the complex pathogenesis. Individual differences are significant, limiting the effectiveness and safety of treatment.
Ptbp2 gene expression promoters, including Ptbp2 overexpression plasmid vectors and viral vectors, were used to upregulate Ptbp2 expression and activity, thereby reducing microglia-mediated neuroinflammation and improving brain tissue damage.
It significantly reduces infarct volume caused by ischemic stroke, improves neurological function, inhibits microglia M1 polarization, and provides a novel treatment approach.
Smart Images

Figure CN121490084A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a Ptbp2 promoter in treatment of ischemic stroke. BACKGROUND
[0002] Ischemic stroke is a serious cerebrovascular disease with high morbidity, high mortality and high disability rate. The main cause of ischemic stroke is the formation of thrombus, which blocks the cerebral blood vessels, causing cerebral ischemia and hypoxia, leading to brain nerve cell damage and further causing brain tissue necrosis. Studies have shown that the pathological process of ischemic stroke involves a series of signal cascade reactions, leading to brain parenchyma necrosis. The main mechanism is that cerebral ischemia deprives the brain tissue of oxygen, glucose, lipids, etc., causing energy metabolism disorder, inactivation of energy-dependent ion channels and ion pumps, thus leading to dysfunction of excitatory neurotransmitter release and reuptake, causing a large accumulation of excitatory neurotransmitters in the ischemic area, and inducing excitotoxicity. Subsequently, a large amount of calcium ions flow into the cells, inducing important pathological events of ischemia, i.e. excessive production of reactive oxygen species (ROS), mitochondrial dysfunction, inflammation and apoptosis. Inflammation and oxidative stress promote the infiltration of neutrophils, macrophages and microglia into the ischemic lesion to further induce the production of ROS and other pro-inflammatory mediators, ultimately leading to cell swelling and necrosis.
[0003] At present, the drug treatment of ischemic stroke in the acute phase aims to rapidly restore blood flow and minimize neurological damage. Thrombolytic therapy is the most important one, which usually uses tissue plasminogen activator (tPA) for intravenous thrombolysis. In addition, antiplatelet drugs are also widely used in acute treatment, mainly including aspirin and clopidogrel. However, so far, the effective treatment drug selection is relatively limited, and the treatment strategy is relatively single. This limitation not only limits the treatment effect, but also increases the risk of treatment. Due to the complex pathogenesis of ischemic stroke, involving multiple biological pathways and factors, existing drugs often have difficulty in comprehensive coverage and response. In addition, different patients may have different responses to drugs due to individual differences, which also increases the difficulty and uncertainty of treatment. Therefore, we urgently need to find new treatment drugs or treatment methods to cope with the treatment problems of ischemic stroke. SUMMARY
[0004] In order to make up for the shortcomings of the prior art, the purpose of the present application is to provide the application of Ptbp2 promoter in treatment of ischemic stroke.
[0005] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: The application provides the use of a Ptbp2 gene expression promoter in the preparation of a drug for treating ischemic stroke.
[0006] Further, the Ptbp2 gene is a coding gene of a Ptbp2 protein with an amino acid sequence as shown in SEQ ID NO: 1.
[0007] Further, the coding strand nucleotide sequence of the coding gene of the Ptbp2 protein is as shown in SEQ ID NO: 2.
[0008] In some embodiments, the Ptbp2 gene expression promoter of the application refers to any substance capable of up-regulating the expression of Ptbp2, increasing the activity of Ptbp2, improving the stability of Ptbp2, increasing the effective action time of Ptbp2, or promoting the transcription and translation of Ptbp2, which falls within the protection scope of the application.
[0009] In some embodiments, the Ptbp2 gene expression promoter of the application refers to any substance capable of promoting the expression of Ptbp2, including but not limited to: a natural purified substance capable of promoting the expression of Ptbp2, a modified natural purified substance, a semi-synthetic substance, a chemically synthesized substance, or any combination thereof.
[0010] Further, the Ptbp2 gene expression promoter includes a Ptbp2 overexpression plasmid vector or a viral vector capable of promoting the expression of Ptbp2, an active peptide capable of promoting the expression of Ptbp2, an oligonucleotide capable of promoting the expression of Ptbp2, a protein capable of promoting the expression of Ptbp2, a small molecule compound capable of promoting the expression of Ptbp2, a nanoparticle carrying Ptbp2, or a liposome encapsulating Ptbp2.
[0011] Further, the promoter is an overexpression viral vector capable of promoting the expression of Ptbp2.
[0012] Further, the viral vector includes an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, a lentivirus vector, a poxvirus vector, a vaccinia virus vector, or a herpes virus vector.
[0013] Further, the promoter is a Ptbp2 overexpression adeno-associated virus vector or a lentivirus vector capable of promoting the expression of Ptbp2.
[0014] In some embodiments, the adeno-associated virus (AAV) is a small, replication-defective virus belonging to the parvovirus family, a nonenveloped, single-stranded linear DNA virus, including AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV-DJ. Adeno-associated virus vectors can infect both replicating and quiescent cells, have long-term transgene expression superiority, and no viral-induced pathophysiological reactions have been observed. Therefore, AAV has gained extensive attention in the field of gene research and is the most commonly used viral vector.
[0015] The AAV genome is a linear single-stranded DNA molecule, and the coding region of both ends is two cis-acting nucleotide inverted terminal repeat (ITR) sequences, about 145 nucleotides in length, which function as primers during the initiation of DNA replication. The AAV gene coding region consists of two major open reading frames, non-structural replication genes (Rep) and structural capsid genes (Cap), located between the left and right inverted terminal repeat sequences (L-ITR and R-ITR). The AAV genome contains about 4.7 kilobases (kb).
[0016] In some embodiments, the lentivirus is a type of gene therapy vector based on the human immunodeficiency virus (HIV-1), spherical, about 80-120 nanometers in diameter, with an envelope, and the surface is inlaid with glycoprotein spikes that mediate host cell recognition and invasion, belonging to the retroviridae lentivirus genus. The lentivirus genome is a single-stranded RNA, which is converted to double-stranded DNA by reverse transcriptase after infecting host cells, and integrated into the host chromosome to achieve long-term stable expression. The genome contains three core genes (gag, pol, env) and multiple auxiliary genes (such as vif, vpr, nef, etc.), which regulate the virus replication and infection process.
[0017] In some embodiments, the term "treatment" refers to reversing or alleviating a disease or condition indicated with the term, or one or more symptoms thereof, inhibiting the progression of the disease or condition, or one or more symptoms thereof, or preventing the disease or condition, or one or more symptoms thereof. The term "treatment" used in the present invention refers to the "treatment" behavior as defined above. Therefore, the treatment or treatment regimen of a disease in a mammal can include one or more of the following: inhibiting the growth of the disease, i.e., arresting its development; preventing the spread of the disease; alleviating the disease; preventing the recurrence of the disease; alleviating the symptoms of the disease.
[0018] In some embodiments, the improvement refers to at least about 10%, at least about 30%, at least about 50%, at least about 80% or more reduction in the symptoms (e.g., infarct volume or behavior) of the animal model or the phenotype of the cells derived from the animal model (e.g., microglia M1 polarization, inflammation) compared to before administration of the drug.
[0019] The second aspect of the present application provides a drug for treating ischemic stroke, comprising the Ptbp2 gene expression promoter of the first aspect of the present application.
[0020] The third aspect of the present application provides a pharmaceutical composition for treating ischemic stroke, comprising the drug of the second aspect of the present application as a first active ingredient.
[0021] Further, the pharmaceutical composition further comprises a second active ingredient which can be used for treating or assisting in treating ischemic stroke.
[0022] Further, the second active ingredient includes thrombolytic drugs, anti-platelet aggregation drugs, neuroprotective agents, statins, and drugs for improving cerebral circulation.
[0023] In some embodiments, the thrombolytic drug can be selected from recombinant tissue-type plasminogen activator rt-PA, such as alteplase, by activating plasminogen to plasmin to dissolve thrombus and restore blood flow in occluded vessels. The anti-platelet aggregation drug can be selected from aspirin, clopidogrel, and ticagrelor, by inhibiting platelet activation and aggregation to prevent thrombus formation or enlargement. The neuroprotective agent can be selected from edaravone, citicoline sodium, and oxiracetam, by removing free radicals, inhibiting inflammatory response, or promoting nerve repair to reduce the damage of brain tissue caused by ischemia and hypoxia. The statin can be selected from atorvastatin and rosuvastatin, by reducing low-density lipoprotein cholesterol (LDL-C) and stabilizing atherosclerotic plaques to reduce vascular inflammatory response. The drug for improving cerebral circulation can be selected from fasinumacetam, urickinase, and nimodipine, by dilating cerebral vessels, promoting collateral circulation, or increasing blood perfusion in ischemic areas.
[0024] In the present application, the second active ingredient which can be used for treating or assisting in treating ischemic stroke is not limited to the specific drugs listed above, and any drug that can be used for treating or assisting in treating ischemic stroke will fall within the scope of the present application.
[0025] In some embodiments, the pharmaceutical composition comprising at least one drug can be administered conventionally in unit dosage form. When used in a pharmaceutical composition, a unit dosage form refers to a physically discrete unit suitable for administration to a subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required physiologically acceptable diluent (i.e., carrier or vehicle).
[0026] In some embodiments, the pharmaceutical composition is administered in a therapeutically effective amount in a manner compatible with the dosage formulation. The amount and time of administration depends on the subject to be treated, the capacity of the subject to utilize the active ingredient, or the degree to which the therapeutic effect is desired. The precise amount of active ingredient, such as the pharmaceutical provided by the fourth aspect of the present application, required to be delivered depends on the judgment of the physician, and is peculiar to each individual. Suitable dosage regimes are variable, but are represented by an initial administration followed by subsequent injections or other administrations at intervals of one or more hours, or, alternatively, by continuous intravenous infusion sufficient to maintain the concentration in the blood at a range specified for in vivo treatment.
[0027] In some embodiments, the effective daily dose of the active ingredient can be administered as one, two, three, four, five, six or more sub-doses administered separately, optionally at appropriate intervals throughout the day, optionally in unit dosage forms. The active ingredient can be administered once, twice or three times daily.
[0028] In some embodiments, the subject refers to an individual or an animal subject suffering from or likely to suffer from the ischemic stroke or ischemic stroke related conditions described in the present application, and can also refer to an individual or an animal subject used for a certain purpose, for example, for scientific research purposes. Specifically, the individual, for example, an animal subject, particularly a mammalian subject, such as a human, a pig, a dog, a cat, a cow, a sheep, a horse, a mouse, a rat, a rabbit, a guinea pig, a monkey, etc. More specifically, the individual described in the present application is a human.
[0029] In some embodiments, the therapeutically effective amount refers to the amount of treatment required to alleviate at least one or more symptoms of a disease or condition, and relates to a sufficient amount of a drug to provide the desired effect. Therefore, a therapeutically effective amount refers to a treatment amount sufficient to cause a particular effect when administered to a subject. In various contexts, a therapeutically effective amount as used herein also includes a treatment amount sufficient to delay the development of a disease condition, alter the course of a disease condition (for example, but not limited to, slow the progression of a disease condition), or reverse a disease condition.
[0030] It will be appreciated that there are a number of ways of determining effective amounts for a given application. For example, pharmacological methods for dose determination can be used in a therapeutic context. The amount of the pharmaceutical composition administered to a subject will depend on the type and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled person will be able to determine an appropriate dose taking into account these and other factors. For example, a therapeutically effective amount of a Ptbp2 gene expression promoter, a drug for treating ischemic stroke, a pharmaceutical composition or a pharmaceutical preparation provided by the present application can be determined by clinical investigation. Suitable effective dosages also need to take into account the pharmaceutical dosage form, the constitution of the individual to whom the drug is administered, body weight, age, the progress of the disease, the site of administration, and other therapeutic factors.
[0031] The fourth aspect of the present application provides a pharmaceutical preparation for treating ischemic stroke, the pharmaceutical preparation comprising the drug of the second aspect of the present application or the pharmaceutical composition of the third aspect of the present application.
[0032] Further, the pharmaceutical preparation further comprises a pharmaceutically acceptable excipient.
[0033] In some embodiments, the pharmaceutically acceptable excipient refers to any conventional excipient in the field of pharmaceutical preparations, and the selection of a specific excipient will depend on the mode of administration for treating a specific patient or the type and state of the disease. The preparation of a drug for a specific mode of administration is well within the knowledge of a person skilled in the art of drugs. For example, the pharmaceutically acceptable excipients can include solvents, diluents, dispersants, suspending agents, surfactants, isotonic agents, thickening agents, emulsifiers, binders, lubricants, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, ion exchangers, release agents, coating agents, flavoring agents, or antioxidants, etc. that are conventional in the field of pharmacy. If necessary, flavoring agents, preservatives, and sweetening agents, etc. can also be further added to the drug.
[0034] In some embodiments, the present application does not have a particular limitation on the dosage form of the pharmaceutical preparation, which is a dosage form that can be suitable for oral administration, parenteral administration, or topical administration, external administration, including but not limited to injection solutions, tablets, capsules, granules, powders, injection powders, transdermal patches, ointments, gels, suppositories, oral solutions, oral suspensions, injection emulsions, oral emulsions, sustained-release tablets, controlled-release tablets. The above-mentioned various dosage forms of drugs can be prepared according to conventional methods in the field of pharmacy.
[0035] In some embodiments, the pharmaceutically acceptable dose (i.e., the administration dose) of the medicament described in this invention may be varied based on the age, sex, and weight of the subject to be treated (i.e., the subject), the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the diagnostician's judgment. The administration dose is determined taking these factors into account and is within the range of those skilled in the art. A typical dose may be 0.01-1000 mg / kg / day, specifically 1-100 mg / kg / day. However, the scope of this invention is not limited in any way to the stated administration dose.
[0036] The fifth aspect of the present invention provides a method for inhibiting microglial M1 polarization in vitro, the method comprising treating a desired system with the Ptbp2 gene expression promoter described in the first aspect of the present invention.
[0037] Furthermore, the microglia are BV2 cells.
[0038] Furthermore, the method described is not for therapeutic purposes.
[0039] In some implementations, the desired system is one that needs to inhibit the M1 polarization of microglia.
[0040] In some embodiments, the present invention does not particularly limit the desired system. Exemplarily, the system includes the desired cellular system, subcellular system, tissue system, or organ system.
[0041] Advantages and beneficial effects of the present invention: This invention is the first to discover that overexpression of Ptbp2 can significantly improve neurological function and reduce infarct volume in mice with ischemic stroke, and alleviate microglial-mediated neuroinflammation, making it suitable for effective treatment of ischemic stroke. This invention provides a theoretical basis for the development of therapeutic drugs for ischemic stroke, opens up applications for Ptbp2 promoters, and offers a novel approach to treating ischemic stroke, showing broad application prospects in this technical field. Attached Figure Description
[0042] Figure 1 The diagram shows the effect of Ptbp2 overexpression in vivo on ischemic stroke. a is the experimental flowchart; b is a TCC staining image of cerebral infarction; c is the quantification of figure b; d is a Nissl staining image of cerebral infarction; e is the total infarct volume; f is the ischemic core volume; g is the penumbra volume; h is the neurological score; i is the dwell time of the Rotarod test; j is the adhesive removal time; and k is the adhesive contact time.
[0043] Figure 2The images show the results of Ptbp2 overexpression inhibiting M1 polarization in microglia in vitro; where a is the Western blot (WB) results of Ptbp2, CD86, and Arg-1; b is the WB quantification of Ptbp2; c is the WB quantification of CD86; d is the WB quantification of Arg-1; e is the immunofluorescence result; f is the PCR result of CD86; and g is the PCR result of Arg-1. Detailed Implementation
[0044] As used in this invention, the terms “having,” “comprising,” or “including,” or any grammatical variations thereof, are used in a non-exclusive manner. Thus, these terms can all refer to a situation where no other features exist in the entity described in this context besides the features introduced by these terms, and can also refer to a situation where one or more other features are present.
[0045] Furthermore, as used in this invention, the terms “preferred,” “more preferred,” “most preferred,” “particularly,” “more particularly,” “specifically,” “more specifically,” or similar terms are used in combination with optional features without limiting other possibilities.
[0046] Unless otherwise stated, all figures used in this specification and claims to represent volume, weight, temperature, time, density, parts by weight, technical effect, etc., should in any case be understood to be modified by the terms "about" or "approximately". Therefore, unless indicated to the contrary, the numerical parameters listed in the specification and appended claims are approximate values. Unless otherwise stated, the terminology used herein has its common meaning as understood by one of ordinary skill in the art, and each numerical parameter should be interpreted according to the number of significant figures and conventional rounding methods or in a manner understood by one of those skilled in the art.
[0047] Example 1: Study on the therapeutic effect of Ptbp2 overexpression on ischemic stroke model mice I. Experimental Methods 1. Laboratory Animals: Specific pathogen-free (SPF) grade adult male mice (C57BL / 6N mice, 22-26 g, 8-12 weeks old) were purchased from Vital River (Vital River Laboratory Animal Technology Co., Ltd., Beijing, China). Mice were maintained under SPF conditions in a monitored environment (22℃ ± 3℃, 60% ± 5% humidity, 12:12 h light: dark cycle). All mice received a standard diet with unlimited access to food and water. After acclimatization, mice were randomly assigned to control and experimental groups for subsequent experiments. All animal experimental protocols were approved by the Animal Care and Use Committee of the Second Hospital of Hebei Medical University and conducted in accordance with the National Institutes of Health's Guidelines for the Care and Use of Laboratory Animals (NIH Publication No. 80-23, revised 1996).
[0048] 2. Ptbp2 overexpression vector: prepared by Hanheng Biotechnology Co., Ltd., and adeno-associated virus vector pAAV-CMV-MCS-EGFP purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number P67510.
[0049] Ptbp2 amino acid sequence: (SEQ ID NO:1) Ptbp2 nucleotide sequence: Ptbp2 target gene amplification primers: Forward primer: GGACCGATCCAGCCTCCGGTACCGCCACCATGGACGGAATTGTCACTGAGGTTG (SEQ ID NO:3); Reverse primer: ACCATGGTGGCGAATTCGTCGACGATTGTTGACTTGGAGAAAGACACT (SEQ ID NO:4).
[0050] 3. Transient Middle Cerebral Artery (MCA) Occlusion Model (tMCAO): Mice were first anesthetized and allowed to breathe spontaneously. The carotid vessels were dissected, the right common carotid artery (CCA) was clamped, and the right external carotid artery (ECA) was ligated. A silicone-coated monofilament (diameter, 0.22 ± 0.01 mm, Yushun Bio, Guangzhou, China) was inserted through the right ECA into the internal carotid artery (ICA) and advanced to the origin of the MCA. Cerebral blood flow was monitored using a non-invasive laser speckle system (PeriCam PSI System, Sweden) to confirm successful occlusion. The monofilament was removed 60 minutes after vascular occlusion to induce reperfusion. The mice were then placed on a heating pad to maintain a temperature of 37 ± 0.5℃. Mice in the sham-operated group underwent the same procedure, but without the silicone-coated monofilament inserted into the ICA.
[0051] 4. Stereoscopic Injection of AAV Virus: A viral vector overexpressing Ptbp2 was injected into the right lateral ventricle of mice using a stereotactic injection device. After anesthetizing the mice, they were placed in the instrument. Using the anterior fontanelle as a reference point, a 14 mm incision was made to expose the anterior fontanelle and surrounding skull. Then, the skull was marked at positions 1.55 mm to the right of the anterior fontanelle and 1.1 mm caudal. A microsyringe (Hamilton, Shanghai, China) was vertically inserted 3.5 mm deep into the marked positions, and the AAV virus was slowly injected over 10 minutes. The microsyringe was held in place for at least 5 minutes, then slowly removed.
[0052] 5. Measurement of infarct volume: After euthanizing mice, the brain was removed and frozen at -20°C for 20 minutes. It was stained with 2% TTC solution (TTC, T8877, Sigma, MO, USA) at 37°C for 20 minutes. Then it was fixed with 4% paraformaldehyde and images were acquired using a macromicroscope (ZEISS Axio Zoom V16, Germany). The infarct area was quantified using ImageJ software (National Institutes of Health, USA). Histologically, Nissl staining was used to assess infarct volume. After fixing with 10% formaldehyde for 48 hours, the brain tissue was dehydrated and embedded in paraffin, and cut into 3.5 μm sections. The sections were then dewaxed with xylene, drained with ethanol, and stained with 1% toluidine blue according to the manufacturer's instructions (Solarbio, G1434). Finally, the slides were sealed with neutral adhesive and observed under a stereomicroscope (ZEISS Axio Zoom V16, Germany).
[0053] 6. Behavioral Analysis: Neurological function in mice after tMCAO was assessed using three neurobehavioral tests. These included the modified neurological severity score (mNSS), rotation test, and adhesion removal test. Mice underwent neurobehavioral training for three consecutive days prior to tMCAO, and were reassessed on days 1, 2, and 3 post-tMCAO. All tests were performed by researchers unaware of the experiment.
[0054] II. Experimental Results The flowchart of the modeling process is as follows Figure 1 As shown in figure a. TTC and Nissl staining showed that, compared with the tMCAO group, the tMCAO+oe-P2 group treated mice had a significantly reduced infarct volume ( Figure 1 (bg). Neurological function was assessed using the mNSS, rotarod test, and adhesive removal test on days 1, 2, and 3 post-stroke. Compared to the tMCAO group, the mNSS score in the tMCAO+oe-P2 group showed no significant difference on day 1 post-stroke, but was significantly lower on day 3. Figure 1 h). Basic sensorimotor function was assessed prior to the rotating rod and adhesive removal tests to exclude ineligible mice. In the rotarod test, the tMCAO+oe-P2 group showed a significant improvement in dwell time on days 2 and 3 post-stroke compared to the tMCAO group ( Figure 1 i). Adhesive removal tests showed that, compared with the tMCAO group, the tMCAO+oe-P2 group had reduced exposure time on both day 2 and day 3 post-stroke. Figure 1 These findings demonstrate that upregulation of Ptbp2 can effectively improve neurological function and reduce infarct volume in tMCAO model mice.
[0055] Example 2: Study on the inhibitory effect of Ptbp2 overexpression on M1 polarization and inflammation in microglia. I. Experimental Methods 1. Experimental materials: Rabbit anti-Pbtp2 (abcam, catalog number ab154787), rabbit anti-CD86 (Boster, catalog number BM4121), rabbit anti-Iba-1 (Wako, Osaka, Japan, catalog number 019-19741), rabbit anti-Arg-1 (Proteintech, catalog number 16001-1-AP, China).
[0056] 2. Cell Culture: Immortalized BV2 microglia (RRID: CVCL 0182) were obtained from the Chinese center and cultured in DMEM at 37°C and 5% CO2 with 10% fetal bovine serum (Gibco, USA) and 1% penicillin-streptomycin (Solarbio, China). Cells were passaged every two days in a humidified incubator. After passage, BV2 cells were seeded into culture plates. Twenty-four hours after seeding, cells in the lipopolysaccharide (LPS) stimulation group were treated with LPS (2 μg / ml) and then incubated again for 24 hours.
[0057] 3. Ptbp2 overexpression vector: prepared by Hanheng Biotechnology Co., Ltd., and lentiviral vector pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number P0268.
[0058] Ptbp2 target gene amplification primers: Forward primer: TGACCTCCATAGAAGATTCTAGAGCCACCATGGACGGAATTGTCACTGAGGTTG (SEQ ID NO:5); Reverse primer: GCAGATCCTTCGCGGCCGCTTAGATTGTTGACTTGGAGAAAGAC (SEQ ID NO:6).
[0059] 4. Lentiviral transfection: One day before transfection, BV2 cells were seeded into 96-well plates at a density of 6000 cells per well. The next day, the culture supernatant was aspirated, and fresh complete culture medium containing lentivirus was added. Ten hours after infection, the virus-containing medium was aspirated and replaced with fresh medium. 72 hours post-infection, puromycin (60209ES, Shanghai Yisheng Biotechnology Co., Ltd., China) was added for selection. The culture medium containing the selection drug was changed every two days until all untransfected cells died, leaving only stably transfected cells.
[0060] 5. PCR: Reverse transcription was performed using the SureScript™ First-Strand cDNA Synthesis Kit (Gene Copoeia). The obtained cDNA was amplified using a real-time PCR machine (Agilent, Santa Clara, CA, USA). Blaze Taq™ SYBR Green qPCR mixture (Gene Copoeia) was used as the fluorescent dye. Primer sequences are as follows: CD86: Forward: TGTTTCCGTGGAGACGCAAG (SEQ ID NO:7); Reverse: TTGAGCCTTTGTAAATGGGCA (SEQ ID NO:8); Arg-1: Positive: GCTTTGCGAGACGTAGACCCT (SEQ ID NO:9); Reverse: CCATCACCTTGCCAATCCC (SEQ ID NO:10).
[0061] II. Experimental Results The results showed that LPS induced a classic pro-inflammatory response, namely, increased CD86 expression and elevated Arg-1 expression. Figure 2 (ad). Compared with the LPS group, Ptbp2 overexpression significantly downregulated CD86, demonstrating the specificity of Ptbp2. However, oe-NC virus did not show this effect. Further investigation was conducted to determine whether it exerts its effect through the NF-κB pathway. Immunofluorescence results showed that the proportion of CD86 / Iba-1 cells was reduced and the proportion of Arg-1 / Iba-1 cells was increased in the Ptbp2 overexpression group; however, the above effects were largely reversed after the addition of the NF-κB activator PMA. Figure 2 e). PCR data consistently showed that PMA treatment counteracted the regulatory effects of Ptbp2 on CD86 and Arg-1 ( Figure 2 (fg). The above results demonstrate that Ptbp2 exerts its anti-inflammatory effect by inhibiting M1 polarization in microglia through the NF-κB pathway.
[0062] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. Application of Ptbp2 gene expression promoters in the preparation of drugs for treating ischemic stroke.
2. The application according to claim 1, characterized in that, The Ptbp2 gene is the gene encoding the Ptbp2 protein, whose amino acid sequence is shown in SEQ ID NO:
1.
3. The application according to claim 1, characterized in that, The coding strand nucleotide sequence of the gene encoding the Ptbp2 protein is shown in SEQ ID NO:
2.
4. The application according to claim 1, characterized in that, The Ptbp2 gene expression promoters include Ptbp2 overexpression plasmid vectors or viral vectors that promote Ptbp2 expression, active peptides that promote Ptbp2 expression, oligonucleotides that promote Ptbp2 expression, proteins that promote Ptbp2 expression, small molecule compounds that promote Ptbp2 expression, nanoparticles carrying Ptbp2, or liposomes encapsulating Ptbp2. Preferably, the promoter is an overexpression viral vector that promotes Ptbp2 expression; Preferably, the viral vector includes an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, a lentivirus vector, a poxvirus vector, a vaccinia virus vector, or a herpesvirus vector. Preferably, the promoter is a Ptbp2 overexpressing adeno-associated virus vector or lentiviral vector that promotes Ptbp2 expression.
5. A drug for treating ischemic stroke, characterized in that, The drug comprises the Ptbp2 gene expression promoter as described in claim 4.
6. A pharmaceutical composition for treating ischemic stroke, characterized in that, The pharmaceutical composition comprises the drug of claim 5 as the first active ingredient.
7. The pharmaceutical composition according to claim 6, characterized in that, The pharmaceutical composition also contains other second active ingredients that can be used to treat or assist in the treatment of ischemic stroke; Preferably, the second active ingredient includes thrombolytic drugs, antiplatelet aggregation drugs, neuroprotective agents, statins, and drugs that improve cerebral circulation.
8. A pharmaceutical preparation for treating ischemic stroke, characterized in that, The pharmaceutical preparation comprises the drug of claim 5 or the pharmaceutical composition of claim 6 or 7; Preferably, the pharmaceutical preparation further comprises pharmaceutically acceptable excipients.
9. The pharmaceutical preparation according to claim 8, characterized in that, The dosage forms of the pharmaceutical preparations include oral dosage forms, parenteral dosage forms, or topical dosage forms.
10. A method for inhibiting M1 polarization in microglia in vitro, characterized in that, The method includes treating the desired system with the Ptbp2 gene expression promoter as described in any one of claims 1-4; Preferably, the microglia are BV2 cells; Preferably, the desired system is a system that needs to inhibit microglial M1 polarization, including cells, subcellular structures, tissues, or organs.