A microbial composition with the functions of degrading ginseng sensibilizing substances and pesticide residues and antagonizing pathogenic bacteria and application thereof

Bio-organic fertilizer was prepared by using a microbial composition of Trichoderma harzianum, Trichoderma chlorophyllum, and Trichoderma hooks. This solved the problems of degradation of allelochemicals and pesticide residues in ginseng and antagonism of pathogens, improved soil quality, promoted ginseng growth, and achieved an increase in ginseng yield and quality.

CN121495716BActive Publication Date: 2026-04-17JILIN AGRICULTURAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JILIN AGRICULTURAL UNIV
Filing Date
2026-01-08
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies have not yet discovered strains or combinations that can simultaneously and efficiently degrade ginseng allelochemicals, pesticide residues, and antagonize pathogens, leading to limited ginseng growth and soil microecological imbalance, which affects yield and quality.

Method used

A bio-organic fertilizer is prepared by fermentation using a combination of three microorganisms: Trichoderma harzianum, Trichoderma atroviride, and Trichoderma hamatum. This bio-organic fertilizer degrades allelochemicals such as ferulic acid, gallic acid, salicylic acid, and cinnamic acid, as well as pesticide residues such as pentachloronitrobenzene, and antagonizes pathogens such as Fusarium solani, Fusarium oxysporum, Alternaria alternata, and Penicillium desquam.

Benefits of technology

It significantly degrades allelochemicals and pesticide residues, improves soil physicochemical properties, reduces soil pollution, increases ginseng yield and quality, promotes ginseng growth, and solves the problems of continuous cropping obstacles and waste recycling in ginseng.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495716B_ABST
    Figure CN121495716B_ABST
Patent Text Reader

Abstract

This invention relates to the field of microbial technology, and in particular to a microbial composition and its application that simultaneously degrades ginseng allelochemicals and pesticide residues, and antagonizes pathogens. The microbial composition provided by this invention degrades ginseng allelochemicals (ferulic acid, gallic acid, salicylic acid, and cinnamic acid), removes pentachloronitrobenzene pesticide residues from ginseng-growing areas, and antagonizes ginseng pathogens (Fusarium solani, Fusarium oxysporum, Alternaria alternata, and Penicillium desquam). Furthermore, the bio-organic fertilizer made from the bag-cultivated Gastrodia elata fungus residue based on this microbial composition can improve the physical and chemical properties of soil in ginseng-growing areas, reduce pesticide residues and allelochemical content in the soil, decrease ginseng disease incidence, and increase key production indicators such as fresh weight and root length of ginseng under continuous cropping, as well as ginsenoside content; it can also increase the thousand-seed weight, seedling survival rate, and dry weight of ginseng seeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a microbial composition and its application that simultaneously degrades ginseng allelochemicals and pesticide residues and antagonizes pathogens. Background Technology

[0002] Ginseng (Panax ginseng CAMeyer) is a perennial herb belonging to the genus Panax in the family Araliaceae, and its demand continues to increase. However, due to the decreasing availability of suitable land for ginseng cultivation, coupled with restrictions on the conversion of arable land to non-grain crops, the shortage of ginseng land severely restricts the development of the ginseng industry, urgently requiring solutions to the problem of land reuse after ginseng cultivation. Long-term and extensive use of various fungicides and pesticides has led to the continuous accumulation of pesticide residues in the soil, such as persistent organic pollutants like pentachloronitrobenzene and chlorpyrifos, which are difficult to decompose naturally. Furthermore, during ginseng growth, its roots continuously secrete allelochemicals such as phenolic acids. These substances, after gradually accumulating in the soil, produce significant autotoxic effects, not only inhibiting the growth and development of ginseng itself but also disrupting the soil's microecological balance, leading to an increase in pathogens, aggravated ginseng diseases, and a sharp reduction in yield. Therefore, overcoming the obstacles of continuous ginseng cultivation has become a technological bottleneck.

[0003] In recent years, microbial remediation and microbial control technologies have received widespread attention due to their environmental friendliness. However, existing technologies have yet to discover strains and combinations that can simultaneously and efficiently degrade allelopathic substances, pesticide residues, and antagonize pathogens. Building upon the successful early-stage development of ginseng replanting after crop rotation with bagged Gastrodia elata, this study utilizes the mycelium residue from bagged Gastrodia elata cultivation as a raw material to develop a bio-organic fertilizer for resolving ginseng continuous cropping issues. This is significant for simultaneously addressing the reuse of waste from old ginseng fields and bagged Gastrodia elata cultivation. Summary of the Invention

[0004] The purpose of this invention is to provide a microbial composition and its application that simultaneously degrades ginseng allelochemicals and pesticide residues, and antagonizes pathogens, thereby solving the problems existing in the prior art. The microbial composition provided by this invention degrades allelochemicals (ferulic acid, gallic acid, salicylic acid, and cinnamic acid), pentachloronitrobenzene, and antagonizes ginseng pathogens (Fusarium solani, Fusarium oxysporum, Alternaria alternata, and Penicillium desquam). The resulting bio-organic fertilizer can improve the physical and chemical properties of soil after ginseng cultivation, reduce soil pesticide residues and allelochemical content, and promote ginseng growth.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a microbial composition that simultaneously degrades ginseng allelochemicals and pesticide residues and antagonizes pathogens. The microbial composition includes Trichoderma harzianum TH-GY-GYGZ, Trichoderma atroviride TS-GY-GYGZ, and Trichoderma hamatum TG-GY-GYGZ.

[0007] The *Trichoderma harzianum* TH-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41833, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025.

[0008] The *Trichoderma viride* TS-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41834, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025.

[0009] The aforementioned *Trichoderma hookeri* TG-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41832, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025.

[0010] More preferably, the ginseng allelochemicals include one or more of ferulic acid, gallic acid, salicylic acid, and cinnamic acid;

[0011] The pesticide residues include pentachloronitrobenzene.

[0012] The present invention provides a biological agent comprising the above-described microbial composition.

[0013] The present invention provides the use of the above-described microbial composition or the above-described biological agent in any of the following:

[0014] (1) Degradation of ginseng compounds;

[0015] (2) Preparation of products containing degraded ginseng compounds;

[0016] (3) Reduce the incidence of disease in ginseng;

[0017] (4) Prepare products that reduce the incidence of ginseng-related diseases;

[0018] (5) Improve key indicators for ginseng production;

[0019] (6) Prepare products that improve key indicators of ginseng production;

[0020] (7) Promotes the accumulation of ginsenosides;

[0021] (8) Prepare products that promote the accumulation of ginsenosides;

[0022] (9) Improve the physical and chemical properties of the soil after ginseng production;

[0023] (10) Prepare products that improve the physical and chemical properties of soil after ginseng production;

[0024] The compounds include ginseng allelochemicals and pesticide residues.

[0025] Preferably, the ginseng allelochemicals include one or more of ferulic acid, gallic acid, salicylic acid, and cinnamic acid;

[0026] The pesticide residues include pentachloronitrobenzene;

[0027] The infection rate includes the infection rate caused by pathogens and the infection rate caused by continuous cropping obstacles; the pathogens include one or more of Fusarium solani, Fusarium oxysporum, Penicillium spp. and Alternaria.

[0028] The key indicators for ginseng production include fresh ginseng weight, ginseng root length, ginseng seed weight per thousand seeds, ginseng seedling survival rate, and ginseng dry weight.

[0029] The ginsenosides include ginsenoside Rg1, ginsenoside Rg2, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, ginsenoside Re and ginsenoside Rf;

[0030] The soil physicochemical properties are measured by indicators including pH, field water holding capacity, bulk density, organic matter content, available nitrogen content, available phosphorus content, and available potassium content.

[0031] Preferably, the product includes bio-organic fertilizer.

[0032] This invention provides a bio-organic fertilizer, which includes organic fertilizer raw materials, nutrient element raw materials, and solid fermentation microbial fertilizer;

[0033] The method for preparing the solid fermented microbial fertilizer includes the step of inoculating the above-mentioned microbial composition into a culture medium for fermentation culture.

[0034] Preferably, the organic fertilizer raw materials comprise the following components by weight percentage: 50 wt% mushroom compost, 5 wt% soybean cake, 5 wt% peanut cake, 5 wt% rapeseed cake, 5 wt% cottonseed cake, 20 wt% bone meal, and 10 wt% wheat bran;

[0035] The nutritional raw materials include the following components by mass percentage:

[0036] NH4HCO3 26.98wt%, KH2PO4 10.79wt%, K2SO4 35.98wt%, MgSO4•7H2O 17.99wt%, FeSO4•7H2O 3.65wt%, MnSO4 0.55wt%, CuSO4•5H2O 0.66wt%, ZnSO4•7H2O 0.78wt%, H3BO3 2.44wt%, and (NH4)2MoO4 0.18wt%.

[0037] The present invention provides a method for degrading ginseng compounds, characterized by the step of applying the above-mentioned microbial composition, the above-mentioned biological agent, or the above-mentioned bio-organic fertilizer; the compounds include ginseng allelochemicals and pesticide residues.

[0038] The present invention provides a method for improving key indicators of ginseng production and / or promoting the accumulation of ginsenosides, comprising the steps of applying the above-mentioned microbial composition, the above-mentioned biological agent, or the above-mentioned bio-organic fertilizer.

[0039] The present invention provides a method for reducing the disease rate of ginseng and / or improving the physical and chemical properties of soil in ginseng-growing areas, comprising the steps of applying the above-mentioned microbial composition, the above-mentioned biological agent, or the above-mentioned bio-organic fertilizer.

[0040] The present invention discloses the following technical effects:

[0041] This invention provides a microbial composition that simultaneously degrades ginseng allelochemicals and pesticide residues, and antagonizes pathogens. The three Trichoderma strains in the microbial composition provided by this invention can all degrade allelochemicals and pentachloronitrobenzene, and antagonize pathogens. Specifically, *Trichoderma harzianum* TH-GY-GYGZ can degrade 84% ferulic acid, 16% gallic acid, 39% salicylic acid, 3% total ginseng saponins, and 35% cinnamic acid, and degrade 34% pentachloronitrobenzene; *Trichoderma viride* TS-GY-GYGZ can degrade 53% ferulic acid, 12% gallic acid, 7% salicylic acid, 4% total ginseng saponins, and 25% cinnamic acid, and degrade 89% pentachloronitrobenzene; and *Trichoderma hookeriana* TG-GY-GYGZ can degrade 69% ferulic acid, 11% gallic acid, 21% salicylic acid, 4% total ginseng saponins, and 23% cinnamic acid, and degrade 96% pentachloronitrobenzene. Therefore, it can be seen that the microbial composition provided by the present invention can efficiently degrade allelochemicals and pentachloronitrobenzene, and the three Trichoderma strains all have significant antagonistic effects on pathogens (Fusarium solani, Fusarium oxysporum, Alternaria alternata, and Penicillium spp.).

[0042] This invention, based on the microbial composition, prepared a bio-organic fertilizer using bagged Gastrodia elata mycelium residue for use in old ginseng fields. The fertilization treatments significantly increased the content of SOC (soil organic matter), AN (available nitrogen), AP (available phosphorus), and AK (available potassium) in the rhizosphere soil of ginseng (P<0.05), reduced the content of allelochemicals and pesticide residues in the soil, and significantly increased the fresh weight of ginseng under forest cover (P<0.05) and the content of ginsenosides (P<0.05). It also improved the thousand-seed weight, seedling survival rate, and dry weight of ginseng seeds. Furthermore, the bio-organic fertilizer prepared by this invention showed good results in replanting ginseng in both Pinus sylvestris and Larch forests after ginseng cultivation. This invention provides a new strategy for alleviating continuous cropping obstacles in old ginseng fields and for the reuse of waste from bagged Gastrodia elata mycelium residue. It can be used for the restoration of post-ginseng fields and continuous cropping of ginseng, and can also effectively improve the quality of ginseng, showing broad application prospects. Attached Figure Description

[0043] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0044] Figure 1 Colony morphology of the isolated strains; where A: Trichoderma harzianum; B: Trichoderma viride; C: Trichoderma hookeriana; D: Penicillium scutellatus; E: Fusarium solani; F: Fusarium oxysporum; G: Alternaria alternata;

[0045] Figure 2 For the re-inoculation experiment of isolated strains; where A: CK; B: Trichoderma harzianum; C: Trichoderma viride; D: Trichoderma hookeriana; E: Penicillium scutellarioides; F: Fusarium solani; G: Fusarium oxysporum; H: Alternaria alternata;

[0046] Figure 3 Phylogenetic tree of Trichoderma harzianum; where TH-GY-GYGZ: Trichoderma harzianum TH-GY-GYGZ;

[0047] Figure 4 Phylogenetic tree of Trichoderma viride; among which, TS-GY-GYGZ: Trichoderma viride TS-GY-GYGZ;

[0048] Figure 5 Phylogenetic tree of Trichoderma hookeria; where TG-GY-GYGZ: Trichoderma hookeria TG-GY-GYGZ;

[0049] Figure 6The degradation rates of allelochemicals by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma hookeri* TG-GY-GYGZ are shown in the figure. A: ferulic acid; B: gallic acid; C: salicylic acid; D: total ginsenosides; E: cinnamic acid; H: *Trichoderma harzianum* TH-GY-GYGZ; S: *Trichoderma viride* TS-GY-GYGZ; G: *Trichoderma hookeri* TG-GY-GYGZ; CK: no inoculum added.

[0050] Figure 7 The degradation rates of pentachloronitrobenzene by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma hookeri* TG-GY-GYGZ are shown in Figure 1; H: *Trichoderma harzianum* TH-GY-GYGZ; S: *Trichoderma viride* TS-GY-GYGZ; G: *Trichoderma hookeri* TG-GY-GYGZ; CK: No inoculum added.

[0051] Figure 8 This study presents antagonistic experiments against pathogens by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma harzianum* TG-GY-GYGZ. A-1 and A-2 show images and statistical results of the antagonistic effects of these three fungi against *Fusarium solani*. B-1 and B-2 show the antagonistic effects of *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma harzianum* TG-GY-GYGZ on *Fusarium oxysporum*. Antagonistic images and inhibition rate statistics of Trichoderma harzianum; C-1 and C-2: Antagonistic images and inhibition rate statistics of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma truncatum TG-GY-GYGZ against Alternaria alternifolia; D-1 and D-2: Antagonistic images and inhibition rate statistics of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma truncatum TG-GY-GYGZ against Penicillium scabra; CK: Control; H: Trichoderma harzianum; S: Trichoderma viride; G: Trichoderma truncatum;

[0052] Figure 9Compatibility experiments were conducted on Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma teugenol. Among them, (a): Image of co-culture of Trichoderma harzianum TH-GY-GYGZ and Trichoderma viride TS-GY-GYGZ; (b): Image of co-culture of Trichoderma harzianum TH-GY-GYGZ and Trichoderma teugenol TG-GY-GYGZ; (c): Image of co-culture of Trichoderma harzianum TH-GY-GYGZ and Trichoderma teugenol TG-GY-GYGZ. Image 1: Co-culture of Trichoderma harzianum TS-GY-GYGZ and Trichoderma truncatum TG-GY-GYGZ; (d): Co-culture of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ and Trichoderma truncatum TG-GY-GYGZ; A: Trichoderma harzianum TH-GY-GYGZ; B: Trichoderma viride TS-GY-GYGZ; C: Trichoderma truncatum TG-GY-GYGZ;

[0053] Figure 10 The effects of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ and Trichoderma truncatum TG-GY-GYGZ on pH (A) and viable cell count (B) in solid-state fermentation of wheat bran;

[0054] Figure 11 The effects of different application rates on key indicators of ginseng production under forest cover over 3 years; where A: fresh weight; B: dry weight; C: root length; D: thousand-seed weight; E: seedling survival rate; F: disease incidence rate.

[0055] Figure 12 The effect of different application rates on ginsenosides in 3-year-old forest-grown ginseng; where A: Rg1; B: Re; C: Rf; D: Rb1; E: Rg2; F: Rc; G: Rb2; H: Rb3; I: Rd; J: summation of 9 saponins;

[0056] Figure 13 The effects of different application rates on the physicochemical properties of ginseng soil under forest cover for 3 years were investigated. Among them, A: pH; B: field water holding capacity; C: soil bulk density; D: organic matter; E: available nitrogen; F: available phosphorus; G: available potassium. Detailed Implementation

[0057] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0058] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0059] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0060] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0061] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0062] Ferulic acid, cinnamic acid, and pentachloronitrobenzene were purchased from Shanghai Maclean Biochemical Technology Co., Ltd.; gallic acid was purchased from Tianjin Huadong Reagent Factory; salicylic acid was purchased from Shantou Xilong Chemical Plant Co., Ltd.; total ginsenosides were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; compost for bagged cultivation of Gastrodia elata fungus was provided by Baishan Jingzhen Gastrodia elata Co., Ltd.; peanut cake and rapeseed cake were purchased from Sinongren Horticultural Supplies Store; soybean cake was purchased from Luxinyuan Green Plant Store; cottonseed cake was purchased from Qiaohuang Agricultural Supplies Store; wheat bran was purchased from Xixin Agricultural Supplies Store; bone meal was purchased from Shengfeng Horticulture; the enzyme-linked immunosorbent assay (ELISA) reader (INFINITE 200 PRO) was purchased from TECAN; gas chromatograph (GC-14C) was purchased from Shimadzu Corporation, Japan; high performance liquid chromatograph (LC-2010A) was purchased from Shimadzu Corporation, Japan.

[0063] Example 1 Screening of strains

[0064] (1) Isolation and identification of microorganisms from the substrate residue of Gastrodia elata grown in bags

[0065] Take 1g of *Gastrodia elata* spawn from the substrate bags and add it to 9mL of sterile water. Dilute this solution 10-fold serially in 2mL sterile centrifuge tubes. Spread 20μL of the diluted bacterial solution onto PDA solid medium. Repeat each gradient three times and incubate at a constant temperature. After single colonies with different morphologies and colors and good growth appear, aseptically pick a small amount of bacteria and inoculate it into liquid medium. Incubate at 28℃ and 120 r / min for 48h. Then, inoculate it onto fresh PDA medium and streak to isolate the colonies. After multiple streak incubations, obtain single colonies. Then, determine their specific biological taxonomic position through microbial molecular biology identification. The morphology of a single colony is as follows: Figure 1 As shown in AD.

[0066] (2) Isolation and identification of microorganisms from infected ginseng

[0067] After rinsing with clean water to remove soil and impurities adhering to the infected ginseng, the ginseng was transferred to a laminar flow hood and placed in a sterile Erlenmeyer flask. It was then immersed in 75% ethanol for 20 seconds, rinsed three times with sterile water, and then soaked in 5% sodium hypochlorite solution for 3 minutes, followed by rinsing four times with sterile water. The ginseng was then placed in a sterile petri dish and blotted dry with sterile filter paper. Subsequently, the tissue at the junction of diseased and healthy tissue was cut into 0.5cm × 0.5cm × 1cm pieces with a sterile scalpel and placed on PDA medium. The pieces were incubated at 28°C. Once mycelia / colony growth was observed around the tissue pieces, the tips of the mycelia / colony at the cut were picked and transferred to a new PDA plate. After colony growth, edge mycelia / colony were selected based on colony morphology, color differences, and growth time for isolation and culture. After multiple purifications, single colonies were obtained, and their specific biological classification was determined through microbial molecular biology identification. The morphology of a single colony is shown in the image. Figure 1 As shown in EG.

[0068] Colony morphology of the isolated strains is shown in Figure 1 , Figure 1 The AD strains in the text were isolated from fungal residue and identified as four strains: *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, *Trichoderma hookeriana* TG-GY-GYGZ, and *Penicillium decidua*. Figure 1 EG in the text refers to the strain isolated from infected ginseng, which was identified as three strains: Fusarium solani, Fusarium oxysporum, and Alternaria alternata.

[0069] Trichoderma harzianum TH-GY-GYGZ grows rapidly, initially producing white mycelium that turns green after a period of time; Trichoderma viride TS-GY-GYGZ also grows rapidly, initially producing white mycelium that gradually turns yellowish-green; Trichoderma hookeriana TG-GY-GYGZ produces white mycelium, while Penicillium scutellatus is green, with scattered colonies; Fusarium rotundum initially produces white mycelium that turns reddish-brown after a period of time; Fusarium oxysporum grows relatively quickly, with mycelium gradually changing from white to pale purple; Alternaria grows relatively slowly, exhibiting a green center and white periphery.

[0070] (3) Reinoculation experiment of isolated strains

[0071] The aforementioned strains were inoculated into PDB liquid medium for 48 hours, and then diluted with sterile water to a concentration of 1.0 × 10⁻⁶. 7 A bacterial suspension of CFU / mL was prepared. Healthy ginseng roots were sterilized with sodium hypochlorite and placed in sterile glass petri dishes (one ginseng per dish) under aseptic conditions. A spray inoculation method was used, spraying 10 μL of the bacterial suspension onto the surface of the ginseng. The control group was sprayed with an equal volume of PDB culture medium. Each group was replicated three times. The petri dishes were sealed with sealing film and incubated aseptically in the dark at 28°C for 12 days. Disease conditions of the ginseng were photographed every 3 days to screen for pathogens. Results are shown below. Figure 2 .

[0072] from Figure 2 The results show that, in the control group, no significant changes were observed in ginseng 12 days after spraying with PDB culture solution. The results also indicate that, 12 days after spraying with *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma hookeriana* TG-GY-GYGZ, white mycelia appeared on the surface of the ginseng, but without significant pathogenic effects. The remaining strains caused varying degrees of disease to ginseng, with the infection severity ranking as follows: *Fusarium solani* > *Fusarium oxysporum* > *Penicillium destreae* > *Alternaria alternata*. Therefore, *Fusarium solani*, *Fusarium oxysporum*, *Penicillium destreae*, and *Alternaria alternata* were identified as ginseng pathogens and are preserved at Jilin Agricultural University. The applicant has committed to distributing these pathogens for 20 years from the date of application.

[0073] The ITS sequences of *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma hookeri* TG-GY-GYGZ were sequenced. The ITS sequences of these three species are shown in SEQ ID NO.1-SEQ ID NO.3, respectively. The phylogenetic tree of these three species is shown below. Figures 3-5 As shown, *Trichoderma harzianum* TH-GY-GYGZ and *Trichoderma harzianum* strain IPBCC07 546 (KC847187) clustered into one strain; *Trichoderma hamatum* TS-GY-GYGZ and *Trichoderma atroviride isolate* (PQ408417) clustered into one strain; *Trichoderma hamatum* TS-GY-GYGZ and *Trichoderma hamatum* DAOM 167057 (NR 134371) clustered into one strain.

[0074] The sequence of the ITS of Trichoderma harzianum TH-GY-GYGZ (SEQ ID NO.1):

[0075] TTCCTCCCGGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTTCAGAAGTTGGGTGTTTAACGGCTGTGGACGCGCCGCGCTCCCGATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGAGACGGCCACCGCCAAAAGGCAGGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCCTACGAGAGGCGCCGAGAAGGCTCAGATTATAAAAAAAACCCGCGAGGGGGTATACAAAAAGAGTTTTGGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCGACGCACCCGGGGCAGAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGATTTTTTAACTTCCA;

[0076] Sequence of ITS of Trichoderma atroviride TS-GY-GYGZ (SEQ ID NO.2):

[0077] TTTTTCTCCCCCCCTTTTAGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTTCAGAAGTTGGGTGTTTTACGGACGTGGACGCGCCGCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGGATCCCGTCTTAGGGGCTCCCGAGGTCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATAACGTCCGCGAGGGGACTACAGAAAAGAGTTTGGTTGGTCCCTCCGGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGGCAACAGTTTGGTATGGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACTTTTTTTTTTCCTTCCAA;

[0078] Sequence of ITS of Trichoderma hamatum TG-GY-GYGZ (SEQ ID NO.3):

[0079] .

[0080] This invention provides biopreservation information for *Trichoderma harzianum*, *Trichoderma viride*, and *Trichoderma hookeri*, as follows:

[0081] The *Trichoderma harzianum* strain provided in this invention is named *Trichoderma harzianum* TH-GY-GYGZ, and its taxonomic name is *Trichoderma harzianum*. This strain was deposited on March 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 41833.

[0082] The *Trichoderma* strain provided in this invention is named *Trichoderma atroviride* TS-GY-GYGZ, and its taxonomic name is *Trichoderma atroviride*. This strain was deposited on March 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 41834.

[0083] The *Trichoderma hamatum* strain provided in this invention is named *Trichoderma hamatum* TG-GY-GYGZ, and its taxonomic name is *Trichoderma hamatum*. This strain was deposited on March 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 41832.

[0084] Example 2: Performance of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma hookeri TG-GY-GYGZ

[0085] (1) Trichoderma harzianum TH-GY-GYGZ, Trichoderma chlorophyllum TS-GY-GYGZ and Trichoderma truncatum TG-GY-GYGZ degrade allelochemicals

[0086] Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma teugenol TG-GY-GYGZ (all with spore counts of 1×10⁻⁶) were compared. 7 CFU / g of each strain was inoculated into PDB medium containing a single allelochemical (ferulic acid, gallic acid, salicylic acid, total ginsenosides, or cinnamic acid, all at a concentration of 2 μg / mL) for co-culture. The inoculation amount was 2%, and the strains were labeled H, S, and G, respectively. Sterile water was added as a control (CK). Each treatment was repeated in triplicate. Samples were taken at 0, 3, and 7 days after inoculation and culture. The samples were centrifuged at 4000 rpm for 2 min, and 200 μL of the supernatant was collected. The allelochemical content was determined using a microplate reader, and the degradation rate of the allelochemical by the strain was calculated. Results are shown below. Figure 6 .

[0087] like Figure 6As can be seen from the results, compared with the control, after the strain was co-cultured with allelochemicals for 7 days, the levels of the other four allelochemicals, except for total ginsenosides, were significantly reduced (P < 0.05). On day 7 of cultivation, the degradation rates of ferulic acid by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma hookeri* TG-GY-GYGZ, and *Trichoderma viride* TS-GY-GYGZ were 84%, 69%, and 53%, respectively; the degradation rates of gallic acid by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma hookeri* TG-GY-GYGZ, and *Trichoderma viride* TS-GY-GYGZ were 16%, 11%, and 12%, respectively; the degradation rates of salicylic acid by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma hookeri* TG-GY-GYGZ, and *Trichoderma viride* TS-GY-GYGZ were 39%, 21%, and 7%, respectively; and the degradation rates of cinnamic acid by *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma hookeri* TG-GY-GYGZ, and *Trichoderma viride* TS-GY-GYGZ were 35%, 23%, and 25%, respectively.

[0088] (2) Trichoderma harzianum TH-GY-GYGZ, Trichoderma chlorophyllum TS-GY-GYGZ and Trichoderma truncatum TG-GY-GYGZ degrade pentachloronitrobenzene (PCNB).

[0089] Trichoderma harzianum TH-GY-GYGZ, Trichoderma hookeriana TG-GY-GYGZ, and Trichoderma viride TS-GY-GYGZ were inoculated into PDB liquid medium and cultured with shaking for 48 h (28℃, 180 r / min), with the spore number adjusted to 1×10⁻⁶. 7 cfu / g. 1 mL of each bacterial culture was inoculated into PDB medium containing 100 mg / L PCNB pesticide (dissolved in dimethyl sulfoxide), with an inoculation rate of 2%, and labeled H, S, and G respectively. Sterile water was added as a control (CK). The baseline conditions were 28℃ and 180 rpm. Each treatment was repeated in triplicate. Samples were taken at 0, 3, and 7 days after inoculation. 5 mL of the sample was added to a stoppered glass tube, and 8 mL of n-hexane was added for extraction. The mixture was vortexed for 5 min, sonicated (300 W, 40 kHz) for 10 min, and allowed to stand at 4℃ for 1 h. The supernatant was collected, and 2 mL of 10% H2SO4 was added. The mixture was vortexed for 1 min, and the entire volume was transferred to a 10 mL centrifuge tube. The tubes were centrifuged at 3000 rpm for 10 min. The supernatant was collected and filtered through a 0.22 μm microporous membrane to obtain the sample solution. The PCNB content was determined, and the PCNB degradation rate was calculated. Results are shown below. Figure 7 .

[0090] like Figure 7As can be seen, all strains significantly reduced PCNB levels compared to the control (P < 0.05). On day 7 of culture, the PCNB degradation rates of Trichoderma hookeriana TG-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma harzianum TH-GY-GYGZ were 96%, 89%, and 34%, respectively.

[0091] (3) Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ and Trichoderma hookerianum TG-GY-GYGZ antagonize pathogens

[0092] The experiment employed the plate confrontation method. On a culture medium contaminated with pathogens (Fusarium solani, Fusarium oxysporum, Alternaria alternata, or Penicillium desquam), a 5mm diameter pathogenic fungal disc was placed on a 90mm diameter PDA blank medium plate, with the pathogenic fungal disc inoculated to the center. Strains that showed no pathogenicity to ginseng in the previous experiment—Trichoderma hookeri TG-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma harzianum TH-GY-GYGZ—were reinoculated. 5mm diameter fungal discs were placed around the perimeter of the plate, 2cm from the center. The confrontation medium was incubated at 28℃ for 5 days, and growth inhibition was observed and recorded daily. A single pathogen cultured at the same time served as a blank control, and each group was repeated three times. Colony diameter was observed daily, and the inhibition rate was calculated at the end of the experiment: Inhibition rate (%) = (Control group colony diameter - Treatment group colony diameter) / Control group colony diameter × 100. Results of the antagonistic pathogen experiment are shown below. Figure 8 .

[0093] like Figure 8 As can be seen, *Trichoderma harzianum* TG-GY-GYGZ showed a significantly higher inhibition rate against *Fusarium solani* than *Trichoderma viride* TS-GY-GYGZ (P < 0.05). *Trichoderma harzianum* TH-GY-GYGZ showed a significantly higher inhibition rate against *Fusarium oxysporum* than *Trichoderma viride* TS-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ showed a significantly higher inhibition rate against *Fusarium oxysporum* than *Trichoderma harzianum* TG-GY-GYGZ (P < 0.05), and *Trichoderma viride* TS-GY-GYGZ showed a significantly higher inhibition rate against *Penicillium desquam* than both *Trichoderma harzianum* TH-GY-GYGZ and *Trichoderma harzianum* TG-GY-GYGZ (P < 0.05). All three strains showed inhibition rates above 30% against *Alternaria alternata*, but there were no significant differences among the strains (P > 0.05). It is evident that Trichoderma harzianum TH-GY-GYGZ, Trichoderma chlorophyllum TS-GY-GYGZ, and Trichoderma hookerianum TG-GY-GYGZ all exhibit antagonistic effects against the four pathogenic fungi.

[0094] Example 3: Preparation of bio-organic fertilizer from bagged cultivation of Gastrodia elata fungus residue

[0095] (1) Compatibility evaluation of the three strains

[0096] Three functional strains—Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma hookeriana TG-GY-GYGZ—were isolated, identified, and screened from the substrate of Gastrodia elata grown in bags. These strains simultaneously exhibited antagonistic effects against ginseng pathogens, degradation of allelopathic substances, and degradation of pentachloronitrobenzene. Each strain was then cultured on a plate. Using a sterile punch, 5mm diameter mycelial cakes were taken from the confluent culture medium and transferred to a new PDA medium. The three strains were cultured in pairs and co-cultured. The culture dishes were placed in a 28°C incubator, and the growth of the three strains was observed periodically. The compatibility test of the three strains is shown in [reference needed]. Figure 9 .

[0097] like Figure 9 As can be seen from the observation, after a period of cultivation, the growth of these three strains was very good. The mycelial growth of Trichoderma harzianum, Trichoderma viride, and Trichoderma hookeriana was dense and uniform, and there was no antagonism among the three strains, indicating that they were compatible strains.

[0098] (2) Screening of solid-state fermentation process for wheat bran by three strains

[0099] Add water to wheat bran to a moisture content of 60%, sterilize, and obtain wheat bran culture medium. Inoculate the wheat bran culture medium at a 1% inoculum rate (v / w), and then individually inoculate each of the following: *Trichoderma harzianum* TH-GY-GYGZ, *Trichoderma viride* TS-GY-GYGZ, and *Trichoderma hookeriana* TG-GY-GYGZ, with an effective viable count of 1×10⁻⁶. 7 The effective viable count of each strain in the co-inoculation (a mixture of Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma teugenol TG-GY-GYGZ) was 1×10⁻⁶ cfu / mL and the effective viable count of each strain in the co-inoculation (a mixture of Trichoderma harzianum TH-GY-GYGZ, Trichoderma chlorophyllin TS-GY-GYGZ, and Trichoderma teugenol TG-GY-GYGZ) was 1×10⁻⁶ cfu / mL. 7 (CFU / mL), with an uninoculated control, and cultured at 28℃ for 7 days to obtain wheat bran solid-state fermented microbial fertilizer. pH was measured using a pH meter, and viable cell count was determined using the standard plate dilution method. The effects of the three strains on wheat bran solid-state fermentation on pH and viable cell count are shown in [reference needed]. Figure 10 .

[0100] from Figure 10 It can be seen that after 7 days, the pH of all inoculated treatments was significantly higher than that of the blank control (P < 0.05). The pH of the co-inoculation group with three Trichoderma strains (Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma hookeri TG-GY-GYGZ) was significantly higher than that of the single inoculation group (Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, or Trichoderma hookeri TG-GY-GYGZ, P < 0.05). The effect of the three strains on the viable cell count of wheat bran solid-state fermentation followed the same pattern as their effect on pH. Therefore, the co-inoculation process of three Trichoderma strains in wheat bran fermentation is beneficial to increasing both pH and viable cell count.

[0101] (3) Compound of bio-organic fertilizer made from bagged cultivation of Gastrodia elata fungus residue

[0102] This bio-organic fertilizer, made from bagged cultivation of Gastrodia elata fungus compost, consists of 76.18 wt% organic fertilizer raw materials, 18.82 wt% nutrient element raw materials, and 5 wt% wheat bran solid fermentation microbial fertilizer. The organic fertilizer raw material formula comprises 50 wt% bagged Gastrodia elata fungus compost, 5 wt% each of soybean cake, peanut cake, rapeseed cake, and cottonseed cake, 20 wt% bone meal, and 10 wt% wheat bran. The nutrient element formula consists of 26.98 wt% NH4HCO3, 10.79 wt% KH2PO4, 35.98 wt% K2SO4, 17.99 wt% MgSO4•7H2O, 3.65 wt% FeSO4•7H2O, 0.55 wt% MnSO4, 0.66 wt% CuSO4•5H2O, 0.78 wt% ZnSO4•7H2O, 2.44 wt% H3BO3, and 0.18 wt% (NH4)2MoO4. The wheat bran solid-state fermented microbial fertilizer is a solid-state fermentation product of three strains of bacteria using wheat bran as the sole culture medium. (Wheat bran was mixed with water to a moisture content of 60%, sterilized, and the resulting wheat bran culture medium was obtained. A mixture of three Trichoderma species (Trichoderma harzianum TH-GY-GYGZ, Trichoderma viride TS-GY-GYGZ, and Trichoderma hookeriana TG-GY-GYGZ) was inoculated into the wheat bran culture medium at a 1% inoculation rate (v / w). The effective viable count of each strain in the mixture was 1×10⁻⁶.) 7 The volume of the mixture of three Trichoderma species (cfu / mL) constitutes 1% of the wheat bran culture medium. Incubation at 28℃ for 7 days yields solid-state fermented wheat bran fertilizer; the effective viable count in the solid-state fermented wheat bran fertilizer is ≥0.2×10⁻⁶. 7 cfu / g).

[0103] Before application, mix the organic fertilizer raw materials, nutrient raw materials and solid wheat bran fermented microbial fertilizer according to the above formula. This will give you the bag cultivation Gastrodia elata fungus bran bio-organic fertilizer. Prepare it on the spot before use.

[0104] Example 1: Screening of suitable dosage of Gastrodia elata mycelium residue bio-organic fertilizer for bagged cultivation

[0105] An experiment was conducted in Shiling Town, Siping City, Jilin Province. The experimental material was two-year-old ginseng sprouts (average 2g / root). A low-dose group (295.36g / m³) of bag-cultivated Gastrodia elata fungus residue bio-organic fertilizer was set up. 2 ), medium dose group (590.72g / m 2 High-dose group (1181.44 g / m³) 2Four treatment groups were established: a control group (without fertilizer), a ginseng bed, and a control group (without fertilizer). Each ginseng bed consisted of 32 rows (bed dimensions: 1.5m × 10m), with 10 ginseng seedlings planted per row. To ensure the repeatability and reliability of the results, every four rows formed a replicate group. Key indicators of ginseng production, saponin content, and soil physicochemical properties were measured after harvest. The effects of different application rates on key indicators of ginseng production under forest cover over three years are shown in [reference needed]. Figure 11 The effects of different application rates on ginsenosides in 3-year-old forest-grown ginseng are shown in [the table below]. Figure 12 The effects of different application rates on the physicochemical properties of ginseng soil under forest cover after 3 years are shown in [reference needed]. Figure 13 .

[0106] Depend on Figure 11 The results show that the fresh weight of ginseng in the medium-dose group was significantly higher than that in the high-dose group and the control group (P < 0.05). The dry weight ratio of the medium-dose group was significantly higher than that of other treatment groups (P < 0.05). The thousand-seed weight of ginseng in the medium-dose group was significantly higher than that in the low-dose group, significantly higher than that in the low-dose group, and significantly higher than that in the high-dose group (P < 0.05). The seedling survival rate of ginseng in the medium-dose group was significantly higher than that in the high-dose group and the control group (P < 0.05). The disease rate in both the medium-dose and high-dose groups was significantly lower than that in the control group (P < 0.05). Therefore, the use of Gastrodia elata fungus residue bio-organic fertilizer in bagged cultivation can promote ginseng root growth and increase seed weight while reducing the disease rate. Specifically, the medium-dose group (590.72 g / m³) showed the highest growth rate. 2 (This method is most effective.)

[0107] Depend on Figure 12 The results showed that the ginsenoside Rg1 in the medium-dose group was significantly higher than that in other treatment groups (P < 0.05). The sum of the nine ginsenosides (Re, Rg2, Rc, Rd, etc.) in the medium-dose and low-dose groups was significantly higher than that in the high-dose and control groups (P < 0.05). The ginsenosides Rf, Rb1, Rb2, and Rb3 in the medium-dose group were significantly higher than those in the high-dose and control groups (P < 0.05). Specifically, the medium-dose group (590.72 g / m²) had the highest concentration of ginsenosides (590.72 g / m²). 2 (This method is most effective.)

[0108] Depend on Figure 13 The results showed that the soil pH in the medium-dose and high-dose groups was significantly higher than that in the control group (P < 0.05). The field water holding capacity in the medium-dose and high-dose groups was significantly higher than that in the control group (P < 0.05). The soil bulk density in the medium-dose group was significantly lower than that in the control group (P < 0.05). The organic matter, available potassium, and available phosphorus in the high-dose group were significantly higher than those in the control group (P < 0.05). The available nitrogen in the high-dose group was significantly higher than that in other treatment groups, and the low-dose and medium-dose treatment groups were significantly higher than that in the control group (P < 0.05). Specifically, the high-dose group (1181.44 g / m³) had the highest available nitrogen content. 2 (This method is most effective.)

[0109] Example 2: Application of Gastrodia elata mycelium residue bio-organic fertilizer in old ginseng fields during bag cultivation

[0110] An experiment was conducted in Jingyu County, Baishan City, Jilin Province. The experimental material was two-year-old ginseng buds (average 3g / root). In both Pinus sylvestris and Larch forests, groups were established with bagged cultivation of Gastrodia elata fungus and its bio-organic fertilizer (Pinus sylvestris fertilized group and Larch fertilized group) and control groups (Pinus sylvestris control group and Larch control group, respectively). Each ginseng bed had 9 rows of plants (bed size 1.5m × 10m), with 10 seedlings per row. Every 3 rows formed a replicate. After harvest, key ginseng production indicators, saponin content, soil physicochemical properties, allelochemicals, and pesticide residues were measured. The effects of bagged cultivation of Gastrodia elata fungus and its bio-organic fertilizer on key ginseng production indicators in old ginseng fields are shown in Table 1; the effects of bagged cultivation of Gastrodia elata fungus and its bio-organic fertilizer on ginseng saponin content in old ginseng fields are shown in Table 2; and the effects of bagged cultivation of Gastrodia elata fungus and its bio-organic fertilizer on soil physicochemical properties, allelochemicals, and pesticide residues in old ginseng fields are shown in Table 3.

[0111] Table 1 shows that the growth of replanted ginseng in old ginseng fields improved after fertilization for three years. In the old ginseng fields under Pinus sylvestris forests, the fertilized group had significantly higher fresh weight, dry weight, thousand-seed weight, and seedling survival rate than the control group, while the disease rate was significantly lower (P < 0.05). In the old ginseng fields under Larix chinensis forests, the fertilized group had significantly higher fresh weight, dry weight, root length, thousand-seed weight, and seedling survival rate than the control group, while the disease rate was significantly lower (P < 0.05). Therefore, the use of Gastrodia elata fungus residue bio-organic fertilizer in bagged cultivation has a promoting effect on key ginseng production indicators in old ginseng fields under Pinus sylvestris and Larix chinensis forests.

[0112] Table 1. Effects of bagged cultivation of Gastrodia elata fungus residue bio-organic fertilizer on key production indicators of 3-year-old replanted ginseng from old ginseng fields.

[0113]

[0114] Note: Different lowercase letters in the same row indicate significant differences, and the same applies to the table below.

[0115] Table 2 shows that in the fertilized group of 3-year-old ginseng replanted in the Pinus sylvestris forest under old ginseng fields, the levels of ginsenosides Rg1, Rb1, Rc, Rb2, Rd, and the sum of the nine saponins were significantly higher than those in the control group (P < 0.05). Similarly, in the fertilized group of old ginseng fields under larch forest, the levels of ginsenosides Rg1, Re, Rf, Rg2, and the sum of the nine saponins were significantly higher than those in the control group (P < 0.05). This indicates that the bag-cultivated Gastrodia elata fungus residue bio-organic fertilizer promotes saponin accumulation in old ginseng fields under both Pinus sylvestris and larch forests.

[0116] Table 2. Effects of bagged Gastrodia elata mycelium residue bio-organic fertilizer on ginsenoside content in 3-year-old replanted ginseng from old ginseng fields (mg / g)

[0117]

[0118] Table 3 shows that applying bio-organic fertilizer made from the substrate of *Gastrodia elata* fungus during bag cultivation improved the soil physicochemical properties of old ginseng fields. In the old ginseng fields under *Pinus sylvestris* forests, the soil pH, organic matter, available nitrogen, available phosphorus, and available potassium content in the fertilized group were significantly higher than those in the control group (P < 0.05). The changes in soil physicochemical properties in the old ginseng fields under *Larch* forests followed the same pattern as those under *Pinus sylvestris* forests.

[0119] Both fertilization treatments on old ginseng fields under forest cover reduced the content of three allelochemicals in the soil, excluding total ginsenosides and gallic acid. In the ginseng fields under Pinus sylvestris and Larix forests, the levels of ferulic acid, cinnamic acid, and salicylic acid in the fertilized groups were significantly lower than those in the control group (P < 0.05). In the same ginseng fields, the PCNB pesticide residues in the fertilized groups were significantly lower than those in the control group (P < 0.05). This indicates that the bagged cultivation of Gastrodia elata fungus residue bio-organic fertilizer has an improving effect on the soil physicochemical properties of old ginseng fields under Pinus sylvestris and Larix forests, as well as a degradation effect on allelochemicals and pesticide residues.

[0120] Table 3. Effects of bagged cultivation of Gastrodia elata mycelium residue bio-organic fertilizer on the physicochemical properties, allelochemicals, and pesticide residues of old ginseng fields.

[0121]

[0122] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A microbial composition, characterized in that, The microbial composition consists of Trichoderma harzianum ( Trichoderma harzianum )TH-GY-GYGZ, Dark Green Trichoderma ( Trichoderma atroviride )TS-GY-GYGZ and Trichoderma hookeri ( Trichoderma hamatum Composed of TG-GY-GYGZ; The *Trichoderma harzianum* TH-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41833, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025. The *Trichoderma viride* TS-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41834, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025. The aforementioned *Trichoderma hookeri* TG-GY-GYGZ is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41832, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on March 17, 2025.

2. A biological agent, characterized in that, The biological agent includes the microbial composition of claim 1.

3. The use of the microbial composition of claim 1 or the biological agent of claim 2 in any of the following: (1) Degradation of ginseng compounds; (2) Preparation of products containing degraded ginseng compounds; (3) Reduce the incidence of disease in ginseng; (4) Prepare products that reduce the incidence of ginseng-related diseases; (5) Improve key indicators for ginseng production; (6) Prepare products that improve key indicators of ginseng production; (7) Promotes the accumulation of ginsenosides; (8) Prepare products that promote the accumulation of ginsenosides; (9) Improve the physical and chemical properties of the soil after ginseng production; (10) Prepare products that improve the physical and chemical properties of soil after ginseng production; The ginseng-derived compounds are ginseng allelochemicals and pesticide residues; The ginseng allelochemicals are one or more of ferulic acid, gallic acid, salicylic acid and cinnamic acid; The pesticide residue was pentachloronitrobenzene; The infection rate is the infection rate caused by pathogens; the pathogens are one or more of Fusarium solani, Fusarium oxysporum, Penicillium spp., and Alternaria alternata. The key indicators for ginseng production are: fresh ginseng weight, ginseng root length, ginseng seed weight per thousand seeds, ginseng seedling survival rate, and ginseng dry weight. The ginsenosides mentioned are ginsenoside Rg1, ginsenoside Rg2, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, ginsenoside Re and ginsenoside Rf; The soil physicochemical properties are pH, field water holding capacity, bulk density, organic matter content, available nitrogen content, available phosphorus content, and available potassium content.

4. The application according to claim 3, characterized in that, The products include bio-organic fertilizers.

5. A bio-organic fertilizer, characterized in that, The bio-organic fertilizer includes organic fertilizer raw materials, nutrient element raw materials, and solid fermentation microbial fertilizer; The method for preparing the solid fermented microbial fertilizer includes the step of inoculating the microbial composition of claim 1 into a culture medium for fermentation culture.

6. The bio-organic fertilizer according to claim 5, characterized in that, The organic fertilizer raw materials include the following components in weight percentage: 50wt% of bagged Gastrodia elata fungus compost, 5wt% of soybean cake, 5wt% of peanut cake, 5wt% of rapeseed cake, 5wt% of cottonseed cake, 20wt% of bone meal, and 10wt% of wheat bran; The nutritional raw materials include the following components by mass percentage: NH4HCO3 26.98wt%, KH2PO4 10.79wt%, K2SO4 35.98wt%, MgSO4•7H2O 17.99wt%, FeSO4•7H2O 3.65wt%, MnSO4 0.55wt%, CuSO4•5H2O 0.66wt%, ZnSO4•7H2O 0.78wt%, H3BO3 2.44wt%, and (NH4)2MoO4 0.18wt%.

7. A method for degrading ginseng-derived compounds, characterized in that, The method includes the step of applying the microbial composition of claim 1, the biological agent of claim 2, or the bio-organic fertilizer of claim 5 or 6; the compound is a ginseng allelochemical and a pesticide residue; the ginseng allelochemical is one or more of ferulic acid, gallic acid, salicylic acid, and cinnamic acid; and the pesticide residue is pentachloronitrobenzene.

8. A method for improving key indicators in ginseng production and / or promoting ginsenoside accumulation, characterized in that, The method includes the step of applying the microbial composition of claim 1, the biological agent of claim 2, or the bio-organic fertilizer of claim 5 or 6; the key indicators for ginseng production are ginseng fresh weight, ginseng root length, ginseng seed weight per thousand seeds, ginseng seedling survival rate, and ginseng dry weight; the ginsenosides are ginsenoside Rg1, ginsenoside Rg2, ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rb3, ginsenoside Rc, ginsenoside Rd, ginsenoside Re, and ginsenoside Rf.

9. A method for reducing the disease rate of ginseng and / or improving the physical and chemical properties of soil in ginseng-growing areas, characterized in that, The method includes the step of applying the microbial composition of claim 1, the biological agent of claim 2, or the bio-organic fertilizer of claim 5 or 6; the disease rate is the disease rate caused by the pathogen; the pathogen is one or more of Fusarium solani, Fusarium oxysporum, Penicillium spp., and Alternaria alternata. The soil physicochemical properties are pH, field water holding capacity, bulk density, organic matter content, available nitrogen content, available phosphorus content, and available potassium content.

Citation Information

Patent Citations

  • Synergistic compositions comprising a bacillus subtilis strain and a biopesticide

    CN105072915A

  • Evaluation and analysis method for preventing and controlling fusarium verticillioides of corn by chitin-reinforced trichoderma

    CN112442524A