Candida utilis strains with high efficiency of ethanol / acetic acid conversion and applications thereof

Abstract

The application discloses a Candida utilis strain for efficiently converting ethanol / acetic acid and application thereof, and belongs to the technical field of single-cell protein production. In view of the technical problems of limited biomass accumulation, low carbon source conversion efficiency and low protein yield of a wild-type Candida utilis strain when the mixed carbon source of ethanol and acetic acid is used, the application provides the Candida utilis TU546 strain with the preservation number of CGMCC NO. 39030, and the strain is cultured in a fermentation medium containing the mixed carbon source of ethanol and acetic acid, so that the fermentation strain body with high protein content is obtained, and efficient conversion from the mixed carbon source of ethanol and acetic acid to single-cell protein is realized. The strain and the method thereof are mainly used for producing single-cell protein products, and can be used as feed or food additives, and have important application value in the microbial fermentation industry.

Description

Technical Field

[0001] This invention belongs to the field of single-cell protein production technology, and relates to a prion-producing Candida strain that efficiently converts ethanol / acetic acid and its applications. Background Technology

[0002] As a core component of living organisms, protein is increasingly in demand in the food industry, feed production, and pharmaceuticals. However, global protein resources are facing the dual pressures of surging demand and limited traditional supply. Traditional livestock and aquaculture farming models, due to their high resource consumption and environmental impact, are struggling to meet the requirements of sustainable development.

[0003] Against this backdrop, microbial proteins, especially single-cell proteins, are considered a highly promising sustainable protein source. Among them, *Candida utilis* (…) Candida utilis Also known as Cyberlindnerajadinii As a recognized safe industrial microorganism, it has shown great application potential in single-cell protein production due to its high protein content, balanced amino acid composition, and ability to utilize a variety of inexpensive carbon sources.

[0004] Of particular note is that syngas, primarily composed of carbon monoxide, carbon dioxide, and hydrogen, can be metabolized by Clostridium alcohol-producing bacteria (Clostridium perfringens). Clostridium spp. The fermentation process converts the ethanol / acetic acid mixture into a non-grain, low-carbon feedstock pathway for single-cell protein production. *Candida utilis* can synergistically utilize this ethanol / acetic acid mixture as a carbon source, making it an ideal downstream consumer of the upstream syngas fermentation broth, enabling the construction of an innovative "gas-liquid-protein" biomanufacturing route.

[0005] However, the industrialization of this technology still faces key bottlenecks: First, wild-type Candida utilis strains generally suffer from limited biomass accumulation and low carbon source conversion efficiency, resulting in low final protein yield and limiting its economic viability. Second, when utilizing carbon sources such as ethanol, toxic intermediates such as acetaldehyde accumulate during cell metabolism, exerting feedback inhibition on cell growth and further limiting biomass enhancement. Furthermore, efficient fermentation processes utilizing the specific mixed carbon source of ethanol / acetic acid, particularly control strategies suitable for large-scale production, still require in-depth research and optimization.

[0006] Therefore, there is an urgent need in this field for a Candida utilis strain that can efficiently utilize a mixed carbon source of ethanol / acetic acid, has high biomass and high protein yield, and a matching high-efficiency fermentation process, in order to break through the current technical bottleneck and achieve efficient conversion from non-grain carbon sources to high-value single-cell proteins. Summary of the Invention

[0007] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0008] Therefore, the technical solution provided by this invention is as follows:

[0009] A highly efficient *Candida utilis* strain for converting ethanol / acetic acid, wherein the *Candida utilis* strain is *Candida utilis* TU546, and the taxonomic name of *Candida utilis* TU546 is: *Candida utilis*. Cyberlindnerajadinii strain Candida utilis Cyberlindnerajadinii TU546 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39030, deposited on November 3, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0010] A method for producing single-cell protein involves culturing the *Candida utilis* strain in a fermentation medium to obtain fermented cells, which are then used to produce single-cell protein.

[0011] Preferably, in the method for producing single-cell protein, the fermentation medium contains the following components: the total concentration of the mixed carbon source is 5 g / L to 50 g / L, the mixed carbon source is ethanol and acetic acid, and the mass ratio of ethanol to acetic acid in the mixed carbon source is 1:1 to 5:1.

[0012] Preferably, in the method for producing single-cell protein, the carbon source ethanol and sodium acetate are mixed in the fermenter culture, and the ratio of ethanol to sodium acetate in the mixed carbon source is 1:1 to 3:1.

[0013] Preferably, in the method for producing single-cell protein, the culture is carried out in a fermenter at a temperature of 25°C to 37°C and a pH of 5.0 to 7.0.

[0014] Preferably, in the method for producing single-cell protein, the fermentation medium further includes: ammonium sulfate at a concentration of 2 g / L to 10 g / L, potassium dihydrogen phosphate at a concentration of 0.5 g / L to 3.0 g / L, magnesium sulfate at a concentration of 0.2 g / L to 2.5 g / L, calcium chloride at a concentration of 0.1 g / L to 1.5 g / L, zinc sulfate heptahydrate at a concentration of 0.02 g / L to 0.2 g / L, and ferrous sulfate heptahydrate at a concentration of 5 mg / L to 60 mg / L.

[0015] Preferably, in the method for producing single-cell protein, the culture time is 24 to 72 hours.

[0016] A single-cell protein product, produced by any one of the methods described herein.

[0017] The application of the aforementioned Candida utilis strain in the preparation of single-cell protein feed or food additives.

[0018] The application of the described Candida utilis strain in the industrial microbial fermentation using ethanol, acetic acid, sodium acetate, or mixtures thereof.

[0019] The present invention has at least the following beneficial effects:

[0020] This application innovatively utilizes the natural advantage of *Candida utilis* in metabolizing ethanol and acetic acid, and through a multi-strategy synergy (including fermentation process optimization and key gene overexpression), achieves efficient conversion of industrial waste gas into high-value microbial protein. This work provides a practical and feasible strain modification scheme and specific process reference for subsequent large-scale cultivation of *Candida utilis*, fermentation process scale-up, substrate utilization improvement, and production cost control in industrial applications.

[0021] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0022] Figure 1 shows the colony PCR verification results of the Pro-Hyg-CYCI fragment transformant in one embodiment of the present invention, where M is the DNA marker, lane 1 is the wild-type control of strain TU389, and lanes 2-7 are the PCR verification results of the positive transformants.

[0023] Figure 2 shows the amplification of the ARS fragment on the genome of *Candida utilis* TU389 in one embodiment of the present invention, where M is the DNA marker, lanes 1 and 2 are partial bands of ARS1 amplification, lanes 3 and 4 are partial bands of ARS2 amplification, lanes 5 and 6 are partial bands of ARS3 amplification, and lanes 7 and 8 are partial bands of ARS4 amplification.

[0024] Figure 3The diagram shows the PCR verification results of different ARS transformants in one embodiment of the present invention. A represents the PCR verification results of ARS1 transformants, where lane 1 is the wild-type control of strain TU389, and lanes 2-7 are positive transformants; B represents the PCR verification results of ARS2 transformants, where lane 1 is the wild-type control of strain TU389, and lanes 2-7 are positive transformants; C represents the PCR verification results of ARS3 transformants, where lane 1 is the wild-type control of strain TU389, and lanes 2-7 are positive transformants; D represents the PCR verification results of ARS4 transformants, where lane 1 is the wild-type control of strain TU389, and lanes 2-7 are positive transformants.

[0025] Figure 4 shows the colony PCR verification of pMD18-Hyg-ARS4-GUS transformants in one embodiment of the present invention, where M is the DNA maker, lane 1 is the wild-type TU389 control, and lanes 2-9 are positive clone transformants.

[0026] Figure 5 shows the GUS staining verification of the pMD18-Hyg-ARS4-GUS transformant in one embodiment of the present invention, where 1-8 are the staining results of 8 randomly selected transformants.

[0027] Figure 6 shows the amplification of different promoter fragments on the genome of Candida utilis TU389 in one embodiment of the present invention, where M is a DNA marker, lane 1 is promoter Pro1, lane 2 is promoter Pro, lane 3 is promoter Pro3, lane 4 is promoter Pro4, lane 5 is promoter Pro5, and lane 6 is promoter Pro6.

[0028] Figure 7 shows the GUS staining of transformants containing Pro1, Pro2, Pro5, and Pro6 promoter fragments in one embodiment of the present invention, where 1-8 represent the staining of Pro1 transformants, 17-24 represent the staining of Pro2 transformants, 9-16 represent the staining of Pro5 transformants, and 25-32 represent the staining of Pro6 transformants.

[0029] Figure 8 shows the PCR verification results of Pro5 and Pro6 transformant colonies in one embodiment of the present invention, where M is a DNA marker, 1 is a wild-type control, 2-5 are the verification results of Pro5 transformant colonies, and 6-9 are the verification results of Pro6 transformant colonies.

[0030] Figure 9 shows the GUS staining verification results of Pro5 and Pro6 transformants in one embodiment of the present invention, where 1-4 are the colony verification results of Pro5 transformants and 5-8 are the colony verification results of Pro6 transformants.

[0031] Figure 10 shows the biomass, protein content, and protein yield of Pro5 and Pro6 transformants fermented with different carbon sources at 36h and 48h in one embodiment of the present invention. In the figure, A represents the growth of Pro5 and Pro6 transformants fermented with a mixed carbon source of ethanol and sodium acetate for 36h; B represents the growth of Pro5 and Pro6 transformants fermented with a mixed carbon source of ethanol and sodium acetate for 48h; C represents the growth of Pro5 and Pro6 transformants fermented with ethanol for 36h; D represents the growth of Pro5 and Pro6 transformants fermented with ethanol for 48h; E represents the growth of Pro5 and Pro6 transformants fermented with a mixed carbon source of ethanol and sodium acetate for 36h; and F represents the growth of Pro5 and Pro6 transformants fermented with sodium acetate for 48h.

[0032] Figure 11 shows the biomass, protein content, and protein yield of the pMD18-Hyg-ARS4-GUS-Pro6-2ADA6 transformant in one embodiment of the present invention when fermented with a mixed carbon source of ethanol-acetic acid and with ethanol, respectively. The left half of the figure shows the evaluation results when using a mixed carbon source of ethanol-sodium acetate, and the right half of the figure shows the evaluation results when using ethanol as the carbon source.

[0033] Figure 12 is an electrophoresis diagram of plasmid digestion verification in one embodiment of the present invention, wherein lane 1: pMD18-Hyg-ARS4-GUS-Pro6-ADA6 plasmid digested with ApaI; lane 2: pMD18-Hyg-ARS4-GUS-Pro6-ADA6 plasmid not digested with enzymes.

[0034] Figure 13 is a biomass diagram of three rounds of fermentation evaluation in the screening of acetaldehyde dehydrogenase gene ADA6 transformants in one embodiment of the present invention, where A is the result of the first round of fermentation evaluation; B is the result of the second round of fermentation evaluation; and C is the result of the third round of fermentation.

[0035] Figure 14 shows the fermentation performance of engineered strains P14 (4-9) in one embodiment of the present invention in a 5 L fermenter under different pH conditions, where A represents the biomass under different pH conditions, B represents the conversion rate under different pH conditions, and C represents the protein content and protein yield at different pH conditions after fermentation.

[0036] The taxonomic name of strain *Candida utilis* TU546 is: *Candida utilis* Cyberlindnera jadinii strain Candida utilis Cyberlindnera jadinii TU546 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39030, deposited on November 3, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0038] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not imply the presence or addition of one or more other elements or combinations thereof.

[0039] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0040] In microbial culture media, acetic acid and sodium acetate are functionally equivalent; both can be utilized by microorganisms as sources of acetate (CH3COO⁻), and should be considered equivalent substitutes within the scope of patent protection. In patent applications or protections, if "acetic acid" or "sodium acetate" is mentioned as a carbon source or nutrient, it should be understood to encompass both and mixtures of them in any proportion, as they ultimately provide the same metabolite—acetic acid ions—in microbial culture media. Example 1: Screening of Candida utilis

[0041] Take 10g of barley sample, wash thoroughly with sterile physiological saline under aseptic conditions, and collect the supernatant after standing. Inoculate 1mL of the sample solution into 100mL of enrichment medium (such as malt extract medium with added lactic acid to inhibit bacteria), and incubate at 28-30°C and 150-200 rpm for 24-48 hours with shaking. This step allows acid-tolerant yeasts such as *Candida utilis* to proliferate rapidly, while inhibiting the growth of most bacteria and molds. Melt malt extract agar or YPD agar medium and pour it onto plates. Take the enrichment culture and streak it in four zones on the plate using an inoculation loop. Invert the plate and incubate at 28-30°C for 48-72 hours. Typical colony characteristics of *Candida utilis* are milky white, smooth, moist, and with regular edges (sometimes hyphae). 26S rDNA D1 / D2 region sequence analysis confirmed it to be *Candida utilis*. The inventors named it TU389.

[0042] When ethanol is used as the sole carbon source, the OD of TU389 is... 600 The maximum value reached 2.056; with 5 g / L (NH4)2SO4 as the nitrogen source, its protein content reached as high as 42.50%, demonstrating excellent protein synthesis ability. Optimization of the shake-flask fermentation process for Candida utilis TU389.

[0043] TU389 was used as the experimental strain, and fermentation was optimized in 250 mL shake flasks.

[0044] Culture medium composition: The optimized culture medium contains: (NH4)2SO4 5 g / L, anhydrous MgSO4 1 g / L, KH2PO4 1.5 g / L, anhydrous CaCl2 0.5 g / L, ZnSO4·7H2O 100 mg / L, and FeSO4·7H2O 30 mg / L. The carbon source is a mixture of ethanol and sodium acetate, with a total concentration of 10 g / L and a mass ratio of 2:1.

[0045] Fermentation conditions: initial pH 7.0, fermentation temperature 31℃, shaker speed 180 rpm, culture time 48 h. Under these optimized conditions, the biomass of TU389 increased to 5.0 g / L, protein yield reached 2.45 g / L, and carbon source conversion efficiency increased to 50%. The biomass increased from 3.45 g / L to 5.0 g / L, protein content increased from 42.4% to 49.05%, protein yield increased from 1.4 g / L to 2.45 g / L, and carbon source conversion efficiency increased from 34% to 50%, with all core indicators showing increases exceeding 30%, validating the effectiveness of the shake-flask optimization scheme.

[0046] Scale-up culture of Candida utilis TU389 in a 5L fermenter

[0047] The optimized process parameters of the shake-flask fermentation were scaled up to a 5 L fermenter. The liquid volume was 3.5 L, and the inoculum size was 10% (v / v). A mixture of ethanol and acetic acid (mass ratio 2:1) was used as the carbon source and fed to the reactor. The fermentation process was kept constant at pH 6.0 by automatically adding 25% ammonia. The temperature was controlled at 31℃, and dissolved oxygen was controlled by adjusting the turbine rotation speed and aeration rate. After 48 h of fermentation, the cell biomass significantly increased to 28.22 g / L, and the protein yield reached 13.97 g / L.

[0048] Example 2 Screening and verification of functional elements of Candida utilis

[0049] 2.1 Bioinformatics Analysis of Functional Elements

[0050] (1) Replicator

[0051] Four endogenous ARS sequences from *Candida utilis* TU389 were obtained, with sizes of 874 bp, 1490 bp, 1798 bp, and 1921 bp, respectively, and named ARS1, ARS2, ARS3, and ARS4. Genomic DNA was extracted from *Candida utilis* TU389 strain using a yeast genome extraction kit, and its purity was verified. Using this purified genome as a template, PCR amplification of the four ARS sequences was performed to obtain complete target ARS fragments, laying the foundation for subsequent vector construction and functional validation.

[0052] (2) Promoter

[0053] Seven different endogenous functional promoters of Candida utilis TU389 were identified. Primers were designed based on the nucleic acid sequences of these seven promoters. Using the genomic DNA of Candida utilis TU389 strain as a template, the complete fragments of each promoter were obtained by PCR amplification, providing experimental materials for subsequent functional verification.

[0054] Table 1 Sources of endogenous promoters

[0055]

[0056] 2.2 Plasmid Construction

[0057] The expression vector was constructed using seamless cloning technology to obtain the recombinant expression vector.

[0058] (1) Construction of hygromycin expression cassette plasmid

[0059] Using pMD18 as the backbone vector, specific primers Pro-F / R, Hyg-F / R, and CYC1-F / R were designed to construct a recombinant plasmid containing a "promoter-HygB-terminator" expression cassette, named pMD18-Hyg.

[0060] (2) Construction of different replicon plasmids

[0061] Using pMD18-Hyg plasmid as the backbone vector, specific primers ARS1-F / R, ARS2-F / R, ARS3-F / R and ARS4-F / R were designed to construct four recombinant plasmids, which were named pMD18-Hyg-ARS1, pMD18-Hyg-ARS2, pMD18-Hyg-ARS3 and pMD18-Hyg-ARS4, respectively.

[0062] (3) Construction of GUS reporter gene plasmid

[0063] Using pMD18-Hyg-ARS4 plasmid as a template, the "Pro-Hyg-CYCI" expression cassette portion was removed by BamHI digestion, preserving the ARS4 sequence (SEQ ID NO:27) and the pMD18 backbone as the vector backbone for subsequent seamless cloning. Three target fragments were constructed: ① the Pro+Hyg fragment (the stop codon TAG at the end of the HygB gene was deleted to ensure a continuous reading frame); ② the GUS gene fragment; ③ the CYCI terminator fragment. To achieve co-expression of HygB and GUS using a single promoter, a 72 bp linker sequence was inserted between Hyg and GUS. Due to the short linker length, its sequence was integrated into the 3' homologous arm of HygB and the 5' homologous arm of GUS, allowing them to form a continuous open reading frame through homologous recombination. These three fragments were then ligated to the digested vector backbone using seamless cloning technology to construct the recombinant plasmid, named pMD18-Hyg-ARS4-GUS.

[0064] The nucleotide sequence of the ARS4 sequence (SEQ ID NO:27) is as follows:

[0065]

[0066] Seven recombinant plasmids were constructed and named pMD18-Hyg-ARS4-GUS-Pro1, pMD18-Hyg-ARS4-GUS-Pro2, pMD18-Hyg-ARS4-GUS-Pro3, pMD18-Hyg-ARS4-GUS-Pro4, pMD18-Hyg-ARS4-GUS-Pro5, pMD18-Hyg-ARS4-GUS-Pro6, and pMD18-Hyg-ARS4-GUS-7Pro.

[0067] 2.3 DH5α transformation

[0068] The conversion method is described in the instruction manual for DH5α competent cells.

[0069] 2.4 Screening of positive transformants

[0070] Single colonies of Escherichia coli grown after seamless cloning were validated by colony PCR and sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing validation.

[0071] 2.5 Electric shock conversion

[0072] Competent cells of *Candida utilis* TU389 were prepared by electroporation and dispensed into 100 μL tubes. 0.5–1 ng of plasmid was added to each tube. The mixture was transferred to a 0.2 cm electroporation cuvette and incubated on ice for 3 min. Immediately afterwards, the cuvette was placed in an electroporator and a 2.7 kV pulse was applied. After electroporation, 1 mL of pre-cooled 1 mol / L sorbitol was quickly added, and the cuvette was incubated at 28 °C and 180 rpm with shaking for 60 min. 100 μL of the cultured bacterial solution was then spread onto YM agar plates containing 450 μg / mL HygB and incubated upside down at 28 °C for 2–3 days until single colonies appeared.

[0073] 2.6 Transformer Verification and Passage

[0074] Single colonies of *Candida utilis* TU389 grown on HygB-resistant plates after electroporation transformation were passaged on resistant plates (using YM solid plates containing 450 μg / mL HygB) and verified by staining. If the recombinant plasmid successfully expressed the GUS gene in the strain, the cells would turn blue; if not expressed or the plasmid was lost, the cells would not show color. Positive transformants were passaged for 3-5 generations. After confirming plasmid stability through staining verification at each generation, subsequent fermentation evaluation was carried out.

[0075] 2.7 Primer Design

[0076] Table 2 Primers used in this experiment

[0077]

[0078] 2.8 Results and Analysis

[0079] 2.8.1 Validation of the conversion method

[0080] To evaluate the feasibility and efficiency of the optimized electroporation transformation method, we transformed the successfully constructed Pro-Hyg-CYCI fragment into randomly inserted *Candida utilis* cells. Six transformants were randomly selected for colony PCR verification to amplify the Hyg fragment (expected size 1026 bp). The results showed that the wild-type TU389 control strain showed no amplification band, while the other lanes displayed a single, clear expected band. Figure 1 Preliminary results indicate that all randomly detected transformants contain the target plasmid, with a preliminary transformation success rate of 100%.

[0081] 2.8.2 Performance Evaluation of Different Autonomous Replication Sequences

[0082] Based on the autonomously replicating sequence (ARS) nucleic acid sequence retrieved from the NCBI database and specific primers designed, PCR amplification was performed using *Candida utilis* TU389 genomic DNA as a template. The results are as follows: Figure 2 As shown, all four ARS of different sizes were amplified to obtain bright target bands of the same size as expected. Sequencing of the amplified fragments confirmed the presence of the target ARS sequence in the genome of this strain.

[0083] The four recombinant plasmids were then electroporated into *Candida utilis* TU389 competent cells in their free form. After 3 days of culture, single colonies grew on antibiotic-resistant plates. Single colonies were randomly selected for colony PCR validation targeting the HygB region (1026 bp), and the results are as follows. Figure 3 As shown, in the four verification lanes of AD, the first lane was a wild-type control and no bands were detected; the remaining lanes all showed bright and correctly sized target bands, confirming that the four recombinant plasmids were successfully transformed into Candida utilis.

[0084] Single colonies were then streaked onto antibiotic-resistant plates for passage to assess plasmid stability: the pMD18-Hyg-ARS4 transformant was stable for more than 12 passages. Combined with the previous plasmid stability assessment results, pMD18-Hyg-ARS4 demonstrated significantly better stability than other ARS plasmids, and considering the need for plasmid stability in subsequent experiments, pMD18-Hyg-ARS4 was selected as the chassis plasmid for use in related experimental procedures.

[0085] 2.8.3 Construction of the GUS reporter gene system in Candida utilis TU389

[0086] To verify whether the linker could achieve co-expression of two genes in *Candida utilis*, the expression plasmid GUS-HygB was successfully constructed. The recombinant plasmid was introduced into *Candida utilis* cells via electroporation. Single colonies were randomly selected for colony PCR verification, targeting the GUS gene. The results are as follows: Figure 4 As shown, the sequencing results confirmed the sequence was correct, indicating that the pMD18-Hyg-ARS4-GUS plasmid was successfully transformed into Candida utilis TU389 cells.

[0087] At the same time, single colonies were randomly selected for GUS staining verification, and the results were as follows: Figure 5 The results showed that all eight transformants were blue, indicating high transformation efficiency and normal expression of the GUS gene in Candida utilis TU389. This also confirmed that the 72bp linker can achieve co-expression of the two genes in Candida utilis TU389.

[0088] The positive transformant was streaked and passaged on antibiotic-containing plates, confirming its stable passage for 12 generations under selection pressure. The 12th generation strain was then transferred to antibiotic-free plates for further passage, with GUS staining performed at each generation. The results showed that no single colonies grew on antibiotic-free plates by the 6th generation. These results confirm that the recombinant circular plasmid containing ARS4 can be stably passaged for 5 generations in *Candida utilis* under no selection pressure. Its characteristic of "limited stable passage under no selection pressure" can be further extended to the Cre-loxp system for traceless editing of other strains. Based on this characteristic, the editing process can be completed without long-term plasmid maintenance, ensuring editing efficiency while avoiding residual selection markers, thus meeting the core requirements of traceless operation.

[0089] 2.8.4 Screening and Validation of Different Promoters

[0090] (1) PCR amplification and verification of endogenous promoters

[0091] To screen for Candida utilis TU389 Using the genomic DNA of this strain as a template, six candidate endogenous promoters (named Pro1, Pro2, Pro3, Pro4, Pro5, and Pro6) obtained from the NCBI database were specifically amplified by PCR. The amplification results are shown below. Figure 6 As shown.

[0092] (2) Construction, transformation and resistance screening analysis of recombinant plasmids

[0093] Using six successfully amplified promoter fragments as insertion elements, recombinant plasmids containing the GUS reporter gene were constructed using seamless cloning technology. Randomly selected clones were sequenced for verification. The results showed that the promoter fragment sequences of all recombinant plasmids were correct and the insertion direction was accurate, confirming the successful construction of all six recombinant plasmids (pMD18-Hyg-ARS4-GUS-Pro1 to pMD18-Hyg-ARS4-GUS-Pro6).

[0094] The above six recombinant plasmids were introduced into *Candida utilis* via electroporation. TU389 Competent cells were transformed and plated on YM resistance selection plates containing Hyg. After incubation at 28°C for 3 days, colony growth was observed: no single colonies grew on the selection plates corresponding to recombinant plasmids containing Pro3 and Pro4; normal single colonies grew on the plates corresponding to recombinant plasmids containing Pro1, Pro2, Pro5, and Pro6.

[0095] After screening, Pro3 and Pro4 in this embodiment are weak promoters, and their expression level of the hph gene does not reach the threshold required for hygromycin screening, so the transformants cannot acquire resistance.

[0096] (3) GUS staining and functional stability verification of positive transformants

[0097] To further verify the promoter activities of Pro1, Pro2, Pro5, and Pro6, single colonies of bacteria corresponding to the four recombinant plasmids were selected for GUS staining experiments. The results are as follows: Figure 7 As shown, all tested single colonies exhibited a distinct blue color reaction, while *Candida utilis* showed a different reaction. TU389 Wild-type strains (negative control) showed no blue staining, confirming that Pro1, Pro2, Pro5, and Pro6 can effectively drive the expression of downstream GUS reporter genes and possess promoter functional activity.

[0098] To assess the stability of promoter function, the above positive transformants were passaged five times consecutively on YM plates containing HygB, with GUS staining performed for each generation. The results showed that the Pro5 and Pro6 transformants maintained a blue staining reaction in all generations, and there was no significant difference in colony morphology, indicating that Pro5 and Pro6 could stably maintain promoter activity during passage without loss or attenuation of function. However, the Pro1 and Pro2 transformants showed a paler blue color in the GUS staining reaction during passage, presumably due to weaker promoter activity.

[0099] This embodiment aimed to screen functional elements suitable for the *Candida utilis* strain TU389, and systematic experiments were conducted on replicons, promoters, and reporter genes. The replicon ARS4 was successfully screened; this replicon remained stable for more than 12 generations under antibiotic resistance and was naturally lost after 5 passages on antibiotic-free plates. The GUS gene was successfully expressed, confirming that the linker functional element can achieve the fusion expression of two genes. Simultaneously, four promoters capable of successfully initiating the expression of the antibiotic resistance gene HygB and the reporter gene GUS were screened and named Pro1, Pro2, Pro5 (SEQ ID NO:28), and Pro6 (SEQ ID NO:29), respectively. This research lays an important foundation for subsequent construction of recombinant plasmids suitable for this yeast system and for metabolic engineering modifications.

[0100] The nucleotide sequence of Pro5 (SEQ ID NO:28) is shown below:

[0101] aagcttacagcgagcactcaaatctgccctccgagccctccggccctctcttcaacaaactcgcgctgcacttcgtcgtcagtggtgccaatcacccaacgtggaggtatcaagaggtgctccagcccacaaagcgacatcaaagacaacaaccctgccggcctacgtcctacacaccctggtgatcgcagacattgtacaaggtgccacgcaataacctacaggcaccgcacatgacgatggccttggttgtgcaaccagtgacttccacggtccacgcagcaacatgaaccacaccacccagaatcgatgcgcgcaacaacagttgttccggttcactcagccccacagcgagtcgctggcagaacacgagcctgagggcggaaagagggtagaggaaagcgcaaggacaggggacaacctggcccaattgatgtcatataaaccctctcgatcaattgagcacactcatccgccaattgacccctgttcgcagctccacgccccatgttcctcgtccctggtgtagcttctcccctaaattccagcgcttggttccgccctccctgtctcccgggtttaacgaacgtgtgtaccatctgatggtaatccgctcccgtccgcgcaacacaactcacaagcagatcacacctgtacacgccgctgctgatgcgcccaatttaattttttttctctcaatgtaggggagaagccttgggagctcccgactcccagttgggcacagctgccacctcatgacttttcctgtgtgtgcctgtctgacgttacgtgtgatgtagtggcccccgttcggtgtgttttcgcctgttgcgctgtgccccccttaaaagtataaaaggaagtgcaattgctgtttgtgttgattgttgatccttgtttcctctgtttcctcctcatcacacaagaaaggtttcttctttccaacagatacaaaacacacttacaaacaacata

[0102] The nucleotide sequence of Pro6 (SEQ ID NO:29) is shown below:

[0103]

[0104] Example 3 Engineered strain

[0105] Acetaldehyde, a key intermediate in microbial metabolism, can significantly toxicize bacterial strains through accumulation. It not only disrupts cell membrane integrity and inhibits enzymatic reaction efficiency but also induces oxidative stress, leading to cell damage and ultimately inhibiting strain growth and reducing biomass. Acetaldehyde dehydrogenases (ADAs) are core enzymes for mitigating acetaldehyde toxicity, efficiently converting toxic acetaldehyde into non-toxic acetyl-CoA, which can participate in subsequent metabolism. Therefore, overexpressing highly active ADAs is an important strategy for optimizing strain growth performance. Researchers used virtual screening, rational design, and a dual-scoring mechanism to select from 5000... Dickeyaparazeae Among the homologs of ADA (DpADA), a strain derived from... Buttiauxellasp. S04-F03 The highly active acetaldehyde dehydrogenase ADA6 was developed. This enzyme exhibits excellent catalytic performance: the acetaldehyde-to-acetyl-CoA conversion rate reaches 57.6%, which is 14.1 times that of wild-type DpADA (3.8%). Simultaneously, kinetic parameters show that its Km value is reduced by more than 90% compared to DpADA, and the kcat / Km value is increased by more than 5 times, demonstrating significantly superior affinity for acetaldehyde and catalytic efficiency, providing a highly efficient enzyme source for alleviating the acetaldehyde toxicity of the strain. Based on this, this embodiment proposes to introduce the aforementioned highly active ADA6 gene into *Candida utilis* and achieve overexpression. By strengthening the acetaldehyde metabolic pathway and reducing intracellular acetaldehyde accumulation, its toxic inhibitory effect on the strain is mitigated, ultimately increasing biomass and providing theoretical and experimental support for optimizing the industrial-scale application of *Candida utilis*.

[0106] The basic chassis carrier is the circular plasmid pMD18-Hyg-ARS4-GUS.

[0107] (1) Ethanol as a single carbon source culture medium

[0108] (NH4)2SO4 5 g / L, anhydrous MgSO4 1 g / L, KH2PO4 1.5 g / L, anhydrous CaCl2 0.5 g / L, ZnSO4·7H2O 100 mg / L, FeSO4·7H2O 30 mg / L, anhydrous ethanol 10 g / L, pH 7.

[0109] (2) Sodium acetate as a single carbon source culture medium

[0110] (NH4)2SO4 5 g / L, anhydrous MgSO4 1 g / L, KH2PO4 1.5 g / L, anhydrous CaCl2 0.5 g / L, ZnSO4·7H2O 100 mg / L, FeSO4·7H2O 30 mg / L, sodium acetate 10 g / L, pH 7.

[0111] (3) Mixed carbon source culture medium

[0112] (NH4)2SO4 5 g / L, anhydrous MgSO4 1 g / L, KH2PO4 1.5 g / L, anhydrous CaCl2 0.5 g / L, ZnSO4·7H2O 100 mg / L, FeSO4·7H2O 30 mg / L, anhydrous ethanol 6.67 g / L, sodium acetate 3.33 g / L, pH 7.

[0113] 3.3 Experimental Methods

[0114] 3.3.1 Bioinformatics analysis of acetaldehyde dehydrogenase gene

[0115] The target acetaldehyde dehydrogenase gene was identified as ADA6, which originates from... Buttiauxella sp.S04-F03 A search on the NCBI website confirmed its gene accession number as WP_232921703.1, and relevant gene sequence information was obtained. The gene was synthesized in its entirety by Suzhou Genewise Biotechnology Co., Ltd. During the synthesis process, to adapt to host expression requirements, it was synthesized according to the *Candida utilis* (*Candida utilis*) gene sequence. Cyberlindnera jadinii The codon preference of the acetaldehyde dehydrogenase gene was optimized, and the nucleotide sequence SEQ ID NO: 30 of ADA6 after optimization is shown below:

[0116]

[0117] 3.3.2 Plasmid Construction

[0118] The conversion method is described in the instruction manual for DH5α competent cells.

[0119] (1) Construction of plasmid for overexpressing acetaldehyde dehydrogenase gene

[0120] Using pMD18-Hyg-ARS4-GUS plasmid as the base chassis, ApaI and SmaI were selected as double restriction sites for vector linearization. After restriction, ApaI site was retained upstream of the insert fragment and SmaI site was retained downstream for subsequent element assembly.

[0121] The target expression cassette to be inserted consists of three parts: a promoter, an aldehyde dehydrogenase gene, and a terminator. The promoters used are the previously validated strong promoters Pro5 and Pro6; the terminator is uniformly the CYC1 terminator. Specific primers with homologous arms were designed for each of these components for PCR amplification to ensure efficient recombination between fragments and between fragments and the vector.

[0122] The two recombinant plasmids that were finally constructed were named pMD18-Hyg-ARS4-GUS-Pro6-ADA6 and pMD18-Hyg-ARS4-GUS-Pro5-ADA6, respectively.

[0123] (2) Construction of plasmid for overexpressing double-copy acetaldehyde dehydrogenase gene

[0124] Using the pMD18-Hyg-ARS4-GUS plasmid as the base, the restriction enzyme sites were the same as described above. The target expression cassette to be inserted consisted of four parts: a promoter, an acetaldehyde dehydrogenase gene linked by a linker, and a terminator. The previously validated strong promoter Pro6 was selected as the promoter; the acetaldehyde dehydrogenase gene ADA6 and the terminator were CYCI terminators. The recombinant plasmid was named pMD18-Hyg-ARS4-GUS-Pro6-2ADA6.

[0125] 3.3.3 Primer Design

[0126] Table 3 Primers used in this experiment

[0127]

[0128] 3.4 Results and Analysis

[0129] 3.4.1 Efficiency assessment of different promoters driving the ADA6 gene in transformants

[0130] To compare the transcriptional driving strength of promoters Pro5 and Pro6 on the acetaldehyde dehydrogenase gene ADA6, the recombinant plasmids pMD18-Hyg-ARS4-GUS-Pro5-ADA6 and pMD18-Hyg-ARS4-GUS-Pro6-ADA6, which were verified by sequencing, were electroporated into *Candida utilis* TU389 competent cells. The transformation products were plated on YM resistance plates containing HygB. After 3 days of culture, regular single colonies grew on the plates corresponding to both recombinant plasmids, while wild-type TU389 cells did not grow under the same selection conditions, indicating that the resistance markers were effective and the transformation was initially successful. Single colonies with good growth from both transformants were randomly selected for GUS staining verification, and colony PCR was performed on the 1410 bp portion of the ADA6 gene. The results are as follows: Figure 8 and 9 As shown: Lane 1 is the wild-type control, and lanes 2-9 are randomly selected Pro5 and Pro6 transformants, with bright bands of the correct size. Randomly selected colonies from both Pro5 and Pro6 transformants showed a distinct blue staining, confirming that both Pro5 and Pro6 possess promoter activity and can drive downstream reporter gene expression. Furthermore, the positive transformants were passaged five times consecutively on antibiotic-resistant plates, with each generation showing a blue staining result, confirming the stable inheritance of the recombinant plasmid under selection pressure. Subsequently, one strain from each of the two transformants was randomly selected, inoculated into YM liquid medium for expansion and preservation, and used for subsequent shake-flask fermentation evaluation.

[0131] To investigate the effects of promoter strength on ADA6 expression and the fermentation phenotype of the strain under different carbon source conditions, shake-flask fermentation experiments were conducted for 36 h and 48 h using mixed carbon sources, ethanol alone, and sodium acetate alone, respectively. Biomass, protein content, and protein yield were measured. The results are as follows: Figure 10 As shown:

[0132] (1) Mixed carbon source conditions

[0133] Figure 10 At 36 h, the biomass of Pro6 transformants reached 5.15±0.16 g / L and the protein yield reached 2.21±0.05 g / L, both significantly higher than that of wild-type TU389; there was no significant difference in biomass and protein yield between Pro5 transformants and wild-type; there was no statistically significant difference in protein content among the three. Figure 10 At 48 h, the biomass (5.39±0.05 g / L) and protein yield (2.55±0.03 g / L) of the Pro6 transformant remained the highest and were significantly different from those of the wild type; the Pro5 transformant was not significantly different from the wild type, and the protein content was not different among the three groups.

[0134] (2) Single ethanol carbon source conditions

[0135] Figure 10 At a median C of 36 h, the Pro6 transformant showed the best performance, with a biomass of 5.84±0.07 g / L and a protein yield of 2.68±0.05 g / L, both significantly higher than the wild type; the Pro5 transformant showed no significant difference from the wild type, and the protein content of the three was consistent. Figure 10 At 48h of mid-D, the biomass of all three groups decreased slightly due to ethanol depletion, but the Pro6 transformant still maintained the highest biomass and was significantly different from the wild type; the Pro5 transformant was still not significantly different from the wild type.

[0136] (3) Conditions for using a single sodium acetate carbon source

[0137] Figure 10 E is 36 h and Figure 10 At 48 h, there were no significant differences in biomass, protein content, and protein yield between the two transformants and the wild type. This is related to the molecular mechanism of acetic acid metabolism. Yeast's utilization of acetic acid mainly depends on upstream enzymes such as acetyl-CoA synthase. Acetaldehyde dehydrogenase is not the rate-limiting enzyme in this pathway, so its increased expression level is unlikely to cause phenotypic differences.

[0138] The results clearly demonstrate that Pro6 significantly drives ADA6 expression more strongly than Pro5. This conclusion is consistent with general principles in yeast promoter function studies, where promoter strength directly determines the transcription efficiency of downstream genes, thereby altering the fermentation phenotype of the strain by affecting the expression levels of functional proteins. For example, in Pichia pastoris, strong promoters can significantly increase β-carotene production by enhancing the expression levels of heterologous genes, while weak promoters have no significant effect. Considering the biomass and protein yield advantages of the Pro6 transformant under mixed carbon sources and ethanol in this study, Pro6 can be identified as a stronger promoter.

[0139] 3.4.2 Evaluation of the free plasmid containing the double-copy acetaldehyde dehydrogenase gene ADA6

[0140] The successfully constructed double-copy acetaldehyde dehydrogenase plasmid was transformed into Candida utilis TU389. After 3 days of culture, positive transformants grew on the plate. GUS staining of the transformed genus after subculturing showed that all transformed genus were blue, indicating that the plasmid had been successfully introduced into the strain and could be stably inherited.

[0141] Fermentation performance was validated using an ethanol-acetic acid mixed carbon source system and an ethanol-only carbon source system. Under the mixed carbon source condition, the peak biomass of the two-copy transformants reached 5.45±0.05 g / L, which was not statistically significantly different from that of the single-copy transformants (5.39±0.05 g / L). Under the ethanol-only carbon source condition, the peak biomass of the two-copy transformants was 5.45±0.15 g / L, significantly lower than that of the single-copy transformants (5.84±0.07 g / L). It is noteworthy that in both carbon source systems, such as... Figure 11 As shown, the protein content of the double-copy transformants was significantly lower than that of the wild-type strain. Therefore, further experiments on the multiple-copy gene of acetaldehyde dehydrogenase will be temporarily discontinued.

[0142] 3.4.3 Transformation of linearized plasmids of acetaldehyde dehydrogenase gene and multiple rounds of screening of engineered strains

[0143] Based on the aforementioned studies, although the functional effectiveness of acetaldehyde dehydrogenase gene overexpression using circular plasmids has been confirmed, the genetic instability and copy number variation of this system limit its industrial application potential. To obtain genetically stable engineered bacteria suitable for large-scale culture, this study obtained linearized fragments by digesting plasmids with enzymes and utilized the yeast non-homologous end joining (NHEJ) mechanism to achieve random insertion of the fragments into the genome, thereby constructing genetically stable engineered bacteria.

[0144] (1) Preparation and verification of linearized plasmids

[0145] Using the correctly sequenced recombinant pMD18-Hyg-ARS4-GUS-Pro6-ADA6 as a template, linearized fragments were obtained by digestion with only the ApaI restriction site without introducing additional homologous arms, relying on the yeast's own NHEJ mechanism for random integration. The linearization verification results are as follows: Figure 12 As shown: Lane 1 shows linearized plasmids digested with ApaI, all exhibiting a single bright band, consistent with the expected size. Lane 2 shows undigested circular plasmids exhibiting both supercoiled and open-circular morphologies, confirming successful linearization and good fragment integrity.

[0146] (2) Electroconversion of linearized plasmids and primary screening of transformants

[0147] The two purified linearized plasmids were introduced into *Candida utilis* TU389 competent cells via electroporation, and the transformation products were plated on YM-resistant plates containing hygromycin. After 3 days of culture, 56 single colonies corresponding to the ADA6 linearized plasmid grew, with uniform morphology and no contamination.

[0148] (3) Verification of resistance plate passage and stability of transformants

[0149] To exclude false-positive transformants that were "linear fragments not inserted into the genome and only temporarily residual," all 56 transformants were streaked and passaged on YM resistance plates containing hygromycin. GUS staining was performed after each generation for verification. Passage on the resistance plates allowed for continuous selection pressure, further enriching transformants with stable genomic insertion. The results showed that all transformants remained blue after 5 generations, confirming successful integration of the exogenous gene and its stable inheritance.

[0150] (4) Multi-round fermentation screening of transformants

[0151] In this embodiment, 56 transformants were screened by 250 mL shake flask fermentation using a mixed carbon source of ethanol-sodium acetate to evaluate their metabolic performance. The results are as follows: Figure 13 As shown.

[0152] First round of preliminary screening ( Figure 13 The results from the study (A) show that 16 transformants in the ADA6 group (P1-P5, P7, P8, P12, P14, P23, P31, P37, P46, P49, P54, P56) exhibited excellent performance.

[0153] Second round of screening ( Figure 13 In step B, the 16 transformants obtained from the initial screening were validated: 7 transformants in group ADA6 (P2, P3, P7, P, P12, P14, P54) showed stable performance. This round of screening ensured the reliability of the phenotypic data and further confirmed the importance of multiple rounds of screening in eliminating experimental errors and ensuring the reliability of results.

[0154] Third round of performance evaluation ( Figure 13 (C) The seven candidate strains were tested using a mixed carbon source fermentation method. Final performance analysis showed that transformant P14 was the best in the ADA6 group, with a biomass of 5.77 g / L when using a mixed carbon source.

[0155] 3.4.4 Evaluation of the optimal transformant in 5L fermentation

[0156] Based on systematic data from previous rounds of shake-flask fermentation screening, the exogenous ADA6 transformant P14 was identified as the target engineered strain due to its optimal carbon source utilization efficiency and cell protein synthesis capacity. To further evaluate the environmental adaptability, metabolic stability, and production performance of this strain under near-industrial-scale cultivation conditions, this study employed an ethanol-acetic acid mixed carbon source system simulating the carbon source composition characteristics of industrial waste gas, and conducted a scale-up verification experiment in a 5 L fermenter. Combining the previously identified optimal initial pH (6.0) for wild-type strains in this mixed carbon source fermentation, this experiment used this baseline value as the core, setting three pH gradients (5.5, 6.0, and 6.5) to systematically investigate the comprehensive effects of different pH conditions on the fermentation performance of strain P14. Specific results are as follows: Figure 14 As shown.

[0157] Depend on Figure 14 As shown in Figure A, the biomass growth trend of engineered strain P14 was consistent under different pH conditions, reaching a peak accumulation at 48 h of fermentation. However, there were significant differences in the absolute biomass and protein-related indicators among the pH groups: the pH 5.5 group performed best, with a biomass of 46.7 g / L and a protein content of 46.12%, corresponding to a protein yield as high as 21.69 g / L, demonstrating a highly efficient synergistic ability between growth and protein synthesis; the pH 6.0 group had a biomass of 25.87 g / L, lower than the pH 5.5 group, but the protein content in this group showed a peak of 52.83%, with a protein yield of 13.82 g / L; while the growth of the pH 6.5 group was significantly inhibited, with a biomass of only 14.99 g / L, a protein content of 44.25%, and a protein yield reduced to 6.64 g / L. It is noteworthy that the abnormally high protein content under pH 6.0 conditions requires further analysis through combined transcriptomics and proteomics to determine the specific regulatory pathway.

[0158] from Figure 14As shown in Figure B, the carbon source conversion efficiency data indicates that the pH 5.5 group consistently maintained the optimal conversion level: this group reached a peak conversion rate of 68.33% at 36 h of fermentation, and then slightly decreased to 63.23% at 48 h, but was still significantly higher than the other two groups. This suggests that the metabolic pathway of the strain to the ethanol-acetic acid mixed carbon source was more active under acidic conditions, resulting in higher carbon source utilization. The conversion rate of the pH 6.0 group showed a trend of first increasing and then decreasing, reaching a maximum of 55.38% at 24 h of fermentation. After that, due to the slowdown in the growth rate of the strain and the decrease in metabolic activity, the conversion rate continued to decrease, dropping to 31.66% at 48 h. The carbon source conversion efficiency of the pH 6.5 group was the worst, starting to decline continuously after 12 h of fermentation, and finally dropping to 19.04% at 48 h. This result is consistent with the low biomass data of this group, indicating that a weakly neutral pH environment inhibits the activity of the strain's core metabolic enzymes or cell membrane permeability, thereby affecting carbon source absorption and conversion, and is not suitable for the large-scale fermentation of strain P14.

[0159] Based on the comprehensive evaluation results of the core fermentation indicators such as biomass accumulation, carbon source conversion efficiency, and protein yield, the optimal initial pH for the engineered strain P14 in a 5 L fermenter system using a mixed carbon source of ethanol and acetic acid is 5.5. Under these conditions, the strain not only exhibits optimal growth rate and biomass accumulation capacity but also achieves high carbon source conversion efficiency and considerable protein yield. This provides crucial experimental evidence and data support for further optimization of fermentation process parameters and adjustment of equipment adaptability for scale-up to pilot-scale operations.

[0160] This embodiment aims to construct a high-efficiency engineered strain and increase biomass, focusing on the overexpression of acetaldehyde dehydrogenase, a key gene in the ethanol metabolism pathway. First, by comparing two promoters, Pro5 and Pro6, the Pro6 promoter, which exhibits higher expression levels, was selected. Subsequently, using this promoter, linear plasmid screening of the acetaldehyde dehydrogenase gene was conducted. The results showed that transformant P14 performed best, achieving a biomass of 5.77 g / L in mixed carbon source culture. Further scaling up the culture in a 5 L fermenter, the maximum biomass of this engineered strain increased to 46.7 g / L, protein yield increased to 21.69 g / L, and carbon source conversion rate reached 63.23%. This indicates that the engineered strain demonstrates excellent performance in both efficient biomass accumulation and carbon source utilization, providing a reliable strain basis for subsequent large-scale cultivation and industrial applications.

[0161] Through systematic screening and optimization, this invention successfully obtained the high-performance Candida utilis strain TU389. Based on this, in-depth metabolic engineering and fermentation process development were carried out, yielding the following main conclusions:

[0162] First, through performance evaluation of carbon and nitrogen source utilization capabilities, strain TU389 with the best basic performance was selected as the starting strain. Further optimization of the culture medium and fermentation conditions increased the biomass in shake flasks to 5.0 g / L, protein yield to 2.45 g / L, and carbon source conversion rate to 50%. In scale-up culture in a 5 L fermenter, constant pH control significantly increased the biomass to 28.22 g / L and protein yield to 13.97 g / L, providing key process parameters for industrial production.

[0163] Secondly, in order to construct a genetic manipulation system suitable for TU389, the replicator ARS4, which can be stably inherited under resistance conditions and naturally lost in the absence of resistance, a linker that can achieve co-expression of two genes, and four promoters (Pro1, Pro2, Pro5, Pro6) that can effectively initiate the expression of Hyg resistance gene and GUS reporter gene were screened, laying the element foundation for the metabolic engineering of this yeast.

[0164] Finally, based on the above components, an engineered strain overexpressing the acetaldehyde dehydrogenase gene was constructed. In online plasmid screening, transformant P14, driven by the Pro6 promoter, showed the best performance, achieving a biomass of 5.77 g / L in shake-flask culture. After scaling up in a 5 L fermenter, the biomass further increased to 46.7 g / L, protein yield increased to 21.69 g / L, and carbon source conversion rate reached 63.23%, demonstrating good application potential. The optimal engineered strain P14 obtained through the above method was named strain TU546 and submitted to the China General Microbiological Culture Collection Center for preservation. The taxonomic name of *Candida utilis* strain TU546 is *Candida utilis*. Cyberlindnera jadinii strain Candida utilis Cyberlindnera jadinii TU546 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39030, deposited on November 3, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0165] In summary, this invention has gradually established a complete technical system for Candida utilis from basic research to large-scale scale-up, from strain selection and genetic tool development to engineered strain construction and fermentation verification, providing strain, component and process support for its subsequent industrial application.

[0166] Current research only targets the overexpression regulation of a single acetaldehyde dehydrogenase gene, which limits its regulatory effect on metabolic pathways. Future research could further expand genetic engineering strategies to construct multi-gene fusion expression systems containing key metabolic enzymes such as alcohol dehydrogenase and acetyl-CoA synthase. By optimizing gene expression sequence, regulatory element combinations, and expression intensity ratios, a synergistic and efficient metabolic pathway network could be formed, thereby promoting stepwise biomass growth.

[0167] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A highly efficient Candida utilis strain for converting ethanol / acetic acid, characterized in that, The *Candida utilis* strain mentioned is *Candida utilis* TU546, and the taxonomic name of strain TU546 is *Candida utilis*. Cyberlindnera jadinii strain Candida utilis Cyberlindnera jadinii TU546 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 39030, deposited on November 3, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. A method for producing single-cell protein, characterized in that, The Candida utilis strain as described in claim 1 is cultured in a fermentation medium, and the fermented cells are obtained after culture, which is a single-cell protein.

3. The method for producing single-cell protein as described in claim 2, characterized in that, The fermentation medium contains the following components: the total concentration of the mixed carbon source is 5 g / L ~ 50 g / L, the mixed carbon source is ethanol and acetic acid, and the mass ratio of ethanol to acetic acid in the mixed carbon source is 1:1 to 5:

1.

4. The method for producing single-cell protein as described in claim 2, characterized in that, The carbon source in the fermenter is a mixture of ethanol and sodium acetate, with the ratio of ethanol to sodium acetate in the mixture being 1:1 to 3:

1.

5. The method for producing single-cell protein as described in claim 2, characterized in that, The culture was carried out in a fermenter at a temperature of 25℃ to 37℃ and a pH of 5.0 to 7.

0.

6. The method for producing single-cell protein as described in claim 2, characterized in that, The fermentation medium also includes: ammonium sulfate at a concentration of 2 g / L to 10 g / L, potassium dihydrogen phosphate at a concentration of 0.5 g / L to 3.0 g / L, magnesium sulfate at a concentration of 0.2 g / L to 2.5 g / L, calcium chloride at a concentration of 0.1 g / L to 1.5 g / L, zinc sulfate heptahydrate at a concentration of 0.02 g / L to 0.2 g / L, and ferrous sulfate heptahydrate at a concentration of 5 mg / L to 60 mg / L.

7. The method for producing single-cell protein as described in claim 3, characterized in that, The incubation period is 24 to 72 hours.

8. A single-cell protein product, characterized in that, The product is obtained by the method as described in any one of claims 2 to 7.

9. The use of the Candida utilis strain as described in claim 1 in the preparation of single-cell protein feed or food additives.

10. The application of the Candida utilis strain as described in claim 1 in the industrial microbial fermentation using ethanol, acetic acid, sodium acetate or mixtures thereof.

Images