Saccharomyces cerevisiae INM3209 for improving content of phytosphingosine in raw milk and application of saccharomyces cerevisiae INM3209

Abstract

The invention relates to a saccharomyces cerevisiae INM3209 capable of increasing the content of sphingosine in raw milk and application of the saccharomyces cerevisiae INM3209, the strain is saccharomyces cerevisiae, the preservation number is GDMCC NO: 67446, the preservation date is December 19, 2025, the preservation unit is Guangdong Microbial Culture Collection Center, and the preservation address is the 5th floor, No.59 building, No.100 Courtyard, Xianlie Middle Road, Guangzhou. The method has the advantages that the saccharomyces cerevisiae is fermented, so that the content of phytosphingosine in fermentation liquor can be effectively increased; the leavening agent prepared from the saccharomyces cerevisiae is added into feed and used for feeding dairy cows, has no safety risk on the health of the dairy cows, and can improve the concentration of phytosphingosine in cow milk and enhance the additional functional characteristics of the cow milk.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of industrial microorganisms, and particularly relates to a Saccharomyces cerevisiae INM3209 suitable for feed addition and yogurt fermentation and capable of increasing the content of phytosphingosine in raw cow milk and application thereof. BACKGROUND

[0002] Driven by the trend of food functionalization, consumers have more diverse functional demands for dairy products, such as emerging functions of soothing the nerves, helping sleep, and skin care.

[0003] Phytosphingosine has a chemical formula of C 18 H 39 NO3, is a white solid powder, is a precursor of ceramide, exists in the epidermis and skin surface, and is one of important oil components in human epidermis. Phytosphingosine has wide probiotic functions: ① Cholesterol regulation. Due to the similarity in structure, phytosphingosine can competitively bind to cholesterol transport proteins, thereby reducing the absorption and reabsorption of cholesterol, and has potential benefits for preventing cardiovascular diseases; ② Antioxidation. Phytosphingosine can act as a free radical scavenger, inhibit the generation and accumulation of reactive oxygen species, thereby protecting cells from oxidative damage, and has potential benefits for preventing chronic diseases; ③ Immune regulation. Studies have shown that phytosphingosine can affect the function of the immune system by enhancing the activity of natural killer cells and maintaining the balance of immune cells. This immune regulation can strengthen the immune function of the body and resist infection and inflammation; ④ Anti-tumor activity. Phytosphingosine can inhibit tumor cell proliferation and induce tumor cell apoptosis by interfering with the apoptosis signaling pathway of tumor cells and inhibiting the expression of tumor cell proliferation-related proteins, and has potential application prospects in the prevention and treatment of cancer; ⑤ Repairing skin barrier. As one of the skin oil components, phytosphingosine can quickly penetrate into the skin, combine with water in the stratum corneum to form a network structure, and lock in moisture, and naturally has the function of repairing the skin barrier.

[0004] Yeast partial species all have the ability to produce phytosphingosine, and among them, Wickerhamiella sp. is reported to be able to produce a large amount of phytosphingosine, but the strain is not evaluated for food safety, and cannot be applied to food, feed and other fields. Saccharomyces cerevisiae has a long history of use in China, and is highly safe. Therefore, screening a Saccharomyces cerevisiae strain with high phytosphingosine production and optimizing the fermentation strategy to improve its phytosphingosine production capacity is of great significance for the wide application of high-value and functional dairy products.

[0005] At present, the research direction of biological fermentation preparation of phytosphingosine is various. Patent: a high-yield phytosphingosine Saccharomyces cerevisiae strain-CN116103176A, the high-efficiency phytosphingosine Saccharomyces cerevisiae engineering strain constructed by gene engineering technology disclosed in the invention can produce 150.54 mg / g of phytosphingosine in a 5 L fermenter, but the gene engineering strain of the patent cannot be applied in the food field. Patent: a recombinant genetically engineered bacteria producing phytosphingosine and its preparation method and use-CN202410967645.6, the invention provides a recombinant genetically engineered Saccharomyces cerevisiae strain producing phytosphingosine, which also cannot be applied in the food field. Patent: a Streptococcus salivarius subsp. thermophilus producing phytosphingosine, a preparation method and application-CN120310714A, the invention provides a Streptococcus salivarius subsp. thermophilus producing phytosphingosine, which can increase the content of phytosphingosine in flavor fermented milk, but the patent does not involve fermentation medium optimization and animal feed addition. Patent: application of lactobacillus sakei CCFM1267 capable of increasing the content of phytosphingosine in fermented milk-CN120082468A, the invention provides a new use of lactobacillus sakei CCFM1267, which can significantly increase the content of phytosphingosine in the fermented milk system in combination with three strains of Streptococcus thermophilus CCFM1094 and lactobacillus delbrueckii bulgarian subsp. 2038, similarly, the patent does not involve fermentation medium optimization and is not applied in the feed related field.

[0006] Although the above patents increase the content of phytosphingosine by biological fermentation method, the genetically engineered strain cannot be applied in the food related field, and the fermentation optimization strategy only optimizes the addition of strain species and ratio, does not involve the improvement of phytosphingosine content by fermentation medium optimization, and in addition, there is no application report in the feed application field. SUMMARY

[0007] The purpose of the present application is to solve the existing technical problems, and a Saccharomyces cerevisiae INM3209 for increasing the content of phytosphingosine in raw cow milk and its application are proposed.

[0008] In order to achieve the above purpose, the technical scheme is as follows: A Saccharomyces cerevisiae for increasing the content of phytosphingosine in raw cow milk, the strain is Saccharomyces cerevisiae INM3209 ( Saccharomyces cerevisiae ), the preservation number is GDMCC NO: 67446, the preservation date is December 19, 2025, the preservation unit is Guangdong Microbial Culture Collection Center, and the preservation address is No. 59 Building, 5th Floor, 100, Jianli Middle Road, Guangzhou.

[0009] A kind of ferment prepared by saccharomyces cerevisiae for improving the content of phytosphingosine in raw cow milk.

[0010] A preparation method of a ferment, the inoculation concentration of saccharomyces cerevisiae is 1×10 6 CFU / mL;Inoculation amount: 3%;Medium components are 3 g / L yeast extract, 6 g / L peptone, 3 g / L anhydrous glucose, 2‰~3‰ L-serine, 1‰~2‰ palmitic acid;Fermentation conditions: 28℃, 220rpm culture for 4d.

[0011] The application of a ferment in preparing dairy feed.

[0012] The beneficial effects of the present application are: the screened saccharomyces cerevisiae INM3209 in the present application can effectively improve the content of phytosphingosine in fermentation broth after fermentation and optimization of fermentation time and medium nutrient components.

[0013] The ferment prepared by the saccharomyces cerevisiae INM3209 in the present application through fermentation optimization strategy, added into feed and fed to dairy cows, has no safety risk to the health of dairy cows, and can improve the concentration of phytosphingosine in cow milk and enhance the additional functional characteristics of cow milk. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 It is a standard quantitative curve diagram of phytosphingosine.

[0015] Figure 2 It is a colony diagram of saccharomyces cerevisiae INM3209 on YPD agar medium.

[0016] Figure 3 It is a phytosphingosine content diagram of fermentation broth of saccharomyces cerevisiae INM3209 in different groups.

[0017] Figure 4 It is a phytosphingosine content diagram in fresh cow milk after pasteurization in different groups. DETAILED DESCRIPTION

[0018] The present application is further described below in combination with specific embodiments: The experimental methods used in the following implementation examples are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available unless otherwise specified.

[0019] Example 1 is combined with the attached Figures 1-4 , A strain of saccharomyces cerevisiae for improving the content of phytosphingosine in raw cow milk, the strain is saccharomyces cerevisiae INM3209 ( Saccharomyces cerevisiaeThe accession number is GDMCC NO: 67446, the accession date is December 19, 2025, the depositary institution is Guangdong Provincial Center for Microbial Culture Collection, and the depositary address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0020] A starter culture prepared from a brewing yeast that increases the content of phytosphingosine in raw cow's milk.

[0021] A method for preparing a fermentation agent, wherein the inoculum concentration of *Saccharomyces cerevisiae* is 1×10⁻⁶. 6 CFU / mL; Inoculum size: 3%; Culture medium composition: 3 g / L yeast extract, 6 g / L peptone, 3 g / L anhydrous glucose, 2‰~3‰ L-serine, 1‰~2‰ palmitic acid; Fermentation conditions: 28℃, 220 rpm for 4 days.

[0022] An application of a fermentation agent in the preparation of dairy cow feed.

[0023] Screening of plant sphingosine-producing brewer's yeast I. Determination of bacterial concentration: Ten strains of *Saccharomyces cerevisiae* were taken from our own yeast strain bank stored at -80℃ and activated by streaking on YPD agar medium. After two subcultures, single colonies of the *Saccharomyces cerevisiae* strains were picked and added to 2 mL of YPD liquid medium. After culturing for 18 h to the logarithmic development phase, the culture was mixed, and 1 mL of the bacterial solution was taken for plate count to determine the viable cell count. The remaining 1 mL of bacterial solution was centrifuged at 8000 rpm for 10 min, and the YPD liquid medium was removed. After repeating this process three times, 1 mL of sterile water was added and mixed with the lower layer of bacterial precipitate, and the OD was measured. 600 Establish OD 600 The relationship with bacterial concentration.

[0024] II. Screening of *Saccharin-producing* *Saccharin* yeast: The above 10 *Saccharin* yeast strains were streaked onto YPD agar medium and cultured for 24 h. Single colonies were then picked and cultured in 3 mL of YPD liquid medium for 18 h until the logarithmic growth phase. 1 mL of the bacterial culture was taken to measure the bacterial concentration, and the concentration was adjusted to 1 × 10⁻⁶ with sterile water. 6 CFU / mL, and it was diluted at 3% ( v / v The inoculum was inoculated into 25 mL of YPD liquid medium and then placed in a shaker at 28℃ and cultured at 220 rpm for 1 day. After the culture was completed, the mixture was centrifuged at 8000 r / min for 10 min, and the phytosphingosine content in the supernatant was measured.

[0025] The culture media mentioned above are as follows: YPD liquid culture medium: Weigh 10 g yeast extract, 20 g peptone, and 20 g anhydrous glucose, dissolve in 1000 mL distilled water, and sterilize at 121℃ for 15 min.

[0026] YPD agar medium: Weigh 10 g yeast extract, 20 g peptone, 20 g anhydrous glucose, and 15 g agar and dissolve them in 1000 mL distilled water. Sterilize at 121°C for 15 min, cool to 60°C, and pour into plates for later use.

[0027] The specific test methods for the sphingosine content in the above-mentioned plants are as follows: Pipette 200 μL of fermentation broth, add 800 μL of methanol and 50 mg of C18 solid-phase extraction packing material, mix thoroughly by vortexing, centrifuge at 12000 r / min at 4℃ for 5 min, collect the supernatant, let it stand at -20℃ for 30 min, centrifuge at 12000 r / min at 4℃ for 5 min, filter through a 0.22 μm organic filter membrane, place in a sample vial, and transfer to the UPLC-MS / MS platform for detection.

[0028] Liquid chromatography-mass spectrometry conditions: Column, HYPERSIL GOLD C18 column (3 μm, 2.1 mm * 100 mm); Column temperature, 55℃; Mobile phase A, 0.1% ( v / v Formic acid aqueous solution; mobile phase B, methanol; flow rate, 0.4 mL / min; Injection volume: 1 μL; Elution gradient: 100% B isocratic elution; Ion source: ESI (Turbo Spray); Polarity: Positive; Spray voltage: 5500 V; Curtain gas: 30 psi; Collision gas: 9 psi; Nebulization temperature: 550℃; Scan mode: MRM.

[0029] like Figure 1 As shown, the standard quantitative equation for phytosphingosine is: y = 1.50376E7 × x - 1054.72637. R 2 =0.99975.

[0030] As shown in Table 1, all 10 *Saccharomyces cerevisiae* strains possessed a certain ability to produce phytosphingosine. Among them, strain ABY1101 exhibited the most outstanding phytosphingosine production ability. ABY1101, with its superior phytosphingosine production ability, was selected for subculturing stability testing.

[0031] Table 1. Phytosphingosine content in fermentation broths of different Saccharomyces cerevisiae strains

[0032] a The strain number is the identification number of the self-built strain library.

[0033] b The values ​​are the mean ± variance.

[0034] Example 2: Genetic stability test of Saccharomyces cerevisiae strain ABY1101 The *Saccharomyces cerevisiae* ABY1101 from Example 1 was streaked onto YPD solid medium for 10 consecutive generations. After each generation, a single colony was picked and cultured in 3 mL of YPD liquid medium for 24 h, then cultured for 18 h until the logarithmic growth phase. 1 mL of the bacterial culture was then taken to measure the bacterial concentration, and the concentration was adjusted to 1 × 10⁻⁶ with sterile water. 6 CFU / mL, and it was diluted at 3% ( v / v The inoculum was inoculated into 25 mL of YPD liquid medium. After culturing the medium at 220 rpm in a shaker at 28°C for 1 day, the first, fifth, and tenth generation bacterial cultures were centrifuged at 8000 r / min for 10 min, and the supernatant was used as the sample. The method for detecting phytosphingosine was as described in Example 1. Variation (%) = (phytosphingosine content) 第5代 / 第10代 - Phytosphingosine content 第1代 ) / Phytosphingosine content 第1代 *100%.

[0035] Table 2. Results of passaging stability test

[0036] a The values ​​are the mean ± variance.

[0037] The results in Table 2 show that the fermentation performance of the different generations of Saccharomyces cerevisiae ABY1101 was normal, the phytosphingosine content varied within 5%, the genetic stability of the strains was good, and they met the requirements for production and use.

[0038] Morphological observation of strain ABY1101, which has a stable and high yield of phytosphingosine in production, on YPD agar medium. Figure 2 As shown, the colonies are milky white, raised, round, smooth, and have neat edges.

[0039] The ABY1101 strain obtained through the above screening has undergone 26S rDNA D1 / D2 region sequencing. Comparative analysis shows that the 26S rDNA D1 / D2 region sequence of the strain obtained in this invention is similar to that of *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiaeWith a similarity of 99.83%, this strain can be identified as a *Saccharomyces cerevisiae* strain suitable for food fermentation. It is named *Saccharomyces cerevisiae* INM3209. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on December 19, 2025, with accession number GDMCC No: 67446. Therefore, in this application, INM3209 and ABY1101 refer to the same strain. The gene sequence of the INM3209 strain of this invention is as follows: GAGGAAAAGAAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTCGTCTATGTTCCTTGGAACA GGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCG AACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTG GGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCG Example 3: Optimization of fermentation time for brewer's yeast INM3209 First, optimize the fermentation time.

[0040] Referring to Example 1, the concentration of INM3209 bacterial culture was first determined, and the concentration was adjusted to 1×10⁻⁶. 6 CFU / mL, at 3% ( v / v The inoculum was inoculated into 25 mL of YPD liquid medium and cultured at 220 rpm at 28°C. The phytosphingosine content in the fermentation broth was tested every 1 day, referring to Example 1.

[0041] As shown in Table 3, the inoculation concentration was 1×10⁻⁶. 6 Fermentation of *Saccharomyces cerevisiae* INM3209 at CFU / mL for 4 days produced more phytosphingosine than other groups, indicating that fermentation for 4 days was optimal when the inoculum concentration was 1×10⁻⁶. 6 The optimal fermentation time for Saccharomyces cerevisiae INM3209 at CFU / mL.

[0042] Table 3. Effects of different fermentation times on the production of phytosphingosine by Saccharomyces cerevisiae

[0043] Example 4: Optimization of fermentation medium for Saccharomyces cerevisiae INM3209 Next, the composition of the fermentation medium was optimized. Based on the YPD medium composition in Example 1, four groups were set up: Group 1, no treatment; Group 2, with 2‰~3‰ of the nutrient fortifier L-serine added; Group 3, with 2‰~3‰ of the nutrient fortifier L-serine and 1‰~2‰ of the nutrient fortifier palmitic acid added; Group 4, with 1‰~2‰ of the nutrient fortifier palmitic acid added. Each group was repeated three times. 1×10 6 INM3209 bacterial culture at 3% (CFU / mL) v / v The inoculum was inoculated into 25 mL of the culture medium of each group mentioned above. The culture medium was cultured at 28°C and 220 rpm for 4 days. The phytosphingosine content in the fermentation broth was tested according to Example 1.

[0044] like Figure 3 As shown *** , p <0.0005; **** , p <0.0001, the addition of nutrient fortifiers in the culture medium significantly affected the phytosphingosine production capacity of INM3209. Adding 2‰~3‰ L-serine alone inhibited phytosphingosine production by INM3209 fermentation. However, the third group (adding 2‰~3‰ L-serine and 1‰~2‰ palmitic acid) and the fourth group (adding 1‰~2‰ palmitic acid) both promoted higher phytosphingosine production by the INM3209 strain. In particular, the fermentation broth with simultaneous addition of 2‰~3‰ L-serine and 1‰~2‰ palmitic acid showed the highest phytosphingosine yield. In conclusion, the simultaneous addition of 2‰~3‰ L-serine and 1‰~2‰ palmitic acid can further optimize the culture medium composition and promote higher phytosphingosine production by *Saccharomyces cerevisiae* INM3209.

[0045] Example 5: Application of Saccharomyces cerevisiae INM3209 fermentation agent in dairy cow feed Prepare 500 mL of INM3209 fermentation inoculum according to the procedure in Example 4. Specifically, the inoculum concentration is 1×10⁻⁶. 6 CFU / mL; Inoculum size: 3%; Culture medium composition: 3 g / L yeast extract, 6 g / L peptone, 3 g / L anhydrous glucose, 2‰~3‰ L-serine, 1‰~2‰ palmitic acid; Fermentation conditions: 28℃, 220 rpm for 4 days.

[0046] Fifteen dairy cows of the same breed, with similar age, body size, and lactation stage, were selected and divided into three groups: Group 1 received normal feeding without treatment; Group 2 was directly fed 500 mL of fermentation agent (without nutritional fortifiers: 2‰~3‰ L-serine and 1‰~2‰ palmitic acid, other components the same as in Example 3) via gavage; Group 3 was directly fed 500 mL of fermentation agent (containing nutritional fortifiers: 2‰~3‰ L-serine and 1‰~2‰ palmitic acid) via gavage. After 15 days of feeding, 50 mL of fresh milk was collected, pasteurized, and the phytosphingosine content in the milk was determined according to Example 1. During the feeding period, a veterinarian observed and monitored the health status of the dairy cows.

[0047] No significant health problems were observed in any of the dairy cows in the three groups during the feeding period, indicating that the Saccharomyces cerevisiae INM3209 fermentation agent is safe and risk-free when used as feed. Meanwhile... Figure 4 In the middle ****, p<0.0001 by Figure 4 It was found that the group not fed any fermentation agent produced very low levels of phytosphingosine in their fresh milk. The group fed with INM3209 strain fermentation broth produced significantly higher levels of phytosphingosine in their fresh milk, especially the cows fed with fermentation agents prepared with optimized fermentation media (added with nutrient fortifiers), which produced the highest levels of phytosphingosine in their fresh milk. In conclusion, INM3209 fermentation agent, when used as feed for dairy cows, effectively improves the nutritional composition of fresh milk and increases its phytosphingosine content.

[0048] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A brewing yeast strain that increases the content of phytosphingosine in raw cow's milk, characterized in that: This strain is *Saccharomyces cerevisiae* INM3209 (… Saccharomyces cerevisiae The accession number is GDMCC NO: 67446, the accession date is December 19, 2025, the depositary institution is Guangdong Provincial Center for Microbial Culture Collection, and the depositary address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. A starter culture prepared from a brewing yeast that increases the content of phytosphingosine in raw cow's milk as described in claim 1.

3. A method for preparing the fermenting agent as described in claim 2, characterized in that: The inoculum concentration of brewer's yeast is 1×10 6 CFU / mL; Inoculum size: 3%; Culture medium composition: 3 g / L yeast extract, 6 g / L peptone, 3 g / L anhydrous glucose, 2‰~3‰ L-serine, 1‰~2‰ palmitic acid; Fermentation conditions: 28℃, 220 rpm for 4 days.

4. An application of the fermentation agent as described in claim 2 in the preparation of dairy cow feed.

Images