Intron variant capable of accurately splicing and enhancing gene transcription and application of intron variant

Abstract

The invention relates to an intron variant capable of accurately splicing and enhancing gene transcription and application of the intron variant, and belongs to the technical field of biological breeding, the intron variant is a variant of a Cat1mu intron, the Cat1mu intron has a nucleotide sequence as shown in SEQ ID NO.2, and the nucleotide sequence of the intron variant is formed by mutating base AG at the 182th to 183th sites of the sequence as shown in SEQ ID NO.2 into tG, Ac, At, cG, Aa, ta, tt, tc, cc, ct or ca. According to the present invention, the sequence analysis and the saturation mutation are performed on the Cat1mu, the screening is performed to obtain the Cat1mu series variant Cat1mu2-12, the accurate splicing effect of the Cat1mu2-12 during the fusion gene expression process is verified, and the Cat1mu6, the Cat1mu7, the Cat1mu8 and the Cat1mu10 can further enhance the fusion gene expression effect.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically relating to an intron variant that precisely splices and enhances gene transcription and its applications. Background Technology

[0002] Enhancing gene expression levels without altering their spatiotemporal specificity is crucial for bioengineering and scientific research. Introns are essential components of mRNA splicing, and some introns can also act as cis-elements to enhance gene transcription. The first intron of Cat1 (castor bean catalase1) possesses this function, and its short length facilitates its application. However, this intron only enhances transcription in monocots, showing no significant effect in dicots. Furthermore, its splicing is inaccurate, leaving six bases remaining in both monocots and dicots, which greatly limits its application.

[0003] Patent CN120099074A discloses a tissue-specific promoter screening vector and its application. Specifically, by screening for mutations in the intron Cat1 (nucleotide sequence shown in SEQ ID NO.1), a variant Cat1 was obtained that can enhance transcriptional function in both monocots and dicots, with a stronger enhancing effect than the original intron. mu However, the splicing precision of this variant was not improved compared to the original intron, leaving 6 bases remaining. This results in the translation of an additional 2 amino acids, which may lead to the loss of function of the protein expressed by the fusion gene. To address this, the present invention addresses this issue in Cat1. mu Based on this, an intron variant that precisely splices and enhances gene transcription is proposed, along with its applications. Summary of the Invention

[0004] The purpose of this invention is to provide an intron variant that precisely splices and enhances gene transcription, and its application, in order to solve the above-mentioned problems.

[0005] The present invention achieves the above objectives through the following technical solutions: This invention discloses a precisely spliced ​​enhanced gene transcription intron variant, characterized in that it is Cat1. mu Intron variant, Cat1 mu The intron has a nucleotide sequence as shown in SEQ ID NO.2. The nucleotide sequence of the intron variant is composed of a mutation of base AG at positions 182-183 of the sequence shown in SEQ ID NO.2 to tG, Ac, At, cG, Aa, ta, tt, tc, cc, ct or ca.

[0006] As a further optimization of the present invention, the nucleotide sequence of the intron variant is composed of a mutation of the bases AG at positions 182-183 of the sequence shown in SEQ ID NO.2 to Aa, ta, tt or cc.

[0007] The present invention also provides the application of precisely spliced ​​enhanced gene transcription intron variants as described in claim 1 or 2 in the preparation of commercial vectors and in biobreeding.

[0008] As a further optimization of the present invention, intron variants are used to perform precise splicing during the expression of fusion genes.

[0009] As a further optimization of the present invention, intron variants are used to enhance the transcription and expression of the fusion gene.

[0010] The beneficial effects of this invention are as follows: By analyzing Cat1 mu Sequence analysis and saturation mutagenesis were performed, and Cat1 was obtained through screening. mu Cat1 series variant mu2-16 By using Cat1 mu2-16 With Cat1 mu After being transformed into Agrobacterium, the bacteria were used to infect tobacco leaves. RNA was extracted from the infected leaves and semi-quantitative RT-PCR experiments were performed to verify the presence of Cat1. mu2-16 All of them can achieve precise splicing during the expression of fusion genes. Among them, Cat1 mu6 Cat1 mu7 Cat1 mu8 and Cat1 mu10 It can also achieve the same results as Cat1. mu It significantly enhances the expression of fusion genes. Attached Figure Description

[0011] Figure 1 Cat1 mu A schematic diagram of the sequence mutations at the AG bases that lead to missplicing in a series of variants; Figure 2 Cat1 mu2-12 A diagram illustrating the precise splicing effect; Figure 3 To utilize Cat1 mu6 Cat1 mu7 Cat1 mu8 Cat1 mu10 Cat1 mu Sensitivity test results of the GUS staining system; Figure 4 To utilize Cat1 mu6 Cat1 mu7 Cat1mu8 Cat1 mu10 Cat1 mu The expression level of the GUS gene was detected (Note: the Hyg gene is a semi-quantitative internal reference gene). Figure 5 For 35S::eGFP, 35S::Cat1 mu eGFP and 35S::Cat1 mu7 Schematic diagram of the core elements of the eGFP vector (Note: The purple area indicates the position of various Cat1 intron variants, located between amino acid T at position 65 and amino acid Y at position 66 of eGFP). Figure 6 35S::Cat1 mu eGFP and 35S::Cat1 mu7 A schematic diagram of the GFP mRNA splicing effect achieved by eGFP; Figure 7 To utilize Cat1 mu and Cat1 mu7 Results of GFP gene expression level detection (Note: Hyg gene is a semi-quantitative internal reference gene). Figure 8 35S::eGFP, 35S::Cat1 mu eGFP and 35S::Cat1 mu Confocal detection results of tobacco transiently transfected with eGFP (Note: GFP is the green fluorescence channel, DIC is the bright field channel, and Merge is the superposition of green fluorescence and bright field). Figure 9 The spectrum of the pCAMBIA1300-35S vector. Detailed Implementation

[0012] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0013] I. Experimental Materials Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0014] II. Experimental Methods 1. Cat1 mu Acquisition of series variants Analysis of Cat1 and Cat1 muThe sequence (nucleotide sequence shown in SEQ ID NO.2) revealed an additional "AG" sequence 4 bp upstream of the expected splice site. It was speculated that splicing before this AG was the main reason for the remaining 6 bases; therefore, saturation mutations were performed on these two bases, ensuring that the mutated sequence would not form a new "AG" sequence with the adjacent 5'A base. Figure 1 The 11 mutated Cat1 intron sequences (Cat1...) mu2-12 Artificial synthesis was carried out.

[0015] 2. Cat1 mu2-12 Functional verification 2.1 Constructing a carrier The template and Cat1 were synthesized using forward and reverse primer pairs. mu The amplification product was fused with the GUS gene and homologously recombinated into the pCAMBIA1300-35S vector to obtain pCAMBIA1300-35S::Cat1. mu2-16 GUS and pCAMBIA1300-35S::Cat1 mu GUS was used to transform the obtained vector into E. coli, followed by colony PCR, culture, plasmid extraction, and assay. The correctly constructed vector was used for subsequent experiments.

[0016] The sequences of the forward and reverse primers are as follows: SEQ ID NO.3 F: GCCGGAGGCGCAGCTAAGGGTACCATGGTCGATCTGAGGGTAAATTT; SEQ ID NO.4 R: ATTGCCAAATGTTTGAACGATCAGGTACCTTGTTTGCCTCCCTGCT.

[0017] 2.2 Agrobacterium-mediated transformation (1) Take out the competent Escherichia coli stored at -80℃ and place it on an ice bath until it melts (about 5-10 minutes). (2) Shake the bacterial solution from the tube wall and cap to the bottom of the tube by hand. Add about 1 μg of the plasmid to be transformed into competent Escherichia coli and gently mix with your fingers. Incubate on ice for 5 minutes and gently mix several times; (3) Place the float on ice, insert the EP tube into the float, put it into liquid nitrogen for quick freezing, and continue to place it in liquid nitrogen for 2 minutes; (4) Water bath at 37℃ for 5 minutes. Immediately place on ice and let stand for 2 minutes; (5) Add 900 μl LB, gently invert and mix several times, 28℃, 2h; (6) Centrifuge at 3000 rpm for 3 min. Aspirate the supernatant, leaving about 300 μl. Gently pipette to resuspend the cells and plate them on the corresponding antibiotic plate (Rif+Gen+Kam) and incubate at 28℃.

[0018] 2.3 Tobacco contamination (1) Transform tobacco with Agrobacterium (EHA105 or GV3101) according to the tobacco growth stage, and culture at 28℃ in the dark for 2-3 days. A corresponding fluorescent empty vector should be used as a positive control. Transformation is best at 3-6 leaves of tobacco. Water thoroughly the day before injecting Agrobacterium. (2) Scrape 5-10 clones and inoculate them into 20ml of LB containing "carrier bacterial resistance + Rif" and shake overnight at 28℃; (3) Centrifuge at 3000 rpm for 10 min at room temperature and discard the supernatant; (4) Add 20 ml of washing buffer and resuspend the bacterial culture using a plastic dropper. Centrifuge at 3000 rpm for 10 min at room temperature and discard the supernatant; (5) Wash twice more; (6) Resuspend in 10 ml of injection solution. Let stand at room temperature for 1 hour; (7) Use a small syringe to draw up the bacterial solution and inject it into the tobacco leaves. Be careful not to puncture the leaves or splash the bacterial solution. When not wearing glasses, take precautions to prevent the bacterial solution from splashing into your eyes; (8) After growing under low light for 48 hours, subsequent experiments were carried out.

[0019] 2.4 GUS staining The samples were stained using Solarbio's GUS staining kit, and the specific procedures are as follows: (1) Preparation of X-Gluc staining solution: Take an appropriate amount of X-Gluc stock solution (50x) and GUS Buffer, mix them thoroughly at a ratio of 1:50 to prepare X-Gluc staining solution; (2) Take an appropriate amount of the leaves or other tissues to be stained and add an appropriate amount of GUS staining solution to completely immerse the tissues in the GUS staining solution; (3) Incubate at 37℃ for 1-24 hours. As the incubation time increases, blue color gradually appears. When the expression level is high, the site or location of GUS activity will show blue or blue spots. (4) The chlorophyll in the sample can be removed by 70% ethanol and then observed.

[0020] 2.5 RNA Extraction and Semi-Quantitative Validation 2.5.1 RNA Extraction (1) Grind the leaves (about 0.1g) into powder with liquid nitrogen, transfer to a 2.0mL tube, add Trizol to 1mL, and vortex to mix. (2) After pyrolysis on ice for more than 10 minutes, add 200 μL of chloroform and vortex at the highest speed to mix thoroughly; (3) Centrifuge at 4°C and 12000 rpm for 10 min; (4) Transfer about 550 μL of the supernatant to a regular RNase-free 1.5 mL centrifuge tube, add 600 μL of isopropanol pre-cooled in an ice-water bath, vortex to mix, and precipitate at -20℃ for more than 2 hours.

[0021] (5) Centrifuge at 4°C and 12000 rpm for 20 min, and discard the supernatant; (6) Add 1 mL of 75% ethanol pre-cooled in an ice-water bath, and mix by inverting several times. Centrifuge at 12000 rpm for 2 min, and discard the supernatant. Repeat this step once; (7) Centrifuge at 12000 rpm for 2 min, and carefully remove the supernatant using a 200 μL pipette with the yellow pipette tip covered by the white pipette tip; (8) After air drying at room temperature, add 50 μL of DEPC H2O and vortex to dissolve the RNA; (9) Transfer the RNA solution to a 1.5 mL low-adsorption tube for subsequent experiments.

[0022] 2.5.2 Reverse Transcription cDNA was prepared using the Vazyme HiScript® III 1st Strand cDNA Synthesis Kit (+gDNAwiper) reverse transcription kit. The experimental procedure is as follows: (1) Removal of residual genomic DNA: Table 1 Reaction system for removing residual genomic DNA ; Note: Place the prepared mixture in a PCR instrument and incubate at 42°C for 2 minutes.

[0023] (2) Reverse transcription: This experiment used a 20 μL reverse transcription system: Table 2 Reverse Transcription System ; Place the prepared reverse transcription mixture into the PCR instrument and set the following reverse transcription programs: 25℃, 5 min; 50℃, 45 min; 85℃, 5 min.

[0024] 2.5.3 PCR Sequencing Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using primers that cross the Cat1 intron. The product was subjected to 1.5% agarose gel electrophoresis for 30 min, and the main band was cut for sequencing.

[0025] 2.5.4 Semi-quantitative RT-PCR experiment (1) Determine the plateau phase of the internal reference gene: Using Hyg as an internal reference gene, gradient PCR with different cycle numbers was set up. All other conditions were kept the same during the PCR process, and only the cycle number was changed (18-30). The amplification products were subjected to agarose gel electrophoresis. The cycle number before the one where there was no significant difference in the brightness and thickness of the bands was the cycle number that reached the plateau phase. The final cycle number was determined to be 24.

[0026] (2) Level the template using internal parameters: Keeping other conditions constant during PCR, the template concentration was changed to ensure that the amount of internal reference gene product (band brightness) was the same for each template.

[0027] (3) Semi-quantitative RT-PCR experimental reaction system: The Yeasen 2×Hieff® PCR Master Mix (With Dye) was used in this experiment. The reaction system and reaction procedure are shown in Tables 3 and 4. Table 3 Semi-quantitative RT-PCR experimental reaction system ; Table 4 Semi-quantitative RT-PCR experimental reaction procedure ; 2.6 Conclusion All Cat1 intron variants were fused with the GUS gene and transiently transformed into tobacco. RNA was extracted from transfected leaves, reverse transcribed, and subjected to PCR electrophoresis and sequencing. The results showed that Cat1... mu2-12 All variants can be precisely spliced ​​without leaving the six bases of "TTACAG". Figure 2 ); GUS staining of the transformed leaves revealed that Cat1... mu6 Cat1 mu7 Cat1 mu8 Cat1 mu10 With Cat1 mu The blue color is deeper than that of the leaves, indicating that its GUS staining ability is greater than that of Cat1. mu Further improvements have been made ( Figure 3 Using the Hyg gene as an internal control, semi-quantitative PCR analysis was performed on the expression levels of the GUS gene in each experimental group. The results showed that, compared with Cat1... mu Compared to Cat1 mu6 Cat1 mu7 Cat1 mu8 and Cat1 mu10 The expression level of the GUS gene was significantly enhanced.

[0028] The results of GUS staining and semi-quantitative PCR analysis showed that, compared to Cat1 mu Cat1 mu6 Cat1 mu7 Cat1 mu8 Cat1 mu10 All of these can further enhance the expression of the GUS gene. Figure 4 ).

[0029] 3. Experiments involving fusion with the eGFP gene GUS staining and semi-quantitative PCR analysis showed that Cat1 mu7 It has the strongest ability to enhance transcription. Therefore, Cat1 mu and Cat1 mu7 Introns were inserted into the middle of the codons corresponding to amino acids 65 to 66 of the eGFP chromogenic center and constructed into the pCAMBIA1300-35S vector to obtain 35S::eGFP and 35S::Cat1. mu eGFP, 35S::Cat1 mu7 eGFP ( Figure 5 The bacteria were then transformed with Agrobacterium and used to infect tobacco. After 48 hours of infection, infected leaves were collected for reverse transcription, PCR sequencing, and semi-quantitative analysis. The specific procedures were the same as in Section 2.

[0030] The results show that 35S::Cat1 mu eGFP splicing residue of 6 bases, 35S::Cat1 mu7 eGFP splicing was completely correct. Figure 6 Furthermore, semi-quantitative PCR analysis showed that, compared to 35S::eGFP, 35S::Cat1... mu eGFP and 35S::Cat1 mu7 The GFP transcription level of eGFP was significantly enhanced, and 35S::Cat1 mu7 The transcriptional level of eGFP was significantly higher than that of 35S::Cat1. mu eGFP ( Figure 7 This result indicates that Cat1 mu7 It has the strongest ability to enhance the expression of fusion genes; Observed under a confocal microscope, 35S::Cat1 compared to 35S::eGFP. mu No fluorescence signal was observed in eGFP, 35S::Cat1 mu7 The fluorescence signal of eGFP was significantly enhanced. Figure 8 This result indicates that, although Cat1 muIt can enhance transcription, but the amino acids resulting from the translation of residual bases after splicing cause eGFP to lose its luminescent function. It is speculated that this is because the remaining 6 bases lead to the translation of two additional amino acids, disrupting the core structure of the GFP chromophore. Meanwhile, Cat1... mu7 It can not only enhance transcription and ensure complete accuracy of splicing sites, but also further enhance the sensitivity of the eGFP reporter system.

[0031] Based on the above conclusions, it can be concluded that compared to Cat1 mu Cat1 mu7 Cat1 mu6 Cat1 mu8 and Cat1 mu10 It has irreplaceable advantages and application scenarios.

[0032] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A precisely spliced ​​enhanced gene transcription intron variant, characterized in that, Cat1 mu Variants of the intron, namely Cat1 mu The intron has a nucleotide sequence as shown in SEQ ID NO.2, wherein the nucleotide sequence of the intron variant is composed of a mutation of base AG at positions 182-183 of the sequence shown in SEQ ID NO.2 to tG, Ac, At, cG, Aa, ta, tt, tc, cc, ct, or ca.

2. The precisely spliced ​​enhanced gene transcription intron variant according to claim 1, characterized in that: The nucleotide sequence of the intron variant consists of a mutation of base AG at positions 182-183 of the sequence shown in SEQ ID NO.2 to Aa, ta, tt, or cc.

3. The application of a precisely spliced ​​enhanced gene transcription intron variant as described in claim 1 or 2 in the preparation of commercial vectors and in biobreeding.

4. The application according to claim 3, characterized in that: Precise splicing is performed during fusion gene expression using the intron variant as described in claim 1.

5. The application according to claim 3, characterized in that: The transcription and expression of the fusion gene are enhanced using the intron variant as described in claim 2.

Images