Application of rice OsABI3 gene in reduction of rice cadmium accumulation

Abstract

The invention provides application of a rice OsABI3 gene in reduction of rice cadmium accumulation, and relates to the technical field of gene engineering. The nucleotide sequence of the gene is shown as SEQ ID NO.1. The application comprises the following steps: directionally editing the OsABI3 gene by using a CRISPR / Cas9 technology, constructing a recombinant vector, transforming the recombinant vector into a rice callus by using an agrobacterium-mediated method, and screening to obtain a mutant plant. The rice OsABI3 gene is cloned and analyzed for the first time, the nucleotide sequence of the gene is disclosed, a new perspective is provided for illuminating an unknown molecular mechanism of rice for regulating and controlling Cd transportation, and the invention also proves that the OsABI3 gene has the capability of regulating and controlling Cd accumulation of rice; and tissue anatomy and fluorescent staining experiments prove that the OsABI3 has the capability of limiting radial transportation of Cd ions in a root system.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to rice. OsABI3 Application of genes in reducing cadmium accumulation in rice. Background Technology

[0002] Rice has a strong capacity for cadmium (Cd) absorption and accumulation, and the problem of excessive Cd content in rice has become a major challenge threatening my country's food security and public health. Cd accumulation in rice involves complex biological processes, and root Cd absorption and translocation are crucial prerequisites for Cd accumulation in the aboveground parts of the plant. Radial transport in roots, by regulating the process of Cd entering the stele from the root surface and thus affecting the flux of Cd transport to the aboveground parts, is a key step determining Cd accumulation. Elucidating the mechanism of radial cadmium transport in rice roots can provide new insights into reducing cadmium accumulation in rice.

[0003] Studies have shown that radial Cd transport in rice roots involves two pathways: the symplast and the apoplast. The symplast pathway relies on active transport mediated by metal transport proteins (such as OsNramp5, OsHMA3, and OsCd1), and significant progress has been made in understanding its molecular mechanisms. The apoplast pathway, on the other hand, facilitates the rapid migration of Cd ions through passive diffusion across the intercellular spaces. Strengthening the apoplast barrier function can effectively limit Cd transport via the apoplast pathway, significantly reducing Cd content in rice. However, the underlying molecular mechanisms remain poorly understood. Therefore, elucidating the development of the apoplast barrier in rice roots and its regulatory mechanism on Cd transport will not only contribute to refining the theoretical framework of Cd accumulation in rice but also provide crucial support for technological innovation in Cd pollution control in rice. Summary of the Invention

[0004] The purpose of this invention is to provide rice OsABI3 Application of genes in reducing cadmium accumulation in rice.

[0005] The technical problem solved by this invention is achieved by the following technical solution.

[0006] This application provides rice. OsABI3 factors For its application in reducing cadmium accumulation in rice, the nucleotide sequence of the above gene is shown in SEQ ID No. 1.

[0007] Furthermore, the above application uses CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant strains.

[0008] Furthermore, the aforementioned targeted editing includes the following steps: S1: Perform PCR amplification on the above genes to obtain amplification products; S2: Link the above product onto the expression vector to construct a recombination editing expression vector; S3: The above-mentioned recombinant editing expression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.

[0009] This invention also provides a biomaterial comprising the genes described above.

[0010] The embodiments of the present invention also provide the application of the above-mentioned biomaterials in reducing the cadmium sensitivity of rice; and / or, in cultivating cadmium-tolerant rice varieties.

[0011] Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. This invention is the first to clone and analyze rice. OsABI3 The gene was discovered, and its nucleotide sequence was published, providing a new perspective for elucidating the unknown molecular mechanism by which rice regulates Cd transport.

[0012] 2. This invention is the first to use CRISPR / Cas9 technology to knock out rice. OsABI3 The gene was analyzed, resulting in two homozygous mutant lines. Hydroponic experiments revealed a significant increase in Cd content in the aboveground parts of the knockout mutant, demonstrating... OsABI3 The gene has the ability to regulate Cd accumulation in rice; and this was confirmed using tissue anatomy and fluorescence staining experiments. OsABI3 It has the ability to restrict the radial transport of Cd ions in the root system. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0014] Picture 1 Constructed in Embodiment 1 of the present invention OsABI3 Map of the vector used to knockout mutant; Picture 2 In the CRISPR / Cas9 target system of Embodiment 1 of the present invention OsABI3 A schematic diagram of the target location; Picture 3 Wild-type rice seedlings in Example 2 of this invention and OsABI3 Growth plot of knockout mutant; Picture 4 In Embodiment 2 of the present invention OsABI3 Knockout mutant and wild-type rice seedling biomass; Picture 5 In Embodiment 2 of the present invention OsABI3Comparison of Cd accumulation characteristics in rice seedlings of knockout mutant and wild-type rice; Picture 6 In Embodiment 3 of the present invention OsABI3 Distribution characteristics of Cd in the roots of knockout mutant and wild-type rice seedlings; Picture 7 Constructed in Embodiment 4 of the present invention OsABI3 A map of the vectors used to overexpress the mutants; Picture 8 In Embodiment 4 of the present invention OsABI3 A schematic diagram of expression levels in overexpression mutant lines. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0016] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to specific embodiments.

[0017] Example 1 To verify OsABI3 To assess the effect of reducing cadmium accumulation in rice, this embodiment first designed a control plant, i.e., [the following was performed / conducted / implemented]. OsABI3 The construction and identification of knockout mutants include the following steps: The rice seeds were purchased from Hangzhou Baige Biotechnology Co., Ltd. The information was based on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / index.shtml). OsABI3The genome sequence information of (LOC_Os01g68370) was obtained, and the nucleotide sequence was then sequenced. The sequencing results are shown in SEQ ID No. 1. Based on the above sequencing results, target sites and sgRNA sequences were designed. The target site sequence is shown in SEQ ID No. 3, and the sgRNA sequence is shown in SEQ ID No. 4. Oligo dimers were then prepared based on the sgRNA sequences. The synthesized upstream and downstream Oligo were dissolved in water to a concentration of 10 μM, mixed according to the following reaction system (see Table 1), heated at 95°C for 3 minutes, and then slowly cooled to 20°C at approximately 0.2°C / second. After the Oligo dimers were prepared, they were constructed into a CRISPR / Cas vector. The components were mixed on ice according to the following reaction system (see Table 2), and after thorough mixing, the mixture was reacted at room temperature (20°C) for 1 hour to construct the knockout recombinant vector.

[0018] SEQ ID No.3: CACCCCTGATCTCCGCCGCCGGG SEQ ID No.4: CACCCCTGATCTCCGCCGCC Table 1 Preparation of Oligo dimer system

[0019] Table 2. Construction of Hybrid Systems of Knockout Recombinant Vectors

[0020] After construction, the knockout recombinant vector was transformed into callus tissue of rice Zhonghua 11 using Agrobacterium-mediated transformation. DNA was extracted from transgenic candidate plants and wild-type plants, and mutant plants were obtained through PCR amplification and sequencing verification. The verification primer F is shown in SEQ ID No. 5, primer R is shown in SEQ ID No. 6, and the amplification program is shown in Table 3. SEQ ID No.5: 5'-CACCTACACGCACACAGACA-3' SEQ ID No.6: 5'-AGGTCGAGGAGCTGGTCTAT-3' Table 3 PCR amplification system

[0021] After identification and screening, two mutant plants with different knockout mutation types were obtained. abi3 1 and abi3 2 Stable strains were obtained by propagating two generations of each strain. For example... Picture 1 As shown, Picture 1 To build OsABI3 Map of the vector used to knockout mutant Picture 2 For CRISPR / Cas9 target systems OsABI3 The target site locations are shown in red triangles, with the specific locations of the knockout targets indicated by the arrows. The target site locations for these two mutation types are as follows: abi3 1 It contains a deletion of 20 bases and a substitution of 1 base. abi3 2 There is an insertion of one base. This mutation makes the corresponding abi3 1 and abi3 2 Genes in strains OsABI3 The amino acid sequence formed by translation terminates prematurely. OsABI3 Unable to express itself normally, resulting in the corresponding strains OsABI3 Functionality missing.

[0022] Example 2 This embodiment verifies that... OsABI3 The analysis of differences in biomass and Cd content in different organs of the knockout mutant included the following steps: Wild-type rice Zhonghua 11 and OsABI3 Knockout mutant ( abi3 1 and abi3 2 Seeds were disinfected with 30% H2O2 for 30 min, then soaked in 0.1% NaClO for 1 day, and then germinated in a constant temperature and humidity chamber (35 ℃, 60% humidity). After the seeds sprouted, they were transferred to 1 L black hydroponic boxes and watered daily with an appropriate amount of deionized water to maintain a certain level of humidity. When the seedlings had three leaves and one bud, seedlings with uniform growth were selected for transplanting. The seedlings were then transplanted into 2.5 L black cultivation pots, 4 plants per pot, and cultured in complete nutrient solution for 14 days. Afterward, they were treated with 5 μmol / L (Cd) Cd. During the culture period, the nutrient solution was changed every 3 days, and the pH of the nutrient solution was adjusted to 5.5 with HCl or NaOH. Natural light was used, and an appropriate amount of deionized water was added. Picture 3 As shown, samples were taken 7 days after Cd treatment (seedling stage). The samples were divided into underground and aboveground parts. After drying, the dry weight was taken as biomass, and the Cd content of the plants was determined according to the national standard (GB5009.268-2025).

[0023] Differences in biomass during hydroponic experiments, such as Picture 4As shown, the scale bar is 10cm; different lowercase letters represent the significance of differences in the same strain under different treatments ( p <0.05). Hydroponic results showed that Cd treatment reduced... OsABI3 Growth and biomass of knockout mutants and wild-type rice OsABI3 The knockout mutant showed no significant difference in biomass compared to wild-type rice, indicating that the knockout... OsABI3 The gene does not affect the growth of rice.

[0024] Differences in Cd content in different parts of the hydroponic experiment, such as Picture 5 As shown, *, ** and *** represent... OsABI3 Knockout mutants and wild-type p <0.05、 p <0.01 and p Significant differences were observed at values ​​<0.001. Then, the Cd transport coefficient and Cd accumulation were calculated using the following method: Cd translocation coefficient = Aboveground Cd content / Underground Cd content Cd accumulation = Cd content × biomass It can be concluded that in the hydroponic experiment, OsABI3 The knockout mutant showed significantly higher levels of Cd in the underground part, aboveground part, Cd translocation coefficient, and Cd accumulation than wild-type rice.

[0025] The above results indicate that OsABI3 Cd accumulation in rice is regulated by limiting Cd absorption in the roots and translocation from the roots to the aboveground parts.

[0026] Example 3 This embodiment further describes... OsABI3 The analysis of differences in radial cadmium transport in the roots of knockout mutants included the following steps: Wild-type rice Zhonghua 11 and OsABI3 Knockout mutant ( abi3 1 and abi3 2Seeds were disinfected with 30% H2O2 for 30 min, then soaked in 0.1% NaClO for 1 day, and then germinated in a constant temperature and humidity chamber (temperature 35 ℃, humidity 60%). After the seeds broke through the root bud, they were transferred to a 1 L black hydroponic box. After germination for 4 days, they were treated with 5 μmol / L (Cd). After 24 h of Cd treatment, root segments about 3 cm from the root tip were collected, preserved in 0.9% physiological saline, frozen, and sectioned. After labeling Cd ions with a fluorescent probe using Leadmium Green AM dye, the distribution of fluorescence in the sections was observed using a laser confocal scanning microscope.

[0027] Differences in Cd ion distribution in roots, such as Picture 6 As shown, en represents the endodermis, x represents xylem vessels, ex represents the exodermis, red arrows indicate that the flow of cadmium ions is blocked at the endodermis or exodermis, green fluorescence represents cadmium ions, and the scale bar is 20 μm; *** indicates OsABI3 Knockout mutants and wild-type p Significant differences exist at <0.001. The fluorescence intensity of Cd ions in the roots of wild-type rice is weaker, but... OsABI3 The knockout mutant roots showed stronger Cd ion fluorescence intensity. Picture 6 A), and OsABI3 The fluorescence intensity of Cd ion staining in the knockout mutant of rice roots was significantly higher than that in wild-type rice. Picture 6 BD), indicating OsABI3 It reduced the distribution of Cd ions in rice roots.

[0028] The above results indicate that OsABI3 By restricting the radial transport of Cd ions in the root system, the absorption of Cd in the roots and its translocation from the roots to the aboveground parts are reduced.

[0029] Example 4 This embodiment has been implemented. OsABI3 The construction and identification of overexpression lines include the following steps: Using rice ZH11 cDNA as a template, OsABI3 The gene CDS sequence was amplified to obtain PCR amplification products, which were then forward-ligated into the overexpression vector pCAMBIA1300. OsABI3 The CDS sequence is shown in SEQ ID No. 2, and the overexpression vector map is shown in... Picture 7 As shown. The ligation product was transformed into *E. coli* DH5α competent cells, positive clones were selected, plasmids were amplified, and then transformed into *Agrobacterium*. Callus infection and tissue culture were used to obtain... OsABI3 Enhanced expression OsABI3Overexpression lines. To be developed for wild-type ZH11 (WT) and... OsABI3 Overexpression lines ( OsABI3-OE-1~6 After the seedlings reached 30 days of growth, approximately 0.1g of roots were cut off, thoroughly ground with liquid nitrogen, and total RNA was extracted using a bioengineered total RNA extraction reagent (Trizol). cDNA was synthesized from the RNA samples using the TaKaRa PrimeScript FAST RT reagent Kit with gDNA Eraser; and RT-qPCR was performed using the TaKaRa TB Green Premix Ex Taq II FAST qPCR kit, with primers q... OsABI3 -F as shown in SEQ ID No. 7, primer q OsABI3 -R is shown in SEQ ID No. 8, and the RT-qPCR reaction system is shown in Table 4: SEQ ID No.7: 5'-TGAACCCCTGTAGTGTGTCG-3' SEQ ID No.8: 5'-TTAGCCGCAATGGACACGA-3' Table 4 RT-qPCR amplification system

[0030] Wild-type ZH11 and OsABI3 Overexpression lines OsABI3 Relative expression level differences, such as Picture 8 As shown, *** indicates OsABI3 Overexpression lines and wild type p Significant differences exist at values ​​<0.001. After analysis, OsABI3-OE-1~6 middle OsABI3 The relative expression level was significantly higher than that of the wild type. These results indicate that the six strains obtained according to this implementation plan... OsABI3 All overexpression lines were positive.

[0031] Comparing Example 1 and Example 4, it can be seen that rice OsABI3 The gene can significantly reduce cadmium accumulation in rice. Therefore, based on this conclusion, rice containing [a specific gene] can be prepared. OsABI3 Genetic biomaterials are used to reduce the cadmium sensitivity of rice; or to breed cadmium-tolerant rice varieties based on them.

[0032] In summary, the embodiments of the present invention provide rice OsABI3 and its genes OsABI3 Its application in reducing cadmium accumulation in rice, and the first cloning and analysis of rice OsABI3The gene was discovered, and its nucleotide sequence was published, providing a new perspective for elucidating the unknown molecular mechanism of Cd transport regulation in rice. This invention is the first to knock out rice using CRISPR / Cas9 technology. OsABI3 The gene was analyzed, resulting in two homozygous mutant lines. Hydroponic experiments revealed a significant increase in Cd content in the aboveground parts of the knockout mutant; indicating... OsABI3 The gene has the ability to regulate Cd accumulation in rice. This was confirmed using tissue anatomy and fluorescence staining experiments. OsABI3 The gene has the ability to restrict the radial transport of Cd ions in the root system.

[0033] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

Claims

1. Rice OsABI3 The application of genes in reducing cadmium accumulation in rice is characterized by, The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, It also includes using CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant lines.

3. The application according to claim 2, characterized in that, The targeted editing includes the following steps: S1: Perform PCR amplification on the gene to obtain the amplification product; S2: Link the product onto an expression vector to construct a recombination-editing expression vector; S3: The recombinant editing expression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.

4. A biomaterial, characterized in that, Includes the gene as described in claim 1.

5. The application of the biomaterial as described in claim 4 in reducing cadmium sensitivity in rice; and / or in breeding cadmium-tolerant rice varieties.

Images