Method for high-efficiency scarless editing of leprosy genome and application thereof

Abstract

This invention discloses a highly efficient and scarless method for editing the genome of myxobacteria and its applications. This invention combines the ISDra2 TnpB cleavage system of *Gastrococcus radiodurans* with the MxRedET homologous recombination system of myxobacteria to form a one-step scarless editing platform (MxDIRECT). ISDra2 is responsible for precisely locating and cleaving the target DNA, and MxRedET then efficiently integrates or replaces fragments at the cleavage site, enabling gene knockout, insertion, and replacement operations. This method increases the editing efficiency of myxobacteria from 1% to 100%, shortens the cycle from 3-6 months to 5-7 days, and allows for one-step two-site scarless editing through a two-site design. A single cleavage can knock out up to approximately 80kb of DNA, while two cleavages can knock out up to 200kb; and single nucleotide substitutions can be performed at any location, achieving precise base editing. This technology provides an efficient and precise tool for modifying the functional genes and metabolic pathways of myxobacterial chassis cells, significantly advancing synthetic biology research.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering and gene editing technology, specifically relating to a method and application for efficient and traceless editing of the genome of myxobacteria. Background Technology

[0002] In recent years, the rapid development of gene editing technologies (such as CRISPR-Cas9, TALENs, and ZFNs) has provided powerful tools for biological research and bioengineering applications. However, existing technologies still have significant limitations: while the CRISPR-Cas9 system is widely used, its homologous recombination (HDR) efficiency is low in many organisms, large gene fragment insertion (>5 kb) is difficult, and there is a risk of off-target effects; while traditional recombination systems (such as RecA) often have insufficient editing efficiency in prokaryotes. TnpB nuclease, as an RNA-guided nuclease of the IS200 / IS605 transposon family, has advantages such as small size (about 400-500 aa), convenient delivery, and high targeting, but it is difficult to achieve precise editing when used alone due to the lack of an efficient recombination mechanism. On the other hand, the RedET recombination system (derived from the λ phage Red homologous recombination pathway), although capable of mediating efficient homologous recombination through Redα (RecE) and Redβ (RecT), lacks targeting and usually requires reliance on cutting systems such as CRISPR-Cas9. Currently, the combination of Cas9 and RedET is still limited by the large molecular weight of Cas9 and the delivery challenges.

[0003] Myxobacteria, as a group of Gram-negative bacteria with unique social behavior and rich metabolic diversity, can produce novel and functionally diverse bioactive substances, showing great application potential in drug development, biocontrol, and other fields. However, due to the slow growth and difficult genetic manipulation of myxobacteria, the application of traditional gene editing methods in myxobacteria faces many limitations, greatly hindering in-depth research on their metabolic mechanisms and the efficient development of bioactive substances. Currently, commonly used myxobacterial gene editing technologies, such as conjugation transfer and homologous recombination, suffer from low editing efficiency, long cycles, and complex operations, making it difficult to achieve precise modification of the myxobacterial genome. The RedET system is a highly efficient homologous recombination technology that can significantly improve DNA recombination efficiency by expressing specific recombinant proteins, and has achieved good results in gene editing of various microorganisms. However, in myxobacteria, the RedET system still faces challenges such as single editing target and difficulty in precisely modifying some complex gene sites. The TnpB system, as a novel RNA-guided endonuclease system, has advantages such as small protein size, high editing flexibility, and broad targeting range, showing great application prospects in the field of gene editing. However, applying the TnpB system alone to myxobacteria suffers from problems such as unstable editing efficiency, microhomology repair, and poor editing effects on certain specific gene structures. Therefore, overcoming the shortcomings of existing technologies and developing an efficient and precise gene editing technology for myxobacteria is a pressing technical challenge. Combining the RedET and TnpB systems in myxobacteria is expected to fully leverage the advantages of both systems, compensate for their respective shortcomings, provide new technical means for the genetic modification and functional research of myxobacteria, and promote the development of related fields.

[0004] To address the shortcomings of existing gene editing technologies (such as CRISPR-Cas9) in prokaryotes, including low homologous recombination efficiency, difficulty in inserting large fragments, and high off-target risks, this invention proposes for the first time the combined use of the TnpB nuclease and the RedET recombination system. This method, through TnpB gRNA-guided targeted cleavage and RedET-mediated homologous recombination, enables gene knockout (seamless deletion of the target gene), gene knock-in (precise integration of large fragments), point mutation (scarless single-base editing), large-fragment DNA recombination (deletion / inversion / translocation), and simultaneous multi-gene editing. This system combines the small size and low off-target advantages of TnpB with the large-fragment recombination capabilities of RedET, effectively overcoming the limitations of existing technologies and providing a superior solution for metabolic engineering, genome rearrangement, and synthetic biology research. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a highly efficient and precise gene editing method based on the TnpB nuclease and RedET recombination system. TnpB enables high-precision targeted cleavage, while RedET facilitates efficient homologous recombination, significantly improving gene editing efficiency. This combined system combines the low off-target and small size advantages of TnpB with the large fragment integration capability of RedET, making it widely applicable to genome editing in prokaryotes and eukaryotes, providing superior solutions for synthetic biology, gene therapy, and industrial microbial modification. Furthermore, when using this method for gene editing in myxobacteria, the targeted repair fragment required after cleavage by the TnpB nuclease system consists of only 1000 bp segments in each of the left and right homologous arms. No resistance selection tags are needed between the two homologous arms, achieving scarless editing with a single genetic operation. This increases the gene editing efficiency in myxobacteria from 1% to 100%, and shortens the scarless editing cycle from 3-6 months to 5-7 days.

[0006] To achieve the objectives of this invention, the technical solution is as follows:

[0007] The TnpB nuclease involved in this invention is derived from *Radiata spp.* Deinococcus radiodurans R1 (purchased through common commercial channels), named ISDra2. The gene for this nuclease is 1227 base pairs long, and its corresponding nucleotide sequence is shown in SEQ ID NO.1. This gene encodes 408 amino acids, and its corresponding amino acid sequence is shown in SEQ ID NO.2. The TnpB nuclease needs to form a functional complex with guide RNA (gRNA) through specific recognition and synergistic interaction to perform its targeted cleavage function. The guide RNA is 251 base pairs long and contains a 20 bp guide sequence, which is 20 bp downstream of the TAM site TTGAT and guides the TnpB nuclease to cleave the target site. The nucleotide sequence of the guide RNA is shown in SEQ ID NO.3.

[0008] This invention constructs a cleavage plasmid pZJY4111-ISDra2 capable of targeted cleavage in myxobacteria. The vector is a myxobacterial autonomous replication vector containing a high-copy-rate replication initiation site from *E. coli*, an apramycin resistance gene (apra), and a TnpB system controlled by a vanillic acid-inducible promoter. When using this plasmid for targeted cleavage in myxobacteria, only a 20 bp change in the guide sequence is needed to target different cleavage sites each time. The nucleotide sequence of the pZJY4111-ISDra2 plasmid is shown in SEQ ID NO.4.

[0009] The RedET homologous recombination system used in this invention is a myxobacterial endogenous recombination system: MYqaJ-MRecT (Myxococcales bacterium isolate new MAG-79 k141_1563931; Accession Number: JAEUJW010000039). The MYqaJ gene is 924 base pairs long, and its corresponding nucleotide sequence is shown in SEQ ID NO.5. This gene encodes 307 amino acids, and its corresponding amino acid sequence is shown in SEQ ID NO.6. The MRecT gene is 846 base pairs long, and its corresponding nucleotide sequence is shown in SEQ ID NO.7. This gene encodes 281 amino acids, and its corresponding amino acid sequence is shown in SEQ ID NO.8. This recombination system was constructed on the pSWU19 plasmid using Gbison assembly. Expression was activated using the moderate-strength promoter rrnd5 to construct the RedET recombination system expression vector. The vector is a myxobacterial integration vector containing a high-copy-rate replication initiation site, a kanamycin resistance gene (kmR), and a phage integration site from *E. coli*. attP A promoter rrnd5 with moderate expression intensity in myxobacteria and a homologous recombinase system expressed under the control of this promoter were named pSWU19-rrnd5 MYqaJ-MRecT-Km, and its nucleotide sequence is shown in SEQ ID NO.9.

[0010] Therefore, a first aspect of the present invention is to provide a gene editing system comprising a cutting plasmid pZJY4111-ISDra2 and a RedET recombination system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km; the nucleotide sequence of the cutting plasmid pZJY4111-ISDra2 is shown in SEQ ID NO.4; and the nucleotide sequence of the RedET recombination system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km is shown in SEQ ID NO.9.

[0011] Preferably, the main vector backbone of the cleavage plasmid is the myxobacterial autonomous replication plasmid pZJY4111, which contains a high copy number replication initiation site from Escherichia coli, an apramycin resistance gene, a vanillic acid inducible promoter, and a TnpB cleavage system induced by the promoter.

[0012] Preferably, the main vector backbone of the RedET recombinant system expression plasmid is the myxobacterial integration plasmid pSWU19, which contains a high copy number origin of replication from Escherichia coli, a kanamycin resistance gene, and a phage integration site. attP The promoter rrnd5 and the homologous recombinase system MYqaJ-MRecT expressed under the control of this promoter.

[0013] Preferably, the TnpB cleavage system comprises a TnpB encoding gene and a guide RNA; the guide RNA is a reRNA, and its 3' end contains a 20 bp guide sequence that is complementary to the gene to be knocked out and guides the TnpB nuclease to cleave the target site.

[0014] Preferably, the nucleotide sequence of the TnpB encoding gene is shown in SEQ ID NO.1; and the nucleotide sequence of the guide RNA is shown in SEQ ID NO.3.

[0015] Preferably, the homologous recombinase system MYqaJ-MRecT comprises two genes, MYqaJ and MRecT; the nucleotide sequence of the MYqaJ gene is shown in SEQ ID NO.5; and the nucleotide sequence of the MRecT gene is shown in SEQ ID NO.7.

[0016] A second aspect of the present invention is to provide an engineered bacterium comprising the gene editing system described above.

[0017] A third aspect of the present invention is to provide the application of the above-described gene editing system in the traceless editing of the genome of sticky bacteria.

[0018] Preferably, the seamless editing includes:

[0019] (i) Gene knockout, gene insertion, or gene replacement;

[0020] (ii) Single nucleotide editing.

[0021] A fourth aspect of the present invention is to provide a method for efficiently and scarlessly editing the genome of myxobacteria, comprising the following steps:

[0022] (1) Construction of cutting plasmid: construct cutting plasmid pZJY4111-ISDra2, and replace only the 20 bp guide sequence built into the 3' end of the reRNA of the TnpB nuclease-guide RNA system according to the different target sites, while keeping the rest of the reRNA backbone sequence unchanged;

[0023] (2) Construction of repair fragments: Select 100-1000 bp sequences at both ends of the gene to be knocked out as left and right homologous arms. Connect the left and right homologous arms into 200-2000 bp repair fragments by overlapping extension PCR. Use the repair fragments as templates and perform PCR using phosphorylation modification primers so that the 5' ends of the repair fragments are phosphorylated and thiophosphorylated, respectively.

[0024] (3) Preparation and electroporation of competent cells of myxobacteria: The homologous recombinase system MYqaJ-MRecT was integrated into the genome of myxobacteria using the RedET recombination system expression plasmid to obtain strains containing the homologous recombinase system; then competent cells were prepared from the strains, and the cutting plasmid and repair fragment were mixed and added to the prepared competent cells for gene editing to obtain the corresponding mutant strains;

[0025] (4) Removal of cutting plasmid: The cutting plasmid is removed by relaxation passage without affecting the next gene editing.

[0026] Preferably, in step (3), the expression plasmid of the RedET recombination system... attP The site can recognize sites on the myxobacterial genome. attB The site was used to integrate the recombinase system MYqaJ-MRecT into the myxobacterial genome.

[0027] Preferably, in step (3), the gene editing includes (i) gene knockout, gene insertion, or gene replacement; and (ii) single nucleotide editing.

[0028] Among them, gene knockout involves introducing TnpB-targeted cleavage plasmids and linear DNA fragments into target microorganisms containing the RedET recombination system to delete the target gene.

[0029] Gene insertion: Inserting exogenous gene fragments at the target site, using the TnpB system for cutting and RedET repair to achieve precise, scarless insertion;

[0030] Gene replacement: Precise, scarless replacement is achieved by using the TnpB system for cutting and RedET repair;

[0031] Single nucleotide editing: Precise single nucleotide editing is achieved using the TnpB system for cleavage and RedET repair, with mutation sites designed on the repair fragments.

[0032] Preferably, in step (4), the relaxation passage includes the following steps: the mutant strain with the cutting plasmid is transferred into CTT liquid medium containing kanamycin and cultured with shaking for 20-24 h, then the bacterial solution is serially diluted, the diluted bacterial solution is spread on CTT plates containing kanamycin, and after standing for 5-7 days, a single colony is picked for the following verification: 1) multiple primer pairs are designed on the cutting system plasmid for PCR verification, and the corresponding band cannot be obtained by PCR; 2) the colony is spotted or streaked on CTT plates containing apramycin and it is confirmed that the colony cannot grow. If both of the above conditions are met at the same time, the cutting plasmid removal is successful and the next round of gene editing can be carried out.

[0033] Compared with existing technologies, this invention has the following beneficial effects: The TnpB-RedET combined gene editing method proposed in this invention is reported for the first time. Compared with existing technologies, this invention does not rely on resistance tag screening, can significantly improve the efficiency of precise and scarless gene editing, has a low off-target rate, and can achieve large fragment knockout, multi-site editing, and single nucleotide editing. It increases the gene knockout efficiency in myxobacteria from 1% to 100%, and shortens the knockout cycle of myxobacteria from 3-6 months to 5-7 days.

[0034] RedET recombination is highly efficient in Gram-negative bacteria closely related to *E. coli*, while TnpB proteins are widely distributed in prokaryotes, including various archaea and bacteria. Combining these two technologies, leveraging the broad distribution of TnpB, is expected to extend RedET-related recombination processes to more non-*E. coli* prokaryotic hosts, broadening the range of editable species. Simultaneously, the TnpB-RedET combined gene editing method facilitates the rapid knockout of redundant genes, optimization of regulatory elements, precise modification of synthetic pathways, and rapid and efficient alteration of chassis cells, solidifying the foundation for synthesis. Attached Figure Description

[0035] Figure 1 This is a schematic diagram illustrating the working principle of the ISDra2-RedET combined gene editing method.

[0036] Figure 2 To validate the function of the ISDra2-RedET system in myxobacteria and optimize editing conditions. Among other things, Figure 2 (a) Photo comparison of the results of plasmid interference experiments with ISDra2 in myxobacteria. Figure 2 (b) A bar chart comparison of the plasmid interference results of ISDra2 in myxobacteria. Figure 2 (c) Comparison of gene editing results using the combined application of ISDra2-RedET with gene editing using the RedET system alone or the TnpB system alone. Figure 2 (d) is an exploration of the length of the homologous arm of the repair fragment when ISDra2-RedET is used in combination. Figure 2 (e) The effect of the ratio of targeted cutting plasmids to repair fragments on editing efficiency.

[0037] Figure 3 This is a flowchart illustrating the one-step two-site editing process when using ISDra2-RedET in conjunction.

[0038] Figure 4 This diagram illustrates the principle of using ISDra2-RedET for seamless large-fragment knockout and the principle of two-site editing. Figure 4 (a) To cut a piece at the center, an 80 kb segment can be removed; Figure 4 (b) To remove a fragment up to 200 kb, one cut is made at each end of the fragment to be removed. Figure 4 (c) is a schematic diagram of the principle of step-by-step electrospinning for dual-site editing.

[0039] Figure 5 To achieve multimodal gene editing results using ISDra2-RedET. Figure 5 (a) is the result of cutting and knocking out a large fragment when ISDra2-RedET is used together. Figure 5 (b) is the result of using ISDra2-RedET in combination to remove large fragments by making two cuts. Figure 5 (c) is the result of one-step two-site editing when ISDra2-RedET is used together. Figure 5 (d) shows the results of single nucleotide editing when ISDra2-RedET is used in combination. Detailed Implementation

[0040] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0041] Unless otherwise specified, the experimental methods in the following examples are conventional experimental methods, and the experimental reagents and consumables mentioned in the following examples are all from conventional biochemical reagent companies.

[0042] The primers were synthesized by Shanghai Sangon Biotech Co., Ltd., the restriction endonuclease was from TakaRa Biotechnology (Beijing) Co., Ltd., the DNA polymerase was from Vazyme, and the antibiotic was Aladdin. The *Escherichia coli* DH5α involved in this invention was purchased from Qingke Biotechnology. *Myxococcus faecalis* (…) Myxococcus xanthus Both DK1622 and HU04 are from our research group. Among them, strain Hu04 was obtained by modifying DK1622. For the specific construction method, please refer to the literature "An upgraded Myxococcus xanthus chassis with enhanced growth characteristics for effiffifficient genetic manipulation".

[0043] CTT liquid medium (1 L): 10 g casein, 1.97 g MgSO4·7H2O, 10 mL Tris-HCl buffer, 10 mL PBS buffer, bring the volume to 1 L with distilled water, adjust the pH to 7.6, and autoclave at 121℃ for 20 min.

[0044] In this invention, a schematic diagram illustrating the working principle of the ISDra2-RedET combined gene editing method is shown below. Figure 1 This includes the following steps:

[0045] (1) Construction of ISDra2 targeted cleavage plasmid:

[0046] The main vector backbone of this cleavage plasmid is the myxobacterial autonomous replication plasmid pZJY4111, which contains a high-copy replication initiation site, an apramycin resistance gene, a vanillic acid-inducible promoter, and a vanillic acid-induced TnpB cleavage system. This targeting cleavage system contains the TnpB (ISDra2) encoding gene, a reRNA backbone region, and a 20 bp guide sequence (i.e., the reRNA guide region) targeting the gene to be knocked out. The reRNA backbone region is 231 bp in length and is tandemly linked with ISDra2, with the sequence: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAA-3'. A 20 bp guide sequence is attached to the 3' end of the reRNA backbone region. During each construction, only this 20 bp guide sequence needs to be changed on the cutting plasmid.

[0047] (2) Construction of seamless repair fragments:

[0048] Select 100-1000 bp sequences from both ends of the gene to be knocked out as left and right homologous arms. Connect the left and right homologous arms into a 200-2000 bp repair fragment by overlapping extension PCR. Use this repair fragment as a template and perform PCR using phosphorylation modification primers so that the 5' end of the repair fragment is modified by phosphorylation and thiophosphorylation, respectively.

[0049] (3) Preparation and electroporation of competent myxobacterial cells:

[0050] Remove the *Myxococcus faecalis* DK1622-MxRedET containing MYqaJ-MRecT (or MxRedET) from the -80℃ freezer, and add 100 μL to CTT (kana) liquid medium. Incubate at 30℃ with shaking at 200 rpm for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600 If the result is 1, then 1 mL of bacterial culture should be used to prepare competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, mix 400-800 ng of the cutting plasmid and 600-3600 ng of the repair fragment, add the mixture to the prepared competent cells, mix well, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and revive in a 15 mL centrifuge tube. Revive at 30°C and 200 rpm for 4-6 h. After resuscitation, gradient plating was performed on CTT (kana + apra + vanillic acid) medium, with doses of 50 μL, 100 μL, 200 μL, and 500 μL respectively. After plating, the plates were incubated upside down in a 30°C incubator for 5-7 days, and single colonies were picked for verification.

[0051] (4) Detection of recombinants:

[0052] Single colonies were picked and grown in fresh CTT (kana+apra+vanillic acid) solid medium. After 2-3 days of growth, a suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until obvious turbidity was observed. The medium was then boiled in a metal bath at 100℃ for 5 min, followed by an ice bath for 5 min, and repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Primers for PCR detection were designed 50 bp outside the homologous arms. If knockout failed, the PCR fragment would be the original genome fragment. If the scarless editing was successful, the PCR fragment would be smaller; the size of the smaller fragment needs to be analyzed based on the specific knockout situation.

[0053] (5) Relaxing the plasmid removes the cutting plasmid from the mutant strain, facilitating the next round of gene knockout:

[0054] The mutant strain carrying the cleavage plasmid was transferred into fresh CTT (kana) liquid medium and cultured with shaking at 30°C for 20-24 h. 1 OD was then collected. 600 The bacterial count was taken as 5×10 8 Take 100 μL and mix it into 900 μL of ddH2O to prepare a 5×10⁻⁶ solution. 7 This process continues until the solution is diluted to 5 × 10⁻⁶. 1 Take 5 × 10 2 and 5×10 3 100 μL of CTT was plated under gradient conditions, and single colonies were picked for verification after 5-7 days. Multiple primer pairs were designed on the cleavage system plasmid for PCR verification. If the corresponding band could not be obtained by PCR and the obtained single colonies could not grow in CTT (apra), the system removal was successful.

[0055] Example 1: Evaluation of cutting efficiency through plasmid interference experiment

[0056] (1) Constructing a plasmid for ISDra2 to target and cleave the apraR gene

[0057] We selected TnpB (ISDra2) from *Myxococcus xanthus* for evaluation of its cleavage efficiency. We constructed the ISDra2 targeted cleavage system into the myxobacterial site-directed integration plasmid pSWU19 (reference: Wu, SS & Kaiser, D. Genetic and functional evidence that Type IV pili are required for socialgliding motility in *Myxococcus xanthus*. Mol. Microbiol. 18, 547–558 (1995)) and activated it using a vanillic acid-inducible promoter. This targeted cleavage system contains the TnpB coding gene, the reRNA backbone region, and a 20 bp guide sequence targeting the apraR gene (i.e., the reRNA guide region). The reRNA backbone region is 231 bp in length and is tandemly linked with ISDra2, with the sequence: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAA-3'. A 20 bp guide sequence, 5'-GGCAAAGGTTCCCTATGGGG-3', is attached to the 3' end of the reRNA. Using the ISDra2 system fragment as a template, PCR was performed using primers ISDra2-reRNA-f and ISDra2-reRNA-r to obtain the ISDra2-reRNA fragment targeting apramycin. Using the pSWU19 vector as a template, PCR was performed using pSWU19-f and pSWU19-r to obtain the pSWU19 vector backbone. The ISDra2-reRNA fragment and the pSWU19 vector backbone were assembled using Gbison and then transformed into *E. coli* DH5α via chemical transformation. Screening was performed on LB (Kana) plates. After 16 h, single colonies were picked for verification using check-f1 and check-r1 primers. Verified single colonies were inoculated into 5 mL of LB (Kana) for plasmid extraction. The control plasmid, compared to the cut plasmid, lacked a 20 bp guide sequence; all other parts remained the same.Using the obtained cutting plasmids as templates, PCR was performed on ISDra2-f and ISDra2-r. The resulting fragments were assembled using Gbison to obtain the control plasmid. The verification method and primers were the same as above. Thus, the cutting plasmid pSWU19-ISDra2-reRNA-Kana and the control plasmid pSWU19-ISDra2-Kana were obtained.

[0058] (2) Electroporate the cut plasmid into strain HU04

[0059] Remove *Myxococcus faecalis* HU04 from the -80℃ freezer, add 100 μL to CTT liquid medium, and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600 If the result is 1, then 1 mL of bacterial culture should be taken for the preparation of competent cells. Centrifuge the bacterial culture at 4℃ and 8000 rpm, and discard the supernatant. Add 1 mL of ddH2O pre-chilled on ice to wash the bacterial cells, centrifuge at 4℃ and 8000 rpm, discard the supernatant, and repeat the washing 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, add 2 μL of the constructed recombinase expression vector, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and revive in a 15 mL centrifuge tube. Revive at 30℃ and 200 rpm for 4-10 h. After revival, perform gradient plating on CTT (kana) resistant medium, taking 50 μL, 100 μL, 200 μL, and 500 μL respectively. After plating, incubate upside down in a 30℃ incubator for 5-7 days, then pick single colonies for verification. Pick single colonies and place them in fresh CTT (Kana) solid medium. After 2-3 days of growth, scrape an appropriate amount of bacterial cells into 20 μL ddH2O until obvious turbidity is achieved, then boil in a 100℃ metal bath for 5 min, followed by an ice bath for 5 min, repeating this process three times. Centrifuge the prepared template at 12000 rpm for 5 min, and use the supernatant for PCR detection. The detection primers are check-f2 and check-r2, yielding mutant strains HU04-ISDra2-reRNA and HU04-ISDra2. HU04-ISDra2-reRNA can target and cleave the apraR gene, causing genome fragmentation and resulting in bacterial death. HU04-ISDra2 only expresses the ISDra2 protein but does not possess the targeting cleavage function.

[0060] (3) Construct the cut plasmid, which carries the apraR gene.

[0061] The vector backbone of the cleaved plasmid was the autonomously replicating plasmid pZJY4111 (Source: Zhao, JY et al. Discovery of the autonomously replicating plasmid pMF1 from Myxococcus fulvus and development of a gene cloning system in Myxococcus xanthus. Appl. Environ. Microbiol. 74, 1980–1987 (2008).), containing a green fluorescent protein gene and the targeted cleavage of the apramycin resistance gene apraR. The DNA fragment of the green fluorescent protein was obtained by PCR using EGFP-f and EGFP-r primers. Using the pZJY4111 vector as a template, PCR was performed using pZJY4111-f and pZJY4111-r to obtain the vector backbone of pZJY4111. The pZJY4111 vector backbone fragment and the green fluorescent protein DNA fragment were assembled using Gbison and then transformed into *E. coli* DH5α via chemical transformation. Screening was performed on LB (apra) plates. After 16 h, single colonies were picked for verification using check-f2 and check-r2 primers. The verified single colonies were inoculated into 5 mL LB (kana) for plasmid extraction. Thus, the cleaved plasmid pZJY4111-EGFP-apraR was obtained.

[0062] (4) Electroporate the cut plasmid into mutant strains HU04-ISDra2-reRNA and HU04-ISDra2

[0063] To determine the cleavage efficiency of ISDra2 in myxobacteria, we electroporated the cleaved plasmid into HU04-ISDra2-reRNA and HU04-ISDra2, and the cleavage efficiency of ISDra2 was determined by the number of fluorescent single colonies on solid plates.

[0064] The site-directed mutant strains HU04-ISDra2-reRNA and HU04-ISDra2 were cultured to the logarithmic growth phase, and 1 OD was collected. 600 The bacterial count, such as: measuring OD 600If the result is 1, then 1 mL of bacterial culture should be taken for the preparation of competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, add 300 ng of linearized cleaved plasmid pZJY4111-EGFP-apraR, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and incubate in a 15 mL centrifuge tube for 6 h. After resuscitation, 10 μL, 50 μL, 100 μL, and 200 μL of the culture were spread onto CTT solid medium containing vanillic acid and apramycin and incubated for 5-7 days. The cleavage efficiency was assessed based on the number of fluorescent single colonies. Figure 2 As shown in (a), because the cleavage system in the mutant strain HU04-ISDra2-reRNA can target and cleave the apraR gene on the cleaved plasmid pZJY4111-EGFP-apraR, the apramycin resistance gene is destroyed, resulting in the bacteria being unable to grow on solid media containing apramycin and no single colonies being formed. As a control, the mutant strain HU04-ISDra2 does not have the function of targeting and cleaving apraR, so this bacteria can grow on solid media containing the apramycin resistance gene and exhibit fluorescence.

[0065] Figure 2 (b) illustrates the effect of two different constructs on the number of transformants (CFU / mL) during ISDra2 plasmid interference experiments in myxobacteria. ISDra2-reRNA effectively cleaved the apraR gene, leading to loss of apramycin resistance, and transformants barely survived on selection plates; while ISDra2 did not cleave this gene, retaining a certain number of transformants. This result validates the cleavage activity of ISDra2-reRNA on the target gene.

[0066] Example 2: Application of the ISDra2-MxRedET combined system in the scarless knockout of gene cluster 24 in myxobacterium HU04

[0067] The strain HU04-MxRedET, which previously contained the MYqaJ-MRecT recombinase system (obtained by introducing the pSWU19-rrnd5 MYqaJ-MRecT-Km plasmid into the HU04 strain), was used in a previous laboratory experiment to perform a one-step, scarless knockout of the gene encoding the ABC transporter permease in this strain. This gene is located at genomic position 1876759…1877784, corresponding to the number MXAN_RS07770, and 1026 bp was knocked out.

[0068] (1) Construct a cutting plasmid for targeted cleavage of the MXAN_RS07770 gene.

[0069] The TAM site TTGAT was searched within the MXAN_RS07770 gene. There are four TTGAT sites within this gene. One suitable TAM was selected, and a 20 bp segment was further selected from its 3' end as the guide sequence for targeted cleavage. The guide sequence is: 5'-GTCCAGCAGCCTGTGGGTGG-3'. This 20 bp guide sequence was added to the 3' end of the reRNA, thus constructing the cleavage plasmid targeting the MXAN_RS07770 gene. This describes the construction process of the cleavage plasmid map. Using a previously constructed cleavage plasmid (with pZJY4111 as the backbone) as a template, PCR was performed using RS07770-f and RS07770-r as upstream and downstream primers. The obtained fragments were recovered from the gel and assembled using Gbison to obtain the targeted cleavage plasmid pZJY4111-RS07770-apraR.

[0070] (2) Preparation of donor DNA fragments

[0071] 1000 bp segments were selected at each end of the gene to be knocked out, MXAN_RS07770, as upstream and downstream homologous arms for repair. The upstream and downstream homologous arms were then subjected to overlap extension PCR to obtain the complete donor DNA fragment. The primers for obtaining the upstream homologous arm fragment were MXAN_RS07770up-f and MXAN_RS07770up-r, with the genome of strain HU04-MxRedET as the template. The primers for obtaining the downstream homologous arm fragment were MXAN_RS07770dw-f and MXAN_RS07770dw-r, with the genome of strain HU04-MxRedET as the template. The primers for overlap extension PCR were MXAN_RS07770up-f and MXAN_RS07770dw-r, with the templates MXAN_RS07770up and MXAN_RS07770dw obtained above. After obtaining the complete donor fragment, the 5' end of the repair fragment was phosphorylated and thiophosphorylated using specific phosphorylation modification primers. The modification primers were: MXAN_RS07770up-f(s) and MXAN_RS07770dw-r(p).

[0072] (3) Gene editing was performed using the cutting plasmids and repair fragments constructed in (1) and (2).

[0073] Remove the HU04-MxRedET strain, which needs to be edited, from the -80℃ freezer. Add 100 μL to CTT (kana) liquid medium and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600If the result is 1, then 1 mL of bacterial culture should be used to prepare competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, mix 400 ng of the cleavage plasmid and 1800 ng of the donor fragment, and add them together to the competent cells. Transfer the mixture to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and thaw in a 15 mL centrifuge tube for 4-6 h. After resuscitation, 50 μL, 100 μL, 200 μL, and 500 μL of culture medium were incubated on CTT solid medium containing apramycin and vanillic acid for 5-7 days. Single colonies were then picked for verification. Each single colony was placed in fresh CTT (apra + vanillic acid) solid medium and allowed to grow for 2-3 days. A suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until significant turbidity was observed. The mixture was then boiled in a metal bath at 100°C for 5 min, followed by an ice bath for 5 min, repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Forward and reverse primers were designed within 50 bp of the homologous arms for PCR; the primer names were Δ07770check-f and Δ07770check-r.

[0074] (4) Relaxing the plating removes the cutting plasmids from the mutant strains, facilitating the next round of gene editing.

[0075] The successfully knocked-out mutant strains from (3) were transferred into new CTT (kana) liquid medium and cultured with shaking at 30°C for 20-24 h. 1 OD was then collected. 600 The bacterial count was taken as 5×10 8 Take 100 μL and mix it into 900 μL of ddH2O to prepare a 5×10⁻⁶ solution. 7 This process continues until the solution is diluted to 5 × 10⁻⁶. 1 Take 5 × 10 2 and 5×10 3 100 μL of CTT (kana) was plated under gradient conditions. After 5-7 days, single colonies were picked for verification. Multiple primer pairs were designed for PCR verification on the cut plasmid. If the corresponding band could not be obtained by PCR and the obtained single colonies could not grow in CTT (apra), the system removal was successful. The primers used for this verification were ISDra2check-f1 and ISDra2check-r1, and ISDra2check-f2 and ISDra2check-r2.

[0076] Following the methods described above, the effects of the following three gene editing strategies were compared and evaluated: (i) combined use of ISDra2-RedET; (ii) use of the RedET system alone; and (iii) use of the TnpB system alone. Results are shown in […]. Figure 2 (c) ISDra2+RT: Gene editing using ISDra2 and the repair fragment RT resulted in almost no single colony growth on solid plates due to the lack of RedET system-assisted repair, resulting in zero gene editing efficiency. RedET+RT: Gene editing using only the RedET system and the repair fragment RT resulted in zero gene editing efficiency due to the lack of selection pressure from cleavage or resistance tags to promote recombination, with the plates filled with single colonies, all of which were false positives. ISDra2+RedET+RT: Gene editing using ISDra2-RedET in combination with the addition of the repair fragment RT resulted in zero gene editing efficiency. After ISDra2 targeted the DK1622 genome, the RedET system used RT to perform homology repair at the cleavage site, thus achieving scarless editing of the DK1622 genome.

[0077] Following the methods described above, the effect of the length of the homologous arm of the repair fragment on gene editing efficiency when ISDra2-RedET is used in combination was systematically evaluated. The results are shown in [Figure number missing]. Figure 2 (d). As shown in the figure, homologous arm lengths of 100-1000 bp can achieve effective gene repair when ISDra2-RedET is used in combination. Moreover, the homologous arm length has an inverted U-shaped trend with respect to repair efficiency. Within the 100-1000 bp range, lengths that are too short (≤100 bp) or too long (≥800 bp) both lead to a decrease in efficiency.

[0078] Following the methods described above, the effect of the ratio of targeted cleavage plasmids to repair fragments on gene editing efficiency when ISDra2-RedET is used in combination was systematically evaluated. The results are shown in [Figure number missing]. Figure 2 (e) As shown in the figure, effective gene editing can be achieved with a targeted cleavage plasmid dosage of 400-800 ng and a repair fragment dosage of 600-3600 ng. The optimal ratio is 800 ng: 600 ng, which achieves the highest editing efficiency while also being economical in terms of experimental material usage and ease of operation.

[0079] Example 3: ISDra2-RedET combined for seamless knockout of large fragments

[0080] The schematic diagrams for the principle of using TnpB-RedET for large-fragment seamless knockout and the principle of two-site editing are shown below. Figure 4 .

[0081] The experimental principle for using ISDra2-RedET in combination to remove large fragments by making a single cut is described in [link to experimental principle]. Figure 4(a) includes the following steps: ISDra2 cleavage plasmid targeting the middle position of the fragment to be knocked out and its corresponding homologous repair fragment are co-transformed into competent cells, recovered in antibiotic-free CTT medium at 30°C for 4-6 hours, the culture is placed on solid CTT medium containing apramycin (60 μg / mL) and vanillin (0.5 mM), mutant strains are selected, and then verified by PCR.

[0082] The results are shown in Figure 5 (a). As shown in the figure, the combined use of ISDra2 and RedET can achieve efficient knockout of a fragment of about 80kb in the center of the target region of the genome with only one cut, demonstrating the potential and simplicity of this system in genome editing.

[0083] The experimental principle of using ISDra2-RedET in combination to remove large fragments by making two cuts is described in [link to experimental principle]. Figure 4 (b) includes the following steps: ISDra2 cleavage plasmids targeting both ends of the fragment to be knocked out and their corresponding homologous repair fragments are co-transformed into competent cells, recovered in antibiotic-free CTT medium at 30°C for 4-6 hours, the culture is placed on solid CTT medium containing apramycin (60 μg / mL) and vanillin (0.5 mM), mutant strains are selected, and then verified by PCR.

[0084] The results are shown in Figure 5 (b). As shown in the figure, using ISDra2-RedET in combination with cutting one cut at each end of the fragment to be knocked out can successfully knock out a fragment of up to 200kb, further verifying the feasibility of this system in genome editing.

[0085] Example 4: Application scheme of ISDra2-RedET combined to achieve one-step two-site gene editing

[0086] A flowchart illustrating the one-step two-site editing process when using ISDra2-RedET in conjunction is shown below. Figure 3 The experimental principle is as follows: Figure 4 (c) includes the following steps:

[0087] (1) After mixing the cutting plasmid and the repair fragment of gene 1, electroporate them. For specific operation, refer to Example 2.

[0088] (2) 2 mL CTT medium (antibiotic-free), 30℃ for 2-4 h recovery;

[0089] (3) Add apramycin resistance and vanillic acid inducer to the resuscitation solution from the previous step. The final concentration of apramycin is 30 µg / mL and the final concentration of vanillic acid is 0.5 mM. Continue resuscitation for 6-8 h.

[0090] (4) Wash the bacteria in the revived bacterial solution from the previous step to prepare competent cells and co-transform the gene 2 cutting plasmid and repair fragment;

[0091] (5) 2 mL CTT medium (antibiotic-free), 30℃ for 6-8 h recovery;

[0092] 500 µL and 1000 µL of bacterial culture were plated onto CTT plates containing apramycin (60 μg / mL) and vanillic acid (0.5 mM). Double knockout mutants were selected and subsequently verified by PCR. Results are shown below. Figure 5 (c). As shown in the figure, the combined use of ISDra2 and RedET can generate two-site mutants with a single edit, eliminating the need for traditional multiple rounds of screening and verification, and significantly improving experimental efficiency.

[0093] Example 5: Application of the ISDra2-MxRedET combined system in single nucleotide editing in myxobacteria

[0094] The strain HU04-MxRedET, which previously possessed the MYqaJ-MRecT recombinase system, underwent single nucleotide editing of a coding gene segment within gene cluster TA of this strain. Following the same procedure, a suitable TTGAT was selected within the gene to be edited, and a 20 bp sequence was chosen from its 3' end as a guide sequence. The mutated nucleotide was designed at the guide sequence. The guide sequence is: 5'-TTGATGCAGGTGATGAAGACCGCGG-3', and the corresponding mutation locations are shown below:

[0095] SNE1:TTGATCCAGGTGATGAAGACCGCGG;

[0096] SNE2:TTGATGAAGGTGATGAAGACCGCGG;

[0097] SNE3:TTGATGCTGGTGATGAAGACCGCGG;

[0098] SNE4:TTGATGCAAGTGATGAAGACCGCGG;

[0099] SNE5:TTGATGCAGTTGATGAAGACCGCGG;

[0100] SNE6:TTGATGCAGGAGATGAAGACCGCGG;

[0101] SNE8:TTGATGCAGGTGGTGAAGACCGCGG;

[0102] SNE9:TTGATGCAGGTGAGGAAGACCGCGG;

[0103] SNE10:TTGATGCAGGTGATTAAGACCGCGG;

[0104] SNE11:TTGATGCAGGTGATGCAGACCGCGG;

[0105] SNE12:TTGATGCAGGTGATGATGACCGCGG;

[0106] SNE16:TTGATGCAGGTGATGAAGACTGCGG

[0107] These mutations were designed on the donor repair fragment, which was prepared in the same way as in Example 2 (2). The construction of the cleavage plasmid was the same as in Example 2 (1). Gene editing and verification of the mutant strain were performed according to Example 2 (3). Since the mutant strain and the wild strain differed by only one nucleotide, the repair fragment obtained by PCR was subjected to Sanger sequencing.

[0108] Depend on Figure 5 (d) shows that the ISDra2-RedET combination system can achieve efficient single base substitution, and especially after optimizing the template design, it can play an important role in gene function research and potential gene therapy.

[0109] The primer sequences used in the examples are shown in Table 1.

[0110] Table 1

[0111] Primers Primer sequence (5'-3') ISDra2-reRNA-f AGCGAGTCAGTGAGCGAGGAAG ISDra2-reRNA-r CCCCATAGGGAACCTTTGCCTTGAACCTCACACGACTAAAGTCGC pSWU19-f GGCAAAGGTTCCCTATGGGGGAATTCttttttccaggcatcaaataaaacgaaag pSWU19-r TCCTCGCTCACTGACTCGCTGAGCGGTATCAGCTCACTCAAAGGC check-f1 AACGCGGCCTTTTTACGGTTCC check-r1 CCCTCTTGTTCCAGGGACCGG ISDra2-f AGCGAGTCAGTGAGCGAGGAAG ISDra2-r TCACACGACTAAAGTCGCGTGATTC check-f2 CGAACTGTGGGGAAACCCATG EGFP-f AAAGAGGAGAAATACTAGATGGTGAGCAAG EGFP-r CAAAAAAGGGAATAAGGGCGACACG pZJY4111-f TAAGATCCTTGAGAGTTTTCGCC pZJY4111-r CTGTTGAGATCCAGTTCGATGTAACCCAC RS07770-f gtccagcagcctgtgggtggTTCttttttccaggcatcaaataaaacgaaagg RS07770-r gtccagcagcctgtgggtggTTGAACCTCACACGACTAAAGTCGC MXAN_RS07770up-f gccgggtgttgagcgatactc MXAN_RS07770up-r tgacacgaagcagcgctcctcaggccgccttctcttccg MXAN_RS07770dw-f gtgtcacagcccgtttccgc MXAN_RS07770dw-r caatggccgcatcgaccgc MXAN_RS07770up-f(s) <![CDATA[G s ccgggtgttgagcgatactc]]> MXAN_RS07770dw-r(p) <![CDATA[C p aatggccgcatcgaccgc]]> Δ07770check-f aaaggcagttccagccggtc Δ07770check-r ctcggagcgggcctccag ISDra2check-f1 CGAACTGTGGGGAAACCCATG ISDra2check-r1 CTTGTTCCAGGGACCGGAGC ISDra2check-f2 CAGCCGAACGACCGAGCG ISDra2check-r2 ACGCGGTCTCAAGGTTTTTCAGC .

[0112] The above detailed description is a specific description of the embodiments of the present invention. These embodiments are not intended to limit the patent scope of the present invention. All equivalent implementations or modifications that do not depart from the present invention should be included in the patent scope of this case.

Claims

1. A gene editing system, characterized in that, The plasmid includes the cleavage plasmid pZJY4111-ISDra2 and the RedET recombinant system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km; the nucleotide sequence of the cleavage plasmid pZJY4111-ISDra2 is shown in SEQ ID NO.4; the nucleotide sequence of the RedET recombinant system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km is shown in SEQ ID NO.

9.

2. The gene editing system according to claim 1, characterized in that, The main vector backbone of the cleavage plasmid is the myxobacterial autonomous replication plasmid pZJY4111, which contains a high copy number replication initiation site, an apramycin resistance gene, a vanillic acid inducible promoter, and a TnpB cleavage system induced by this promoter; the main vector backbone of the RedET recombination system expression plasmid is the myxobacterial integration plasmid pSWU19, which contains a high copy number replication initiation site, a kanamycin resistance gene, and a phage integration site. attP The promoter rrnd5 and the homologous recombinase system MYqaJ-MRecT expressed under the control of this promoter.

3. The gene editing system according to claim 2, characterized in that, The TnpB cleavage system comprises a TnpB encoding gene and a guide RNA; the guide RNA is a reRNA, and its 3' end contains a 20 bp guide sequence, which is 20 bp downstream of the TAM site TTGAT and guides the TnpB nuclease to cleave the target site.

4. The gene editing system according to claim 3, characterized in that, The nucleotide sequence of the TnpB encoding gene is shown in SEQ ID NO.1; the nucleotide sequence of the guide RNA is shown in SEQ ID NO.

3.

5. The gene editing system according to claim 2, characterized in that, The homologous recombinase system MYqaJ-MRecT comprises two genes, MYqaJ and MRecT; the nucleotide sequence of the MYqaJ gene is shown in SEQ ID NO.5; and the nucleotide sequence of the MRecT gene is shown in SEQ ID NO.

7.

6. An engineered bacterium, characterized in that, It includes the gene editing system according to any one of claims 1-5.

7. The application of the gene editing system according to any one of claims 1-5 in the traceless editing of the genome of myxobacteria.

8. The application according to claim 7, characterized in that, The seamless editing includes: (i) Gene knockout, gene insertion, or gene replacement; (ii) Single nucleotide editing.

9. A method for efficiently and tracelessly editing the genome of myxobacteria, characterized in that, Includes the following steps: (1) Construction of cutting plasmid: construct the cutting plasmid pZJY4111-ISDra2 as described in claim 1, and replace only the 20 bp guide sequence built into the 3' end of the reRNA of the TnpB nuclease-guide RNA system according to the different target sites, while keeping the rest of the reRNA backbone sequence unchanged; (2) Construction of repair fragments: Select 100-1000 bp sequences at both ends of the gene to be knocked out as left and right homologous arms. Connect the left and right homologous arms into 200-2000 bp repair fragments by overlapping extension PCR. Use the repair fragments as templates and perform PCR using phosphorylation modification primers so that the 5' ends of the repair fragments are modified by phosphorylation and thiophosphorylation, respectively. (3) Preparation and electroporation of competent cells of myxobacteria: The homologous recombinase system MYqaJ-MRecT was integrated into the genome of myxobacteria using the RedET recombinant system expression plasmid described in claim 1 to obtain a strain containing the homologous recombinase system; then competent cells were prepared from the strain, and the cutting plasmid and repair fragment were mixed and added to the prepared competent cells for gene editing to obtain the corresponding mutant strain; (4) Removal of cutting plasmid: The cutting plasmid is removed by relaxation passage without affecting the next gene editing.

10. The method according to claim 9, characterized in that, The relaxation passage The procedure includes the following steps: The mutant strain carrying the cutting plasmid is transferred to CTT liquid medium containing kanamycin and cultured with shaking for 20-24 h. The bacterial culture is then serially diluted, and the diluted culture is spread onto CTT plates containing kanamycin. After standing for 5-7 days, single colonies are picked for the following verification: 1) Multiple primer pairs are designed on the cutting system plasmid for PCR verification; the corresponding band cannot be obtained by PCR. 2) The colony is spotted or streaked onto a CTT plate containing aspirin; if the colony cannot grow, the cutting plasmid removal is successful, and the next round of gene editing can proceed.

Images