Wheat drought stress related protein TaSRT1 as well as coding gene and application thereof

Abstract

The invention discloses wheat drought stress related protein TaSRT1 as well as a coding gene and application thereof, and belongs to the field of gene engineering. In order to solve the technical problem of how to regulate and control the drought resistance of plants, the invention provides the method for regulating and controlling the drought resistance of the plants, the method comprises the step of regulating and controlling the drought resistance of receptor plants by regulating and controlling the expression quantity of coding genes of TaSRT1 protein in the receptor plants, and the TaSRT1 protein is the protein with the amino acid sequence being sequence 1. Experiments prove that the survival rate of a TaSRT1 gene knockout strain is obviously higher than that of a wild type, and the water loss rate of an in-vitro leaf is obviously lower than that of a contrast; the survival rate of the overexpression strain is obviously lower than that of a wild type, the water loss rate of an in-vitro leaf is obviously higher than that of a control group, and the drought resistance of wheat is negatively regulated by TaSRT1. The TaSRT1 protein provided by the invention has important theoretical significance and practical value for cultivating plants with improved drought tolerance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a wheat drought stress related protein TaSRT1, a coding gene thereof and application thereof. BACKGROUND

[0002] Wheat is one of the three major crops in the world, and is also an important food crop in China. From 1990 to 2022, the wheat yield in Asia and Europe accounted for more than two-thirds of the global wheat yield. In the future, the demand for wheat in China will continue to increase, and the sustained increase and stability of wheat yield are of great significance to the national food security. Drought and other stress seriously affect the growth and yield of wheat. In the drought and semi-drought climate, the world is showing a transition trend from slow drought to sudden drought, and periodic drought stress seriously restricts the yield of wheat. Therefore, it is of great significance to cultivate drought-tolerant high-yield and high-quality wheat varieties by excavating and applying excellent drought-related genes and enriching the molecular regulation network of wheat drought resistance pathways. SUMMARY

[0003] The technical problem to be solved by the application is how to regulate the drought resistance of plants, for example, how to improve the drought resistance of wheat.

[0004] To solve the above technical problem, the application provides a method for regulating drought resistance of plants, which can comprise regulating the drought resistance of a receptor plant by regulating the expression amount of a coding gene of a TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the receptor plant,

[0005] The TaSRT1 protein is any one of the following:

[0006] a1) the amino acid sequence is any one of the three, any two, or one of the proteins shown in SEQ ID No. 1, SEQ ID No. 5 and SEQ ID No. 6;

[0007] a2) the amino acid sequence of the protein shown in a1) is obtained by substitution, deletion and / or addition of amino acids, and has more than 90% identity with the amino acid sequence shown in a1), and is a protein related to the drought resistance of plants;

[0008] a3) a fusion protein obtained by connecting a tag to the N terminus or / and C terminus of a1) or a2).

[0009] Further, in the method, the regulation can be improvement or promotion or up-regulation.

[0010] Further, in the method, the regulation can also be reduction or inhibition or down-regulation.

[0011] Further, in the method, the protein can be derived from wheat.

[0012] In the present application, SEQ ID No. 1 consists of 917 amino acids. In the present application, SEQ ID No. 5 consists of 440 amino acids. SEQ ID No. 7 consists of 465 amino acids.

[0013] a3) the connection can be through a peptide bond. Specifically, the C-terminus of the tag is dehydrated and condensed with the amino acid of the N-terminus of the protein of a1) or a2) to form a peptide bond connection.

[0014] Alternatively, the N-terminus of the tag is dehydrated and condensed with the amino acid of the C-terminus of the protein of a1) or a2) to form a peptide bond connection.

[0015] In some embodiments of the present application, the protein of a3) can specifically be a protein with an amino acid sequence of SEQ ID No. 1. In SEQ ID No. 1, positions 1-678 are a protein encoded by an allele TaSRT1-D gene in wheat D chromosome, and positions 679-917 are an amino acid sequence of a tag GFP.

[0016] The above-mentioned protein can be artificially synthesized, or a gene encoding the same can be synthesized first and then expressed biologically.

[0017] The protein tag refers to a polypeptide or protein fused and expressed with a target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0018] Further, the method can comprise M1) and / or M2),

[0019] M1) can increase the drought resistance of a recipient plant by reducing the expression amount of a gene encoding a TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant, wherein the recipient plant contains the gene encoding the TaSRT1 protein.

[0020] M2) can reduce the drought resistance of a recipient plant by increasing the expression amount of a gene encoding a TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant.

[0021] Further, in the method, M1) can reduce the expression amount of a gene encoding a TaSRT1 protein and / or the activity or content of the TaSRT1 protein in a recipient plant by knocking out the gene encoding the TaSRT1 protein in the recipient plant.

[0022] M2) The expression level of the gene encoding the protein and / or the activity or content of the TaSRT1 protein in the recipient plant can be increased by introducing a gene encoding the TaSRT1 protein into the recipient plant.

[0023] Further, in the method, M1) the method can include any one, two or three of the following M1-1) to M1-3):

[0024] M1-1) The expression level of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant is reduced by knocking out the gene encoding the TaSRT1 protein in the recipient plant by a CRISPR / Cas system;

[0025] Further, the CRISPR / Cas system can express a gRNA targeting the gene encoding the TaSRT1 protein and an effector protein of the CRISPR / Cas system: Cas9 protein;

[0026] M1-2) The gene in the recipient plant is mutated by any one, two or three of the following M1-21) to M1-23), and the plant is wheat:

[0027] M1-21) An adenine deoxyribonucleotide (A) is inserted between positions 5826 and 5827 of the gene with reference sequence number TraesCS2D02G075800 in the genome of the recipient wheat;

[0028] M1-22) Five deoxyribonucleotides (GCAAA) at positions 5805-5809 of the gene with reference sequence number TraesCS2B02G092700 in the genome of the recipient wheat are deleted, and one thymine deoxyribonucleotide (T) is inserted at the same time;

[0029] M1-23) Four deoxyribonucleotides (CAAA) at positions 5246-5249 of the gene with reference sequence number TraesCS2A02G077800 in the genome of the recipient wheat are deleted;

[0030] M1-3) The gene in the recipient plant is mutated by any one, two or three of the following M1-31) to M1-33), and the plant is wheat:

[0031] M1-31) The adenine deoxyribonucleotide (A) at position 5826 of the gene with reference sequence number TraesCS2D02G075800 in the genome of the recipient wheat is deleted;

[0032] M1-32) deleting 33 deoxyribonucleotides (AGCTTCTCCCTTGGGAAGCCAGAACGCAAATGT) at positions 5780-5812 of the gene with reference sequence number TraesCS2B02G092700 in the genome of the recipient wheat;

[0033] M1-33) deleting 8 deoxyribonucleotides (AACGCAAA) at positions 5242-5249 of the gene with reference sequence number TraesCS2A02G077800 in the genome of the wheat.

[0034] Further, in the method, M2) the expression amount of the coding gene of the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant can be increased by introducing the coding gene of the TaSRT1 protein into the recipient plant.

[0035] Further, in the method, the target sequence of the gRNA in M1-1) is SEQ ID No. 8, 1-19 and / or SEQ ID No. 9, 1-19.

[0036] Further, in the method, M2) the coding gene can be any one of g1)-g4) as follows:

[0037] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2, 4 or 6;

[0038] g2), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0039] g3), the reference sequence number of the nucleotide sequence of the coding strand is a DNA molecule of TraesCS2D02G075800, TraesCS2A02G077800 or TraesCS2B02G092700;

[0040] g4), a DNA molecule having more than 80% identity with any one of the DNA molecules of g1)-g3), and regulating the drought resistance of a plant. SEQ ID No. 3

[0041] Further, in the method, the nucleic acid molecule targeting the coding gene of the TaSRT1 protein and the coding gene of the Cas9 protein are introduced into the recipient plant in the form of a vector.

[0042] In some embodiments of the present application, the vector is pBUE411-TaSRT1.

[0043] Further, in the method, the coding gene of the TaSRT1 protein is introduced into the recipient plant in the form of a vector.

[0044] In some embodiments of the present application, the vector is pWMB110-TaSRT1. The pWMB110-TaSRT1 contains a DNA molecule with a nucleotide sequence of SEQ ID No. 3, which can express a TaSRT1-GFP fusion protein with an amino acid sequence of SEQ ID No. 1.

[0045] The present application also provides a method for preparing a target plant with improved drought resistance, which can obtain a target plant with improved drought resistance by reducing the expression amount of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in a receptor plant.

[0046] Further, the method can include any one of the following C1-1) to C1-3):

[0047] C1-1) reducing the expression amount of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in a receptor plant by knocking out the gene encoding the TaSRT1 protein in the receptor plant through a CRISPR / Cas system, to obtain a target plant with improved drought resistance;

[0048] Further, the CRISPR / Cas system can express a gRNA targeting the gene encoding the TaSRT1 protein and an effector protein of the CRISPR / Cas system: Cas9 protein;

[0049] C1-2) mutating any one, two or three of the following C1-21) to C1-23) in a gene in a receptor plant to obtain a target plant with improved drought resistance, which can be wheat:

[0050] C1-21) inserting one adenine deoxyribonucleotide (A) between positions 5826 and 5827 of the gene with reference sequence number TraesCS2D02G075800 in the genome of a receptor wheat;

[0051] C1-22) deleting five deoxyribonucleotides (GCAAA) at positions 5805-5809 of the gene with reference sequence number TraesCS2B02G092700 in the genome of a receptor wheat, and simultaneously inserting one thymine deoxyribonucleotide (T);

[0052] C1-23) deleting four deoxyribonucleotides (CAAA) at positions 5246-5249 of the gene with reference sequence number TraesCS2A02G077800 in the genome of a receptor wheat;

[0053] C1-3) The recipient plant is mutated in any one, two or three of C1-31) to C1-33) to obtain a plant with improved drought resistance, which can be a wheat plant:

[0054] C1-31) The adenine deoxyribonucleotide (A) at position 5826 of the gene with reference sequence number TraesCS2D02G075800 in the genome of the recipient wheat is deleted;

[0055] C1-32) The 33 deoxyribonucleotides (AGCTTCTCCCTTGGGAAGCCAGAACGCAAATGT) at positions 5780-5812 of the gene with reference sequence number TraesCS2B02G092700 in the genome of the recipient wheat are deleted;

[0056] C1-33) The 8 deoxyribonucleotides (AACGCAAA) at positions 5242-5249 of the gene with reference sequence number TraesCS2A02G077800 in the genome of the wheat are deleted.

[0057] The present application also provides a method for preparing a plant with reduced drought resistance, which can be achieved by increasing the expression amount of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in a recipient plant to obtain a plant with lower drought resistance than the recipient plant.

[0058] Further, the method can increase the expression amount of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant by introducing the gene encoding the TaSRT1 protein into the recipient plant.

[0059] Further, in the method, the gene encoding the TaSRT1 protein can be introduced into the recipient plant in the form of a vector.

[0060] In some embodiments of the present application, the vector can be pWMB110-TaSRT1.

[0061] Further, in the method, the gene encoding the TaSRT1 protein can be any one of g1) to g4) as follows:

[0062] g1) the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2, 4 or 6;

[0063] g2) the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0064] g3) DNA molecules whose nucleotide sequence of the coding strand has reference sequence numbers TraesCS2D02G075800, TraesCS2A02G077800 or TraesCS2B02G092700.

[0065] g4) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1)-g3) and regulates plant drought resistance.

[0066] This application also provides the use of a protein or a substance that regulates the expression of the protein-encoding gene or a substance that regulates the activity or content of the protein in any of the following:

[0067] A1) Its application in regulating plant drought resistance;

[0068] A2) Application in the preparation of products that regulate plant drought resistance;

[0069] A3) Applications in plant breeding or plant-assisted breeding;

[0070] A4) Application in the preparation of plant breeding or plant-assisted breeding products;

[0071] The protein in question is the TaSRT1 protein described above.

[0072] In the application described, the regulation may be to increase, promote, or upregulate.

[0073] In the application described, the regulation may also be reduced, suppressed, or downregulated.

[0074] In the aforementioned application, the purpose of plant breeding may be to obtain target plants with higher drought resistance than the parent plants and / or to obtain target plants with lower drought resistance than the parent plants.

[0075] In this application, the evaluation indicators for plant breeding include the plant's drought resistance.

[0076] In the aforementioned application, the substance that regulates the activity or content of the protein may be a substance that knocks out the coding gene of the protein and / or a substance that reduces the expression of the coding gene of the protein.

[0077] In the aforementioned applications, the substance that regulates the activity or content of the protein may also be a substance that enhances the expression of the gene encoding the protein.

[0078] In the application described, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0079] In the application described, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be accomplished by gene knockout or gene silencing.

[0080] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0081] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0082] In this application, the substance regulating gene expression can be an agent that inhibits or reduces gene expression. The agent that inhibits or reduces gene expression can be a gene knockout agent, such as an agent that knocks out the gene through homologous recombination or an agent that knocks out the gene through CRISPR-Cas9. The agent that inhibits or reduces gene expression can contain a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0083] Furthermore, in the aforementioned applications, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material, which may be any of the following:

[0084] B1) Nucleic acid molecules that inhibit or reduce the expression of the TaSRT1 protein-encoding gene mentioned above;

[0085] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0086] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0087] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0088] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0089] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0090] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0091] B8) Nucleic acid molecules encoding the TaSRT1 protein mentioned above;

[0092] B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

[0093] Furthermore, in the aforementioned applications, the nucleic acid molecule in B1) can be an RNA molecule whose target sequence is the first to last 19 positions of SEQ ID No. 8 and / or the first to last 19 positions of SEQ ID No. 9, or DNA encoding the RNA molecule.

[0094] Furthermore, in the aforementioned application, the nucleic acid molecule described in B8) can be any one of the following g1)-g4):

[0095] g1) The coding sequence of the coding strand is a DNA molecule with SEQ ID No. 2, 4 or 6;

[0096] g2) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0097] g3) DNA molecules whose nucleotide sequence of the coding strand has reference sequence numbers TraesCS2D02G075800, TraesCS2A02G077800 or TraesCS2B02G092700.

[0098] g4) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1)-g3) and regulates plant drought resistance.

[0099] Furthermore, in the aforementioned application, the expression cassette (B9) refers to DNA capable of expressing the TaSRT1 protein in a host cell, which may include not only promoters that initiate transcription of protein-coding genes, but also terminators and / or enhancer sequences that terminate transcription of protein-coding genes.

[0100] In some embodiments of this application, the recombinant vector described in B9) may be pWMB110-TaSRT1. The vector pWMB110-TaSRT1 can express a protein with the amino acid sequence of SEQ ID No. 1.

[0101] Furthermore, in the aforementioned applications, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0102] Furthermore, in the aforementioned applications, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0103] Furthermore, in the aforementioned applications, the transgenic plant organs may be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0104] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0105] In this application, the expression level of the protein-coding gene in plants or the activity or content of the protein can be increased by introducing an expression vector containing the TaSRT1 protein-coding gene, thereby reducing the drought resistance of plants.

[0106] In this application, the drought resistance of plants can be reduced by knocking out the TaSRT1 protein-coding gene in plants, downregulating the expression level of the protein-coding gene or increasing the activity or content of the protein.

[0107] In this application, the plant or recipient plant may be selected from monocotyledonous plants.

[0108] In this application, the monocotyledonous plant may be selected from grasses.

[0109] In this application, the grass plant may be selected from plants of the genus Triticum.

[0110] In this application, the wheat species may be selected from wheat (Triticum aestivum L.).

[0111] In this application, the TaSRT1 protein is divided into three subgenomes based on the different chromosomal distributions of the coding gene on the chromosome. These subgenomes are named as follows: TaSRT1-A subgenome, TaSRT1-B subgenome, and TaSRT1-D subgenome.

[0112] The reference sequence number for the TaSRT1-A subgenome in EnsemblPlants is TraesCS2A02G077800, located at Chromosome 2A:35492638-35498995.

[0113] The reference sequence number for the TaSRT1-B subgenome in EnsemblPlants is TraesCS2B02G092700, located at Chromosome 2B:53464614-53473185.

[0114] The reference sequence number for the TaSRT1-D subgenome in EnsemblPlants is TraesCS2D02G075800, located at Chromosome 2D:32472578-32481962.

[0115] The genome sequence lookup results are from EnsemblPlants, URL: Triticum_aestivum-EnsemblGenomes 59 (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index).

[0116] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-D subgenome is the DNA molecule whose nucleotide sequence is SEQ ID No. 2, and the amino acid sequence of the TaSRT1 protein encoded is positions 1-678 of SEQ ID No. 1.

[0117] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-A subgenome is a DNA molecule whose nucleotide sequence is SEQ ID No. 4, and whose amino acid sequence encodes the protein is SEQ ID No. 5.

[0118] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-B subgenome is a DNA molecule whose nucleotide sequence is SEQ ID No. 6, and whose amino acid sequence encodes the protein is SEQ ID No. 7.

[0119] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0120] The aforementioned 90% or higher degree of identity can be interpreted as 90% or 95% or higher degree of identity.

[0121] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0122] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0123] The beneficial technical effects obtained by the present application are as follows:

[0124] Drought is a major factor limiting wheat yield. The TaSRT1 cloned in this application is a histone deacetylase containing the SIR2 domain. Knockout lines showed significantly increased resistance to drought stress, while overexpression lines were extremely sensitive to drought stress. Studying the function of TaSRT1 and applying it in drought-resistant breeding is of great significance for improving wheat drought resistance.

[0125] Based on previous transcriptome analysis, this application identified a candidate gene that responds to drought stress in wheat. Sequence alignment analysis showed that this gene is homologous to the histone deacetylase gene SRT1 in rice and Arabidopsis thaliana, and named it TaSRT1. Through transgenic methods, its function was further analyzed and identified, clarifying the role of the TaSRT1 gene in the process of wheat responding to drought stress.

[0126] The relationship between the TaSRT1 gene and drought resistance in wheat has not been reported before, therefore the TaSRT1 gene cloned in this application fills this gap. After cloning TaSRT1, overexpression and knockout transgenic vectors were constructed, transformed into common wheat, and the function of TaSRT1 was verified through drought resistance phenotype identification, water loss rate, etc.

[0127] Experiments have shown that the protein and its encoding gene provided in this application can regulate drought resistance in plants: the survival rate of knockout lines was significantly higher than that of wild-type, and the water loss rate and stomatal aperture of detached leaves were significantly lower than those of the control; while the survival rate of overexpression lines was significantly lower than that of wild-type, and the water loss rate and stomatal aperture of detached leaves were significantly higher than those of the control. TaSRT1 negatively regulates drought resistance in wheat. Therefore, the protein provided in this application has important theoretical significance and practical value for cultivating drought-resistant plants. Attached Figure Description

[0128] Figure 1 PCR identification results of TaSRT1 knockout wheat lines.

[0129] Figure 2 Analysis of the expression levels of the target gene in TaSRT1-overexpressing transgenic wheat.

[0130] Figure 3 To identify the drought stress phenotype of TaSRT1 knockout transgenic wheat.

[0131] Figure 4 Survival rate, aboveground fresh weight, and dry weight of TaSRT1 knockout transgenic wheat under drought stress.

[0132] Figure 5 To identify the drought stress phenotype of TaSRT1-overexpressing transgenic wheat.

[0133] Figure 6 The survival rate, aboveground fresh weight, and dry weight of TaSRT1-overexpressing transgenic wheat under drought stress were determined.

[0134] Figure 7 Water loss rate of detached leaves of TaSRT1 knockout transgenic wheat under drought stress.

[0135] Figure 8The water loss rate of detached leaves of TaSRT1-overexpressing transgenic wheat under drought stress.

[0136] Figure 9 Stomatal aperture of TaSRT1 knockout transgenic wheat under drought stress.

[0137] Figure 10 Stomatal aperture of TaSRT1-overexpressing transgenic wheat under drought stress. Detailed Implementation

[0138] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0139] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0140] The pWMB110 overexpression vector used in the following examples was preserved in our laboratory and is described in the paper "Chu, W., Chang, S., Lin, J., Zhang, C., Li, J., Liu, X., Liu, Z., Liu, D., Yang, Q., Zhao, D., Liu, X., Guo, W., Xin, M., Yao, Y., Peng, H., Xie, C., Ni, Z., Sun, Q., Hu, Z. (2024). Methyltransferase TaSAMT1 mediates wheat freezing tolerance by integrating brassinosteroid and salicylic acid signaling. The Plant Cell, Koae 100. Advance online publication." https: / / doi.org / 10.1093 / plcell / koae100 The biological material is disclosed in the document and is named pMWB110. The public may obtain the biological material from the applicant in accordance with the relevant national biosafety regulations. The obtained biological material shall only be used to repeat the experiments of this application and shall not be used for any other purpose.

[0141] The pBUE411 knockout vector and MT1T2 plasmid used in the following examples were preserved in our laboratory and are described in the paper "Du,D.,Zhang,D.,Yuan,J.,Feng,M.,Li,Z.,Wang,Z.,Zhang,Z.,Li,X.,Ke,W.,Li,R.,Chen,Z.,Chai,L.,Hu,Z.,Guo,W.,Xing,J.,Su,Z.,Peng,H.,Xin,M.,Yao,Y.,Sun,Q.et al.(2021).FRIZZY PANICLE defines a regulatory hub for simultaneously controlling spikelet formation and awn elongation in bread wheat.The New Phytologist,231(2),814–833." https: / / doi.org / 10.1111 / nph.17388 The application states that the public may obtain the biological material from the applicant in accordance with the relevant national biosafety regulations. The obtained biological material shall only be used to repeat the experiments of this application and shall not be used for any other purpose.

[0142] Escherichia coli DH5α / EC was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., product number: ZC101-3.

[0143] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0144] This embodiment uses GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The Students t-test is used. In the bar chart, * indicates that the two groups of data are significantly different at the P < 0.05 level, ** indicates that the two groups of data are significantly different at the P < 0.01 level, and *** indicates that the two groups of data are significantly different at the P < 0.001 level.

[0145] Example 1: Cloning of the gene encoding TaSRT1, a wheat drought stress-related protein.

[0146] Based on the target gene ID obtained from transcriptome analysis, a search was conducted in the wheat database of the Ensembl Plants website. Simultaneously, the sequence was compared with homologous gene sequences and encoded protein sequences in rice and Arabidopsis thaliana, confirming that the target gene encodes a histone deacetylase. This protein was named TaSRT1, and its amino acid sequence is SEQ ID No. 1. The gene encoding the TaSRT1 protein was named the TaSRT1 gene. Based on the different chromosomal distributions of the TaSRT1 gene, it was divided into three subgenomes, named TaSRT1-A, TaSRT1-B, and TaSRT1-D.

[0147] The reference sequence number for the TaSRT1-A subgenome in EnsemblPlants is TraesCS2A02G077800, located at Chromosome 2A:35492638-35498995.

[0148] The reference sequence number for the TaSRT1-B subgenome in EnsemblPlants is TraesCS2B02G092700, located at Chromosome 2B:53464614-53473185.

[0149] The reference sequence number for the TaSRT1-D subgenome in EnsemblPlants is TraesCS2D02G075800, located at Chromosome 2D:32472578-32481962.

[0150] The genome sequence lookup results are from EnsemblPlants, URL: Triticum_aestivum-EnsemblGenomes 59 (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index).

[0151] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-D subgenome is the DNA molecule whose nucleotide sequence is SEQ ID No. 2, and the amino acid sequence of the TaSRT1 protein encoded is positions 1-678 of SEQ ID No. 1.

[0152] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-A subgenome is a DNA molecule whose nucleotide sequence is SEQ ID No. 4, and whose amino acid sequence encodes the protein is SEQ ID No. 5.

[0153] The coding sequence (CDS) of the TaSRT1 gene in the TaSRT1-B subgenome is a DNA molecule whose nucleotide sequence is SEQ ID No. 6, and whose amino acid sequence encodes the protein is SEQ ID No. 7.

[0154] The coding gene for the protein TaSRT1 (TaSRT1-D subgenome), i.e., the coding sequence in the TaSRT1-D subgenome, was cloned from wheat. The specific steps are as follows:

[0155] 1. Fielder material was selected. When the wheat reached the two-leaf-one-heart stage, total RNA was extracted from fresh wheat leaves using the Trizol method. The quality of total RNA was identified by agarose gel electrophoresis, and then cDNA was obtained by reverse transcription using reverse transcriptase.

[0156] 2. Primers for artificially synthesized nucleotide sequences (5'-3') as follows:

[0157] F1: ATGGCCTCAGTCTCCCA;

[0158] R1: CTAGCACTTTAGCTTCTTTG.

[0159] 3. Using the cDNA obtained by reverse transcription in step 1 as a template, PCR amplification was performed using F1 and R1 primers to obtain a double-stranded DNA molecule of approximately 2037 bp.

[0160] 4. The amplified double-stranded DNA fragments were recovered using agarose gel extraction.

[0161] 5. The double-stranded DNA fragments recovered from the gel were ligated into the pEASY-Blunt Cloning Vector (T vector) to obtain the recombinant plasmid.

[0162] According to the sequencing results, the recombinant plasmid contains the DNA molecular fragment shown in SEQ ID No. 2 (hereinafter referred to as the TaSRT1 gene coding sequence) and expresses the protein shown in SEQ ID No. 1 (hereinafter referred to as the TaSRT1 protein).

[0163] Example 2: Obtaining and Identifying TaSRT1 Transgenic Wheat

[0164] I. Construction of transgenic pWMB110 overexpression vector

[0165] 1. Based on the pWMB110 vector map and the TaSRT1 and tag GFP gene sequences (SEQ ID NO. 3, positions 2055-2774), design vector adapter primers with the following nucleotide sequences (5'-3'):

[0166] F2: AGGTCGACTCTAGAGGATCCATGGCCTCAGTCTCCCAGGA ;

[0167] R2: CTCGCCCTTGCTCACCATGCACTTTAGCTTCTTTGTCG;

[0168] F3: CGACAAAGAAGCTAAAGTGCATGGTGAGCAAGGGCGAG;

[0169] R3: TCGAGGGTACCCGGGGATCCCTACTTGTACAGCTCGTCC.

[0170] 2. The pWMB110 overexpression vector was digested with restriction endonuclease BamHI (NEB (Beijing) Co., Ltd.) to obtain the digested vector product.

[0171] 3. The designed vector adapter primers F2 and R2 were used to amplify the TaSRT1 gene CDS sequence by PCR to obtain a PCR product containing the TaSRT1 gene sequence.

[0172] 4. The designed vector adapter primers F3 and R3 were used to amplify the CDS sequence of the GFP gene to obtain a fusion PCR product containing the GFP gene sequence.

[0173] 5. Then take 1 μL of the PCR products from steps 3 and 4 as templates and place them in a PCR instrument for PCR amplification (without adding primers, 5 cycles).

[0174] 6. Subsequently, the designed vector adapter primers F2 and R3 were added to the PCR mixture from step 5 for normal PCR amplification, yielding a fusion PCR product containing the TaSRT1 and GFP coding sequences. Sequencing results showed that the nucleotide sequence of the fusion PCR product was SEQ ID NO.3. Positions 1-20 of SEQ ID NO.3 are the sequence from the pWMB110 vector, positions 21-2054 are the TaSRT1 coding sequence without a stop codon, positions 2055-2774 are the GFP coding sequence, and positions 2775-2794 are the sequence from the pWMB110 vector.

[0175] 7. The enzyme digestion vector product from step 2 was ligated and transformed with the fusion PCR product using a homologous recombinase (Beijing Adley Biotechnology Co., Ltd.).

[0176] 8. The ligated vector was transformed into DH5α E. coli competent cells. The target gene fragment was amplified by PCR using vector adapter primers F2 and R3. Positive bacterial cultures were sent to the company for sequencing, and plasmids were extracted from the correctly sequenced pWMB110-TaSRT1 positive clones. Sequencing results showed that the structure of the pWMB110-TaSRT1 positive clone was as follows: a DNA molecule with nucleotide sequences from positions 21 to 2774 of SEQ ID NO. 3 was inserted between the restriction endonuclease BamHI sites of pWMB110 and the overexpression vector, while keeping the other nucleotide sequences of the pWMB110 overexpression vector unchanged. The expressible amino acid sequence of pWMB110-TaSRT1 is the TaSRT1-GFP fusion protein of SEQ ID NO. 1, where positions 1-678 of SEQ ID NO. 1 are the amino acid sequence of TaSRT1, and positions 679-917 of SEQ ID NO. 1 are the amino acid sequence of GFP.

[0177] II. Construction of the transgenic pBUE411 knockout vector

[0178] 1. Design suitable CRISPR / Cas9 targets and specific primers based on the E-CRISP Design website (E-CRISP Design).

[0179] The Crispr / Cas9 target sequence is positions 1-19 of SEQ ID NO. 8 or 9:

[0180] T1: GAGCCAGAACGCAAATGT AGG (SEQ ID NO.8);

[0181] T2: CAGAGTCCACACACCCTTT GGG (SEQ ID NO.9);

[0182] The specific primers are as follows (5'-3'):

[0183] F4:aataatggtctcAAGCgGAAGCCAGAACGCAAATGT;

[0184] F5:GAAGCCAGAACGCAAATGTgttttagagctagaaatagc;

[0185] R4:AAAGGGTGTGTGGACTCTGcgcttcttggtgcc;

[0186] R5:attattggtctctaaacAAAGGGTGTGTGGACTCTG.

[0187] 2. Using the MT1T2 plasmid as a template, PCR was amplified using the above four primers to obtain DNA fragments containing vector adapters and target sites, which were then purified by gel extraction.

[0188] 3. The pBUE411 vector and product were digested with BsaI restriction enzyme and ligated overnight with T4 Ligase ligase. The resulting ligation product was then transferred into DH5α Escherichia coli competent cells for culture.

[0189] 4. Using the vector primer pairs pBUE411-seq-F and pBUE411-seq-R, PCR amplification of the target gene fragment was performed to screen positive clones. The bacterial culture was sent to the company for sequencing. The gene knockout vector with correct sequencing was named pBUE411-TaSRT1. The pBUE411-TaSRT1 knockout vector is obtained by opening the BsaI restriction endonuclease recognition site of the pBUE411 vector, replacing the sequence between fragment 1 (5'-TGCAGATGATCCGTGGC-3') and fragment 2 (5'-ATTTCTAGCTCTAAAAC-3') of the pBUE411 vector with the DNA fragment obtained in step 2, while keeping the other sequences of the pBUE411 vector unchanged. The resulting recombinant vector was named pBUE411-TaSRT1 knockout vector.

[0190] The sequences of primers pBUE411-seq-F and pBUE411-seq-R are as follows (5'-3').

[0191] pBUE411-seq-F: TTTCCCAGTCACGACGTTGT;

[0192] pBUE411-seq-R: ATCTCTAGAGAGGGGCACGA.

[0193] 5. Plasmids were extracted from the correctly sequenced pWMB110-TaSRT1 and pBUE411-TaSRT1 positive clones and transformed into EHA105 Agrobacterium competent cells to obtain EHA105 / pWMB110-TaSRT1 and EHA105 / pBUE411-TaSRT1.

[0194] 6. The Agrobacterium tumefaciens bacterial suspension was tested using vector primers and then sent to the wheat genetic transformation platform of the Wheat Research Center, College of Agriculture, China Agricultural University for wheat genetic transformation (the recipient plant was the Fielder wheat variety).

[0195] 7. Positive identification was performed on the obtained T0 generation plants. The identified positive lines were harvested and then multiplied in a greenhouse, and the T1 generation plants were also positively identified. Overexpressing T1 generation positive plants ROE1 and ROE2, and gene knockout T1 generation positive plants SKO3 and SKO5 were obtained.

[0196] DNA was sampled and extracted from T0 / T1 generation plants. For knockout lines, specific primers for the A / B / D subgenomes were designed near the target site, and amplification was performed for first-generation sequencing to verify whether the area near the target site had been edited. For overexpression lines, pWMB-110 vector primers 110-Ubi-F and 110-NOS-R were used to detect transgenic plants. The specific detection primers are as follows:

[0197] TaSRT1-A-CR-F:CTGATGTTGAGGAGAAACCC;

[0198] TaSRT1-A-CR-R:AGGAACTATTTGTGGTGTTC;

[0199] TaSRT1-B-CR-F:TTTTCAGTGAACTAGCCCTG;

[0200] TaSRT1-B-CR-R:TTGGTGTTTCCCTAAGAAAGTAGAAT;

[0201] TaSRT1-D-CR-F:TCCGTGTTATGACATGAAGTTGA;

[0202] TaSRT1-D-CR-R:AGAGCTATCTGAATAAACCAACAGAT;

[0203] 110-Ubi-F:TAgCCCTgCCTTCATACgCT;

[0204] 110-NOS-R:AAgACCggCAACAggATTCA.

[0205] III. Screening and Identification of TaSRT1 Transgenic Wheat Pure Lines and TaSRT1 Gene Knockout Wheat Pure Lines

[0206] 1. Screening and identification of TaSRT1 gene knockout wheat pure lines

[0207] After harvesting individual plants from the T2 generation of TaSRT1 knockout wheat, high-quality seeds were selected from each line for propagation. Then, samples were taken from each plant, and the corresponding DNA was extracted using the CTAB method. PCR detection was used to identify positive TaSRT1 knockout T3 generation seedlings, and homozygous seeds from the TaSRT1 knockout T3 generation were harvested, namely homozygous seeds from the knockout line SKO3 T3 and homozygous seeds from the knockout line SKO5 T3. The PCR detection results are as follows: Figure 1 .

[0208] Sequencing results showed that in the SKO3 T3 homozygous lines, the region corresponding to the TaSRT1 gene in the genome was altered compared to the wheat variety Fielder.

[0209] One adenine deoxyribonucleotide (A) was inserted between positions 5826 and 5827 in the TaSRT1-D subgenome (i.e., one adenine deoxyribonucleotide (A) was inserted between positions 5826 and 5827 in the gene with reference sequence number TraesCS2D02G075800 in the wheat genome), thereby knocking out the TaSRT1 gene in the TaSRT1-D subgenome.

[0210] The TaSRT1 gene in the TaSRT1-B subgenome is knocked out by deleting five deoxyribonucleotides (GCAAA) at positions 5805-5809 and inserting one thymine deoxyribonucleotide (T) (i.e., in the wheat genome, the gene with reference sequence number TraesCS2B02G092700 has five deoxyribonucleotides (GCAAA) deleted at positions 5805-5809 and one thymine deoxyribonucleotide (T) inserted).

[0211] The TaSRT1 gene in the TaSRT1-A subgenome is knocked out by a deletion of four deoxyribonucleic acid (CAAA) positions 5246-5249 in the TaSRT1-A subgenome (i.e., a deletion of four deoxyribonucleic acid (CAAA) positions 5246-5249 in the gene with the reference sequence TraesCS2A02G077800 in the wheat genome).

[0212] In the SKO5 T3 generation homozygous lines, the region corresponding to the TaSRT1 gene in the genome was altered compared to the wheat variety Fielder:

[0213] The TaSRT1 gene in the TaSRT1-D subgenome is knocked out by the deletion of adenine deoxyribonucleic acid (A) at position 5826 (i.e., the deletion of adenine deoxyribonucleic acid (A) at position 5826 of the gene with reference sequence number TraesCS2D02G075800 in the wheat genome).

[0214] The TaSRT1-B subgenome contains a deletion of 33 deoxyribonucleotides (AGCTTCTCCCTTGGGAAGCCAGAACGCAAATGT) at positions 5780-5812 (i.e., the deletion of 33 deoxyribonucleotides (AGCTTCTCCCTTGGGAAGCCAGAACGCAAATGT) at positions 5780-5812 in the wheat genome, with reference sequence number TraesCS2B02G092700), thus truncating the protein domain encoded by the TaSRT1 gene in the TaSRT1-B subgenome.

[0215] The TaSRT1 subgenome has a deletion of 8 deoxyribonucleotides AACGCAAA between positions 5242 and 5249 (i.e., the deletion of 8 deoxyribonucleotides (AACGCAAA) between positions 5242 and 5249 in the wheat genome, with reference sequence number TraesCS2A02G077800), thereby knocking out the TaSRT1 gene in the TaSRT1-A subgenome.

[0216] The TaSRT1-A subgenome has the reference sequence number TraesCS2A02G077800 (May 2024) in Ensembl Plants release 59, located at Chromosome 2A:35492638-35498995. The TaSRT1-B subgenome has the reference sequence number TraesCS2B02G092700 (May 2024) in Ensembl Plants, located at Chromosome 2B:53464614-53473185. The TaSRT1-D subgenome has the reference sequence number TraesCS2D02G075800 (May 2024) in Ensembl Plants, located at Chromosome2D:32472578-32481962. The genome sequence lookup results are from Ensembl Plants, URL: Triticum_aestivum-Ensembl Genomes 59 (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index).

[0217] The TaSRT1 gene was knocked out in all three subgenomes (A, B, and D) of the SKO3 T3 homozygous lines and the SKO5 T3 homozygous lines. 2. Screening and identification of pure lines of TaSRT1 transgenic wheat.

[0218] After harvesting the T1 generation individual plants of the TaSRT1 overexpressing transgenic wheat, high-quality seeds were selected from each line for propagation. Each plant was then sampled, and corresponding DNA and RNA were extracted. Positive seedlings were identified by PCR detection using 110-Ubi-F and 110-NOS-R primers. Simultaneously, real-time quantitative RT-qPCR was designed using primers TaSRT1-qF and TaSRT1-qR to detect TaSRT1 expression levels, with TaACTIN as an internal control. The primer sequences (5'-3') for TaSRT1-qF, TaSRT1-qR, and the internal control gene are as follows:

[0219] TaSRT1-qF:CAGAGCGCCAGTCTCGT

[0220] TaSRT1-qR:CGAGGTTGCTGCTGGTA

[0221] TaACTIN-F:ggaatccatgagaccacctac

[0222] TaACTIN-R:gacccagacaactcgcaac

[0223] The results of TaSRT1 overexpression transgenic wheat expression level analysis are as follows: Figure 2 As shown, Figure 2 WT represents the relative expression level of the TaSRT1 gene in wild-type Fielders; Figure 2 ROE1 represents the average relative expression level of the TaSRT1 gene in T2 generation TaSRT1 transgenic wheat ROE1; Figure 2 ROE2 represents the average relative expression level of the TaSRT1 gene in T2 generation TaSRT1 transgenic wheat ROE2.

[0224] Example 3: Identification of drought resistance in TaSRT1 transgenic wheat

[0225] I. Survival Rate Assessment

[0226] T3 knockout and overexpression lines, identified as pure lines, were selected, with Fielder material used as a control. The samples were sterilized with 1% sodium hypochlorite for 30 min and washed three times with distilled water. A layer of germination paper was placed in each petri dish, a small amount of distilled water was added, and the dishes were placed in a 4°C refrigerator for 24 h, followed by 24 h at room temperature. Seeds with uniform germination were then transplanted into pots. The experiment was divided into a control group (Well-watered) and a drought stress group (Drought). Each line was placed in three pots in each group, with 16 plants per pot.

[0227] The control group underwent the following procedures:

[0228] Normal cultivation was carried out under conditions of 20℃-22℃, 16 hours of light / 8 hours of darkness, and 60%-70% humidity. Watering was performed every 7 days after the soil had fully absorbed the water from the first watering, allowing the soil to fully absorb the water. After the drought-treated group was rehydrated, the phenotype of the control group was observed and recorded, and the survival rate, aboveground dry weight, and fresh weight were calculated. Survival rate = number of surviving seedlings / total number of seedlings.

[0229] The drought treatment team performed the following operations:

[0230] Under normal cultivation conditions of 20℃-22℃, 16 hours of light / 8 hours of darkness, and 60%-70% humidity, the wheat was watered as follows: after the soil was fully saturated by the first watering, it was watered again after 7 days until the soil was fully saturated, after which no further watering was performed to allow for drought treatment. The key time point was when all the wheat leaves turned yellow and the stems could not be squeezed dry. After rehydration for 7 days after this point, the phenotype was observed and recorded, and the survival rate, aboveground dry weight, and fresh weight were calculated.

[0231] The results are as follows Figures 3 to 6 As shown in the figure, the knockout transgenic lines exhibited high tolerance to drought stress, with significantly higher survival rates and fresh weights than the wild type; while the overexpression transgenic lines were extremely sensitive to drought stress, with lower survival rates and fresh weights than the wild type. This indicates that the TaSRT1 gene plays a negative regulatory role in wheat drought tolerance.

[0232] II. Identification of water loss rate of detached leaves

[0233] 1) The Fielder, TaSRT1 transgenic line was placed in a light incubator and cultured until the two-leaf-one-heart stage. The second leaf was selected as the target leaf for measuring the water loss rate.

[0234] 2) At room temperature, cut off the target leaf from the leaf sheath, immediately weigh the fresh weight of the leaf as the initial fresh weight (the treatment time is recorded as 0h), and then place it on the table to air dry naturally.

[0235] 3) Subsequently, weigh the blades at 1h, 2h, 4h, and 6h respectively. The weighing process should be quick to reduce errors.

[0236] 4) The initial fresh weight was labeled as F0, and the real-time fresh weight was labeled as F1. The wheat leaf water loss rate was calculated as (F0-F1) / F0×100%. Six replicates were set for each knockout line and eight replicates were set for each overexpression line. The average value of the results was taken.

[0237] The results are as follows Figure 7 and Figure 8 As shown in the figure. The results indicate that the water loss rate of detached leaves in TaSRT1 knockout lines was significantly lower than that in wild-type, while the water loss rate of detached leaves in overexpression lines was higher than that in wild-type. These results demonstrate that the TaSRT1 gene plays a negative regulatory role in wheat drought tolerance.

[0238] In summary, the TaSRT1 gene provided by the applicant is a novel gene isolated from wheat, whose function is related to wheat drought resistance. This gene can be used to improve plant varieties, thereby enhancing the drought resistance of plants.

[0239] III. Stomatal aperture measurement

[0240] Stomatal aperture is an important indicator of a plant's drought resistance. Therefore, to further verify whether the TaSRT1 gene is involved in drought resistance regulation, stomatal aperture was measured. The experiment was repeated three times, and the average value was taken. The steps for each repetition are as follows:

[0241] 1) Fielder (WT), TaSRT1 transgenic lines (ROE1 and ROE2) and TaSRT1 gene knockout lines (SKO3 and SKO5) at the two-leaf-one-heart stage were placed in a light incubator and cultured for 15 days. The second leaf was selected as the target leaf for stomatal aperture measurement.

[0242] 2) At room temperature, cut off the target leaf 1 cm from the leaf sheath, cut off a length of about 2 cm, and put it into a 2.0 mL centrifuge tube containing a stomatal buffer (an aqueous solution of 50 mM KNO3, 10 mM MES, and 50 mM CaCl2·2H2O). After placing it in the dark for 1 h, irradiate it under light for 1 h.

[0243] The experiment was divided into two groups: a control group and a drought treatment group.

[0244] Control group: After being placed in darkness for 1 hour and then exposed to light for 1 hour, the leaves were removed, and the mesophyll and upper epidermis of the leaves were quickly scraped off with a scalpel to minimize errors. The stomatal opening was then observed and photographed under a microscope; both observation and photography under the microscope should be performed quickly.

[0245] Drought treatment group: After being placed in darkness for 1 hour and then exposed to light for 1 hour, the leaves were removed and placed at room temperature for 10 minutes. Then, the leaf mesophyll and upper epidermis of the leaves were scraped off with a scalpel. The opening of the stomata was then observed under a microscope and photographed.

[0246] 3) The stomatal length and width of the photographs were measured using the MOTO software. The ratio of stomatal width to stomatal length was used as the stomatal aperture value for statistical analysis. Three replicates were set for each strain, and the average value was taken. Statistical analysis was then performed.

[0247] The results are as follows Figure 9 and Figure 10 As shown, Figure 9 Stomatal aperture of TaSRT1 gene knockout wheat lines under drought stress Figure 10 The stomatal aperture of TaSRT1-overexpressing wheat lines under drought stress was investigated. The results showed that the stomatal aperture of TaSRT1 knockout wheat lines was significantly lower than that of wild-type wheat under drought stress. In contrast, the stomatal aperture of TaSRT1-overexpressing lines was significantly higher than that of wild-type wheat under drought stress.

[0248] Table 1 Sequences in this application

[0249]

[0250]

[0251]

[0252]

[0253] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for regulating plant drought resistance, characterized in that, The method includes regulating drought resistance in recipient plants by controlling the expression level of the gene encoding TaSRT1 protein and / or the activity or content of TaSRT1 protein. The TaSRT1 protein is any of the following: a1) The amino acid sequences are three, any two, or any one of the three proteins in SEQ ID No. 1 (positions 1-678), SEQ ID No. 5, and SEQ ID No. 6, respectively; a2) Proteins obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1), which have more than 90% identity with the amino acid sequence shown in a1) and are related to plant drought resistance. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The method according to claim 1, characterized in that, The method includes M1) and / or M2), M1) Improves drought resistance in recipient plants by reducing the expression level of the gene encoding TaSRT1 protein and / or the activity or content of TaSRT1 protein, wherein the recipient plant contains the gene encoding TaSRT1 protein. M2) reduces drought resistance in recipient plants by increasing the expression level of the gene encoding TaSRT1 protein and / or the activity or content of TaSRT1 protein.

3. The method according to claim 2, characterized in that, In M1), the expression level of the TaSRT1 protein encoding gene and / or the activity or content of the TaSRT1 protein in the recipient plant are reduced by knocking out the gene encoding the TaSRT1 protein in the recipient plant. M2) By introducing the gene encoding the TaSRT1 protein into the recipient plant, the expression level of the gene encoding the protein and / or the activity or content of the TaSRT1 protein in the recipient plant can be increased.

4. The method according to claim 3, characterized in that, The method described in M1) includes any one of the following M1-1)-M1-3): M1-1) By knocking out the gene encoding the TaSRT1 protein in the recipient plant using a CRISPR / Cas system, the expression level of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant is reduced. Furthermore, the CRISPR / Cas system can express gRNA encoding the gene that targets the TaSRT1 protein and the effector protein of the CRISPR / Cas system: Cas9 protein; M1-2) Mutate any one, two, or three of the following mutations in the gene of the recipient plant, wherein the plant is wheat: M1-21) Inserts one adenine deoxyribonucleotide between positions 5826 and 5827 in the gene with reference sequence number TraesCS2D02G075800 in the recipient wheat genome; M1-22) The five deoxyribonucleotides at positions 5805-5809 of the gene with reference sequence number TraesCS2B02G092700 in the recipient wheat genome were deleted, and one thymine deoxyribonucleotide was inserted. M1-23) The four deoxyribonucleotides at positions 5246-5249 of the gene with the reference sequence TraesCS2A02G077800 in the recipient wheat genome were deleted; M1-3) Mutate any one, two, or three of the following mutations in the gene of the recipient plant, wherein the plant is wheat: M1-31) The adenine deoxyribonucleotide at position 5826 of the gene with reference sequence number TraesCS2D02G075800 in the recipient wheat genome was deleted. M1-32) The 33 deoxyribonucleotides at positions 5780-5812 of the gene with reference sequence number TraesCS2B02G092700 in the recipient wheat genome were deleted; M1-33) The eight deoxyribonucleotides at positions 5242-5249 of the gene with reference sequence number TraesCS2A02G077800 in the wheat genome were deleted; The method described in M2) increases the expression level of the TaSRT1 protein encoding gene and / or the activity or content of the TaSRT1 protein in the recipient plant by introducing the TaSRT1 protein encoding gene into the recipient plant.

5. The method according to claim 4, characterized in that, The target sequence of the gRNA described in M1-1) is positions 1-19 of SEQ ID No. 8 and / or positions 1-19 of SEQ ID No. 9; M2) The nucleic acid molecule is any one of the following (g1)-g4): g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 3; g3) A DNA molecule with the reference sequence number TraesCS2D02G075800 for the nucleotide sequence of the coding strand. g4) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1)-g3) and regulates plant drought resistance.

6. A method for preparing plants with altered drought resistance traits, characterized in that, The method includes either C1) or C2) below. C1) A method for preparing a target plant with enhanced drought resistance, the method comprising obtaining a target plant with higher drought resistance than the recipient plant by reducing the expression level of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant; C2) A method for preparing a target plant with reduced drought resistance, the method comprising obtaining a target plant with lower drought resistance than the recipient plant by increasing the expression level of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant.

7. The method according to claim 6, characterized in that, C1) The method includes any one of the following C1-1)-C1-3): C1-1) By knocking out the gene encoding the TaSRT1 protein in the recipient plant using the CRISPR / Cas system, the expression level of the gene encoding the TaSRT1 protein and / or the activity or content of the TaSRT1 protein in the recipient plant are reduced, thereby obtaining a target plant with improved drought resistance. Furthermore, the CRISPR / Cas system can express gRNA encoding the gene that targets the TaSRT1 protein and the effector protein of the CRISPR / Cas system: Cas9 protein; C1-2) Mutate any one, two, or three of the following C1-21)-C1-23) mutations in the genes of the recipient plant to obtain a target plant with improved drought resistance. The plant may be wheat. C1-21) Insert one adenine deoxyribonucleotide between positions 5826 and 5827 of the gene with reference sequence number TraesCS2D02G075800 in the recipient wheat genome; C1-22) Five deoxyribonucleotides at positions 5805-5809 of the gene with reference sequence number TraesCS2B02G092700 in the recipient wheat genome were deleted, and one thymine deoxyribonucleotide was inserted at the same time. C1-23) The four deoxyribonucleotides at positions 5246-5249 of the gene with the reference sequence TraesCS2A02G077800 in the recipient wheat genome were deleted; C1-3) By performing any one, two, or three of the following mutations (C1-31)-C1-33) on the genes in the recipient plant, a target plant with improved drought resistance is obtained. The plant may be wheat: C1-31) The adenine deoxyribonucleotide at position 5826 of the gene with reference sequence number TraesCS2D02G075800 in the recipient wheat genome was deleted. C1-32) The 33 deoxyribonucleotides at positions 5780-5812 of the gene with reference sequence number TraesCS2B02G092700 in the recipient wheat genome were deleted; C1-33) The eight deoxyribonucleotides at positions 5242-5249 of the gene with reference sequence number TraesCS2A02G077800 in the wheat genome were deleted; C2) The method includes introducing the gene encoding the TaSRT1 protein into the recipient plant to obtain a target plant with reduced drought resistance.

8. The use of a protein, or a substance regulating the expression of the protein-encoding gene, or a substance regulating the activity or content of the protein, in any of the following: A1) Its application in regulating plant drought resistance; A2) Application in the preparation of products that regulate plant drought resistance; A3) Applications in plant breeding or plant-assisted breeding; A4) Application in the preparation of plant breeding or plant-assisted breeding products; The protein is the TaSRT1 protein as described in claim 1.

9. The application according to claim 8, characterized in that, The substance that regulates the expression of the protein-coding gene or the substance that regulates the activity or content of the protein is a biological material, and the biological material is any one of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the TaSRT1 protein-encoding gene as described in claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8) A nucleic acid molecule encoding the TaSRT1 protein as described in claim 1; B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

10. The application according to claim 9, characterized in that, B1) The nucleic acid molecule is the RNA molecule or DNA encoding the RNA molecule whose target sequence is the first 19th position of SEQ ID No. 8 and / or the first 19th position of SEQ ID No. 9; B8) The nucleic acid molecule is any one of the following (g1)-g4): g1) The coding sequence of the coding strand is a DNA molecule with SEQ ID No. 2, 4 or 6; g2) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 3; g3) DNA molecules whose nucleotide sequence of the coding strand has reference sequence numbers TraesCS2D02G075800, TraesCS2A02G077800 or TraesCS2B02G092700. g4) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1)-g3) and regulates plant drought resistance.

Images