Application of tomato gene SlLyk13 in regulating and controlling bacterial wilt resistance of plants
By regulating the expression of the tomato gene SlLyk13, the problem of the lack of bacterial wilt resistance gene resources in existing technologies has been solved, thereby improving the resistance of tomatoes to bacterial wilt and providing a green and efficient breeding method.
Patent Information
- Application Number
- CN202511813078.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-10
AI Technical Summary
Current technologies lack effective genetic resources to combat bacterial wilt caused by Ralstonia solanacearum, resulting in complex control measures that are slow to take effect and pose chemical pollution problems.
The SlLyk13 gene in tomatoes is used to regulate plant resistance to bacterial wilt. This can be achieved by overexpressing or knocking down the SlLyk13 gene, thereby increasing or decreasing plant resistance to bacterial wilt. This includes the use of biological materials such as overexpression recombinant vectors and knockdown recombinant vectors.
It significantly improved the resistance of tomatoes to bacterial wilt, providing a green and efficient breeding strategy and enhancing the plant's ability to control bacterial wilt.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to tomato genes. SlLyk13 Application in regulating plant resistance to bacterial wilt. Background Technology
[0002] Rhesus solani (Solanaceae Rhesus) Ralstonia solanacearum Bacterial wilt caused by [unspecified pathogen] is a common soil-borne vascular disease in tomato cultivation. This pathogen can infect and block the plant's vascular system, ultimately leading to plant wilting and death, causing serious economic losses.
[0003] Based on this, scientists have conducted a series of explorations into the prevention and control of bacterial wilt, including agricultural cultivation, physical and chemical control, and biological control measures. However, these measures face many application bottlenecks. For example, traditional agricultural cultivation and management measures can reduce the occurrence and development of bacterial wilt in the field, but they also have the disadvantages of being complex and slow to take effect. Chemical control is the fastest-acting control measure, but the use of large quantities and various types of pesticides and fertilizers leads to prominent "3R" problems (recycling, recycling, and environmental degradation). Therefore, there is an urgent need to further explore and develop greener and more efficient control strategies. Creating disease-resistant varieties is the most economical and effective strategy for controlling bacterial wilt and has become a research direction for its prevention and control. Using gene editing technology to breed disease-resistant varieties is the most economical and effective way to control bacterial wilt. However, there is currently a lack of widely available bacterial wilt resistance genes; therefore, the development of new bacterial wilt-resistant breeding gene resources is imminent. Summary of the Invention
[0004] To address the lack of gene resources for resistance to bacterial wilt in existing technologies, this invention provides a tomato gene. SlLyk13 Its application in regulating plant resistance to bacterial wilt includes the following technical solutions: This invention provides a tomato gene SlLyk13 and / or regulate tomato genes SlLyk13 Applications of the expressed biological material, including regulating plant resistance to bacterial wilt and / or breeding of bacterial wilt-resistant plants; the tomato gene SlLyk13 The accession number in the Sol Genomics Network database is Solyc01g098410.
[0005] Preferably, the pathogen of bacterial wilt includes Rhesus solani (a member of the Solanaceae family).
[0006] Preferably, the regulation includes: overexpressing the tomato gene. SlLyk13 To improve plant resistance to bacterial wilt, or to knock down the aforementioned tomato gene. SlLyk13 Reduce plant resistance to bacterial wilt.
[0007] Preferably, the plant includes tomato.
[0008] This invention also provides a method for regulating tomato genes. SlLyk13 Biological materials expressing the tomato gene, said biological materials including those overexpressing the tomato gene. SlLyk13 Biological materials and / or knockdown of tomato genes SlLyk13 Biomaterials.
[0009] Preferably, the overexpression of the tomato gene SlLyk13 Biological materials include those overexpressing the tomato gene. SlLyk13 Primer pairs containing the tomato gene SlLyk13 Overexpression recombinant vectors and / or vectors containing the tomato gene SlLyk13 Overexpression of microorganisms.
[0010] Preferably, the overexpression of the tomato gene SlLyk13 The primer pairs include an upstream primer as shown in SEQ ID NO:8 and a downstream primer as shown in SEQ ID NO:10.
[0011] Preferably, the knockdown of the tomato gene SlLyk13 Biological materials include tomato genes SlLyk13 VIGS primer pairs, tomato gene SlLyk13 gRNA, knockdown of tomato gene SlLyk13 Recombinant vectors and / or knockdown of tomato genes SlLyk13 Recombinant microorganisms.
[0012] Preferably, the tomato gene SlLyk13 The VIGS primer pair includes an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2; the tomato gene SlLyk13 The gRNA is shown in SEQ ID NO:4.
[0013] This invention also provides a method for improving plant resistance to bacterial wilt, comprising the following steps: overexpressing the tomato gene in the target plant. SlLyk13 The tomato gene SlLyk13 The gene accession number is Solyc01g098410.
[0014] The beneficial effects of this invention are as follows: This invention provides a tomato gene SlLyk13 and / or regulate tomato genes SlLyk13 Applications of the expressed biological material, including regulating plant resistance to bacterial wilt and / or breeding of bacterial wilt-resistant plants; the tomato gene SlLyk13 The accession number in the Sol Genomics Network database is Solyc01g098410. This invention, through screening, identified genes involved in the recognition of extracellular polysaccharides in *Ralstonia solanacearum*.SlLyk13 This was verified in tomatoes through gene silencing and gene knockout. SlLyk13 ,Discover SlLyk13 This gene is involved in the recognition of extracellular polysaccharides by Ralstonia solanacearum and in regulating the resistance of tomatoes to Ralstonia solanacearum. Overexpression of this gene in the roots of the susceptible variety Moneymaker was demonstrated. SlLyk13 ,Discover SlLyk13 The gene can significantly improve the resistance of transgenic tomatoes to Ralstonia solanacearum. Therefore, this invention provides a tomato gene that can enhance the resistance of tomatoes to Ralstonia solanacearum. SlLyk13 It can be used for breeding tomatoes to resist bacterial wilt. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0016] Figure 1 The results show the effect of silencing the SlLYK13 gene on the effect of extracellular polysaccharide EPS-induced immunity in tomatoes. Where A represents the results of reactive oxygen species burst induced by extracellular polysaccharide EPS in silent tomatoes, and B represents the expression level of SlLYK13 in silent tomatoes; Figure 2 for sllyk13 Sequencing results of the target site in the knockout mutant; Figure 3 To knock out SlLYK13 Results of the influence of genes on tomato plant growth; Figure 4 To knock out SlLYK13 Results of the influence of genes on resistance to bacterial wilt in tomatoes; Where A is the Money marker (MM) and sllyk13 A schematic diagram of the appearance of the knockout mutant after inoculation with Ralstonia solanacearum; B shows the disease incidence rate of the plant after inoculation with Ralstonia solanacearum; C shows the survival rate of the plant after inoculation with Ralstonia solanacearum; D shows the bacterial count of the plant after inoculation with Ralstonia solanacearum. Figure 5 This is a schematic diagram of the overexpression vector structure; Figure 6 For overexpression SlLyk13 Results of the influence of genes on resistance to bacterial wilt in tomatoes; Among them, A is the result of the expression of SlLYK13-HA in the roots of the plants; B is a schematic diagram of the appearance of plants with different manifestations after inoculation with Money marker (MM) and OxSlLYK13; C is the result of the incidence of disease of plants inoculated with bacterial wilt pathogen; D is the result of the survival rate of plants inoculated with bacterial wilt pathogen. Detailed Implementation
[0017] This invention provides a tomato gene SlLYK13 and / or regulate tomato genes SlLYK13 Applications of the expressed biological material, including regulating plant resistance to bacterial wilt and / or breeding of bacterial wilt-resistant plants; the tomato gene SlLyk13 The accession number in the Sol Genomics Network database is Solyc01g098410.
[0018] In one embodiment, the pathogen of bacterial wilt includes Rhesus solani (soybean wilt). In another embodiment, the regulation includes overexpressing the tomato gene. SlLyk13 To improve plant resistance to bacterial wilt, or to knock down the aforementioned tomato gene. SlLyk13 Reduce the plant's resistance to bacterial wilt. As one implementation, the plant includes tomato.
[0019] This invention also provides a method for regulating tomato genes. SlLyk13 Biological materials expressing the tomato gene, said biological materials including those overexpressing the tomato gene. SlLyk13 Biological materials and / or knockdown of tomato genes SlLyk13 Biomaterials.
[0020] As one implementation method, the overexpression of the tomato gene SlLyk13 Biological materials include those overexpressing the tomato gene. SlLyk13 Primer pairs containing the tomato gene SlLyk13 Overexpression recombinant vectors and / or vectors containing the tomato gene SlLyk13 Overexpression of the tomato gene by microorganisms. As one implementation method, the overexpression of the tomato gene... SlLyk13 The primer pair includes the upstream primer shown in SEQ ID NO:8 and the downstream primer shown in SEQ ID NO:10. In one embodiment, the overexpression recombinant vector includes a backbone vector. In one embodiment, the backbone vector includes a binary expression vector. In one embodiment, the binary expression vector includes pCAMBIA2300. In one embodiment, the overexpression microorganism includes a basic microorganism. In one embodiment, the basic microorganism includes Agrobacterium. In a specific embodiment, the Agrobacterium is Agrobacterium MSU440.
[0021] As one implementation method, the knockdown of the tomato gene SlLyk13 Biological materials include tomato genes SlLyk13 VIGS primer pairs, tomato gene SlLyk13 gRNA, knockdown of tomato gene SlLyk13 Recombinant vectors and / or knockdown of tomato genes SlLyk13 Recombinant microorganisms. As one implementation method, the tomato gene...SlLyk13 The VIGS primer pair includes an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2. As one embodiment, the tomato gene... SlLyk13 The gRNA is shown in SEQ ID NO:4. In one embodiment, the recombinant vector includes a backbone vector. In one embodiment, the backbone vector includes a PTX knockout vector. In one embodiment, the recombinant microorganism includes a basic microorganism. In one embodiment, the basic microorganism includes *Escherichia coli*. In a specific embodiment, the *Escherichia coli* is *Escherichia coli* MC1061.
[0022] This invention also provides a method for improving plant resistance to bacterial wilt, comprising the following steps: overexpressing the tomato gene in the target plant. SlLyk13 The tomato gene SlLyk13 The gene accession number is Solyc01g098410.
[0023] This invention also provides a method for creating a plant model susceptible to bacterial wilt, comprising the following steps: knocking down the tomato gene in the target plant. SlLyk13 The tomato gene SlLyk13 The gene accession number is Solyc01g098410.
[0024] To further illustrate the present invention, the tomato gene provided by the present invention will be described below with reference to the accompanying drawings and embodiments. SlLyk13 The application of this invention in regulating plant resistance to bacterial wilt is described in detail, but it should not be construed as limiting the scope of protection of this invention.
[0025] The plant materials, bacterial strains, reagents, instruments, and experimental methods used in this invention are as follows: 1. Plant materials Money maker is a tomato variety susceptible to bacterial wilt, while Hawii7996 is a tomato variety resistant to bacterial wilt.
[0026] 2. Test strains Competent transformation strains: Escherichia coli MC1061 for heat shock transformation, and Agrobacterium GV3101 and MSU440 for electroporation transformation.
[0027] Pathogen: Rhesus solani GMI1000 strain.
[0028] 3. Various enzymes, reagents, and instruments Taq and EasyPfu DNA Polymerase were purchased from Beijing TransGen Biotech Co., Ltd.; the reverse transcription kit was purchased from Shanghai Yisheng Biotechnology Co., Ltd.; restriction endonucleases were purchased from Baori Biotechnology Co., Ltd.; SYBR was purchased from Mona Biotechnology Co., Ltd.; Trizol was purchased from Beijing Tiangen Biotech Co., Ltd.; the column-based DNA recovery kit was purchased from Shanghai Sangon Biotech Co., Ltd.; other routine reagents were domestically produced analytical grade or chemically pure reagents; primers were synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd.; sequencing was performed by Qingke Sequencing Co., Ltd.
[0029] PCR instrument (Eppendorf AG 22331 Hamburg), electrophoresis instrument (Tanon EPS 600), fully automated multi-functional microplate reader (Tecan Spark™), real-time PCR instrument (C1000 Touch™), chemiluminescence analyzer (Tanon 5200), spectrophotometer (DeNovix DS 11), clean bench (Beijing Hadonglian HDL), gel imaging system (BIO-RADChemiDoc XRS+), SLR camera (Nikon B700).
[0030] 4. Preparation of reagents and culture media HA antibody (Roche, catalog number 12013819001): 1×PBST + 5% Milk + α-HA-HRP (1:2000 dilution) Agrobacterium suspension: MS Salt 4.3 g, Sucrose 20.0 g, inositol (20 mg / mL) 5 mL, vitamin B1 (1 mg / mL) 400 μL, adjust to pH=5.8, add ddH2O to 1 L, autoclave at 121℃ for 30 min.
[0031] LB liquid medium: Tryptone 10.0 g, Yeast extract 5.0 g, NaCl 10.0 g, ddH2O to a final volume of 1 L, autoclave at 121℃ for 30 min. For solid medium, add an additional 12.0 g of agar.
[0032] CPG liquid medium: Bacteriological peptone NO.2 10.0 g, Casein Hydroxysulfate (acid) 1.0 g, Glucose 5.0 g, ddH2O to a final volume of 1 L, autoclave at 121℃ for 30 min. For solid medium, add an additional 15.0 g of agar.
[0033] 1 / 2MS solid medium: MS Salt 2.2 g, MES 0.5 g, add 0.8 L ddH2O, adjust pH to 5.8 with 5 M KOH, Sucrose 5.0 g, bring volume to 1 L with ddH2O, Agar 8.0 g, autoclave at 121℃ for 30 min.
[0034] KCMS medium (pre-culture and co-culture medium): macroelements (20X) 50 mL, microelements (200X) 5 mL, iron salts (200X) 5 mL, inositol (20 mg / mL) 5 mL, vitamin B1 (1 mg / mL) 1.3 mL, 2,4-D (1 mg / mL) 200 μL, KH2PO4 (100 mg / mL) 2 mL, KT (1 mg / mL) 100 μL, Sucrose 30.0 g, adjust to pH=5.8, bring to a final volume of 1 L with ddH2O, agar 7.4 g, autoclave at 121℃ for 30 min.
[0035] 2Z medium (screening medium): 50 mL macroelements (20X), 5 mL microelements (200X), 5 mL iron salts (200X), 5 mL organic matter (200X), 30.0 g Sucrose, adjust to pH=5.8, bring to 1 L with ddH2O, 7.4 g agar, autoclave at 121℃ for 30 min, and when the temperature is cooled to 60℃, add 100 μL IAA (1 mg / mL), 2 mL zeatin (1 mg / mL), 1 mL kanamycin (100 mg / mL), and 1.2 mL cephalosporin (300 mg / mL).
[0036] 0.2Z medium (subculture medium): 50 mL macroelements (20X), 5 mL microelements (200X), 5 mL iron salts (200X), 5 mL organic matter (200X), 30.0 g Sucrose, adjust to pH=5.8, bring to 1 L with ddH2O, 7.4 g agar, autoclave at 121℃ for 30 min, and when the temperature is cooled to 60℃, add 200 μL zeatin (1 mg / mL), 1 mL kanamycin (100 mg / mL), and 1.2 mL cephalosporin (300 mg / mL).
[0037] Rooting medium: 50 mL macroelements (20X), 5 mL microelements (200X), 5 mL iron salts (200X), 5 mL organic matter (200X), 2 mL IBA (1 mg / mL), 30.0 g Sucrose, 7.4 g agar, adjust to pH=5.8, bring to a final volume of 1 L with ddH2O, autoclave at 121℃ for 30 min, and add 500 μL kanamycin (100 mg / mL) and 1.2 mL cephalosporin (300 mg / mL) when the temperature is cooled to 60℃.
[0038] 5. Experimental Methods 5.1 Plant RNA Extraction Methods: Take 6 tomatoes, each 0.28 cm long. 2 Leaf discs were placed in 1.5 mL centrifuge tubes and rapidly frozen with liquid nitrogen. The tissue was quickly ground into powder, and 350 μL of Trizol was added. The powder was then ground again thoroughly, followed by the addition of another 350 μL of Trizol solution. The mixture was inverted and incubated at room temperature for 10 min. 120 μL of chloroform was added, and the mixture was vigorously inverted and incubated at room temperature for 10 min. The mixture was then centrifuged at 12,000 rpm for 15 min at 4 °C. 400 μL of the supernatant was collected, and 400 μL of phenol / chloroform was added. The mixture was thoroughly mixed and centrifuged at 12,000 rpm for 15 min at 4 °C. The supernatant was transferred to a new centrifuge tube, and 300 μL of isopropanol was added. The mixture was inverted and incubated at -20 °C for 10 min. The supernatant was discarded after centrifugation at 12,000 rpm for 15 min at 4 °C. The supernatant was discarded, and the precipitate was resuspended in 75% ethanol (prepared with DEPC water) and washed. The precipitate was centrifuged at 12,000 rpm for 5 min at room temperature. The supernatant was discarded, and the residual liquid was aspirated. The precipitate was dried in a laminar flow hood for 3 min. 30 μL of chloroform was added to the supernatant. Dissolve RNA in DEPC water, gently tap the bottom of the tube to mix the solution. Measure the concentration and store at -20°C.
[0039] 5.2 Agrobacterium-mediated gene silencing method in tomato: The VIGS vector was electroporated into GV3101 Agrobacterium competent cells. After incubation at 28 °C for 3 h, the cells were plated onto LB agar plates containing 25 μg / mL kana and 25 μg / mL gen. Single colonies were picked and incubated in LB liquid medium with the same resistance at 28 °C and 190 rpm for 12 h. 200 μL of the bacterial culture was transferred to 3 mL of liquid LB medium containing 25 μg / mL kana, 25 μg / mL gen, 10 mM MMES (morpholinoethanesulfonic acid), and 20 μM AS (acetylsyl syringone). The culture was incubated at 28 °C and 190 rpm for 8 h. The bacterial culture was collected, centrifuged at 4,000 rpm, and the bacterial cells were collected. The bacterial cells were resuspended using Agrobacterium suspension and the OD of the culture was adjusted. 600The concentration was 1.5. Agrobacterium YL192 and YL156 were mixed in a 1:1 ratio and injected into the cotyledons of H7996 seedlings that had been growing for one week. Approximately 10 days after inoculation, silencing phytoene desaturase (…) was observed. SlPDS1 The control group of the gene (gene number Solyc03g123760) showed leaf albinoization, and the plant was ready for experimental operation.
[0040] 5.3 Experimental method for EPS-mediated reactive oxygen species burst in tomato leaves and roots: Twelve 0.28 cm samples were taken from tomato plants that were 4 weeks old. 2 Leaf discs were collected, and each leaf disc was cut into 4 narrow leaf segments. The leaf segments were placed in a 96-well plate, and 100 μL of ddH2O was added to each well. The plate was allowed to recover overnight. The ddH2O was removed, and 100 μL of reaction mixture was added, which included 50 μmol / L Luminol, 10 μg / mL peroxidase, and 50 μg / mL EPS. The sample was placed in a microplate reader, and the assay was started immediately. The assay was performed every 1.5 min.
[0041] For root samples, tomato roots grown for 10 days were cut into 0.5 cm segments, and two roots were placed in each well of a 96-well plate containing 100 μL of ddH2O. Each experiment was repeated 12 times, and the samples were allowed to recover overnight. The ddH2O was removed, and 100 μL of a reaction mixture containing 5 μM luminol L-012, 10 μg / mL peroxidase, and 50 μg / mL EPS was added.
[0042] 5.4 Tomato genetic transformation methods: (1) Sowing: Select about 100 plump and healthy Money Marker seeds and pour them into a 50 mL centrifuge tube. Wash with 75% alcohol for 5 min, discard the alcohol, wash the seeds 3 times with sterile water, and then wash the seeds with sodium hypochlorite solution (by volume, 84 disinfectant: distilled water = 1:1) for 5 min. This process should be carried out in a clean bench. Discard the sodium hypochlorite solution and wash the seeds 3 times with sterile water. Place the washed seeds on the surface of 1 / 2 MS medium and culture them in a tissue culture room for about 10 days until the two cotyledons are fully expanded.
[0043] (2) Preparation of explants: Place a piece of filter paper in a petri dish, moisten the filter paper with sterile ddH2O, take out the sterile seedling with unfolded cotyledons, cut off the leaf tip and petiole of the cotyledons, cut it into one explant, place it on KCMS medium (with a layer of filter paper on the medium), and culture in the dark for 2 days.
[0044] (3) Preparation of bacterial culture: Glycerol bacteria containing the knockout vector were picked from -80℃ and streaked on 25 μg / mL Kana and 25 μg / mL LGen (Kana+Gen) resistant LB plates for activation. The plates were incubated upside down at 28℃. The night before the inoculation, single colonies were picked and cultured in 2 mL Kana+Gen resistant liquid LB medium at 28℃ and 190 rpm for 12-16 h. Then, 200 μL of bacterial culture was added to 10 mL Kana+Gen resistant LB medium and cultured at 28℃ and 190 rpm for 6-8 h.
[0045] (4) Infection: Pour the activated bacterial solution into a 15 mL centrifuge tube, centrifuge at 25℃ and 4000 rpm for 20 min, discard the supernatant, add 4 mL of Agrobacterium suspension to suspend the bacterial cells (the Agrobacterium suspension must be opened in a clean bench); measure the OD of the bacterial solution. 600 Dilute the bacterial culture to OD value. 600 =0.1~0.2; Add 30 mL of bacterial suspension to the culture dish, transfer all explants to the Agrobacterium suspension, and incubate for 3~4 min, gently shaking the culture dish during the incubation process; Discard the suspension, place a piece of filter paper in a clean culture dish, transfer the explants onto the filter paper, and quickly absorb the bacterial suspension; Spread a layer of filter paper on KCMS medium, place the explants on the filter paper, and co-culture in the dark for 2 days.
[0046] (5) Screening: Transfer the explants to 2Z medium, with 90-100 leaves per petri dish, with the upper surface of the leaves facing up. Place them in the tissue culture room for culture and observe at least twice a day. After 7 days, the explants will grow. To ensure sufficient growth space, some explants should be transferred to new 2Z medium at this time, and browned explants should be removed. The 2Z medium should be changed every 12-15 days.
[0047] (6) Subculture: Transfer the explants that have grown well on 2Z medium (the callus has swelled and adventitious buds have grown) to 0.2Z medium and subculture for about 15 days; when the adventitious buds have grown leaves, cut off the leaf part of the explant, leaving only the callus and adventitious buds, and place them in a new 0.2Z medium to continue culturing for about 15 days.
[0048] (7) Rooting culture: When the adventitious buds grow to 2-3 cm, cut them off from the base of the root and transfer them to the rooting culture medium to induce rooting.
[0049] (8) Transplanting: When the adventitious roots of the seedlings are growing well, take out the transformed seedlings, clean the culture medium on the roots, transplant them into nutrient soil, cover them with a lid to keep them moist for about 1 week, uncover them and manage them normally, and wait for verification.
[0050] 5.5 Tomato DNA Extraction Use a hole punch to take a round piece of tomato leaf (0.28 cm). 2 Place the sample in a 1.5 mL centrifuge tube and freeze it with liquid nitrogen. Grind the tissue rapidly for about 10 seconds using a grinder. Add 200 μL of 2% CTAB and grind it thoroughly again. Incubate in a 65°C water bath for 15 min. Add 200 μL of chloroform, mix well, centrifuge at 12000 rpm for 15 min, aspirate 150 μL of the supernatant, add an equal volume of isopropanol, invert and mix, centrifuge at 12000 rpm for 15 min and discard the supernatant. Resuspend the precipitate in 75% ethanol and wash it. Centrifuge at 12000 rpm at room temperature for 5 min, discard the supernatant, aspirate the residual liquid, place in a clean bench for 3-5 min to dry the precipitate, add 100 μL of ddH2O to dissolve the DNA, and gently tap the bottom of the tube to mix the solution.
[0051] 5.6 Statistics on root dipping and inoculation with Ralstonia solanacearum in tomatoes and disease incidence Infected tomatoes (Money maker and) were cultured in 32-well trays. SlLyk13 Mutant tomatoes were cultured for approximately 4 weeks before inoculation. The active strain of Rhesus solani GMI1000 was streaked onto CPG plates containing 50 μg / mL SpeC (spectinomycin). Single colonies were picked and cultured in SpeC-resistant liquid CPG medium at 28°C and 190 rpm until OD (occurrence limit). 600 =1.0, transfer the bacterial culture to a 50 mL centrifuge tube, centrifuge at 4000 rpm for 15 min to collect the bacterial cells, resuspend in ddH2O, and adjust the bacterial culture to OD200. 600 =0.1. Small soil clumps of growing tomatoes were soaked in Ralstonia solanacearum GMI1000 bacterial solution for 1 hour. Then, the inoculated tomatoes were transferred to a constant temperature and light incubator (28℃, RH 99%, 12 h light / 12 h dark) for cultivation. The incidence rate and disease index were recorded within 14 days. According to the degree of wilting of the plant leaves, the disease was divided into 5 disease grades: Grade 0, no wilting symptoms; Grade 1, 1%~25% of leaves wilting; Grade 2, 26%~50% of leaves wilting; Grade 3, 51%~75% of leaves wilting; Grade 4, 76%~100% of leaves wilting.
[0052] Incidence rate = (N1+N2+N3+N4) / (N0+N1+N2+N3+N4)×100%; Disease Index (DI) = (N1×1+N2×2+N3×3+N4×4+) / (N0+N1+N2+N3+N4).
[0053] Where N0, N1, N2, N3, and N4 represent the number of plants with disease severity levels of 0, 1, 2, 3, and 4, respectively.
[0054] Colony count: About 10 days after inoculation, a small segment of about 0.2g from the base of a tomato stem was cut, made 3 times longitudinally with a blade, inserted into 1 mL of ddH2O and left to stand for 1 hour. The bacterial suspension was collected and recorded as 10⁻². The suspension was then serially diluted to 10⁻⁴ and 10⁻⁵ using ddH2O. 10 μL of the 10⁻⁴ and 10⁻⁵ bacterial suspensions were spread on CPG plates with the corresponding resistance levels and incubated at 28 ℃ for 2 days. Single colonies were then counted.
[0055] Example 1: Screening and Validation of Genes Involved in the Recognition of Extracellular Polysaccharides in Ralstonia solanacearum Multiple conserved pathogen-associated molecular patterns exist within *Ralstonia solanacearum* (S. solanacearum), and plants have evolved receptors that specifically recognize these molecules during the long-term struggle against it. The extracellular polysaccharide (EPS) secreted by *Ralstonia solanacearum*, as a major pathogenic factor, blocks xylem vessels, causing plant wilting. EPS can also act as an immune elicitor, activating the tomato's defense response; however, how the tomato immune system mediates the recognition and transduction of EPS signals remains unknown. Based on this background, this invention hypothesizes that the tomato pattern recognition receptor SlLYKs family is involved in the recognition process of *Ralstonia solanacearum* extracellular polysaccharides. A search of published domestic and international literature revealed no research reports on the relationship between the tomato pattern recognition receptor SlLYKs family and resistance to *Ralstonia solanacearum*. Therefore, this invention investigates the involvement of tomato SlLYKs in the recognition of *Ralstonia solanacearum* extracellular polysaccharides and their role in the development of tomato resistance to *Ralstonia solanacearum*.
[0056] Existing research has demonstrated that RD-type receptor kinases and non-RD-type receptor kinases form complexes to co-mediate ligand recognition. To screen for receptor-like kinases functional in EPS recognition, this invention utilizes VIGS technology to target RD-type kinases. SlLyk13 (Solyc01g098410) underwent gene silencing.
[0057] First, design using Primer Premier5 software. SlLyk13 The VIGS primer pair for the gene is shown below: SlLyk13 -VIGS-F (SEQ ID NO:1): 5'-GAATTCCTTTCTTCATCTGGCCCGAA-3'; SlLyk13 -VIGS-R (SEQ ID NO:2): 5'-GGTACCGCCTGGAATGTACAACAACC-3'.
[0058] exist SlLyk13 -VIGS-F and SlLyk13 Add -VIGS-R primers EcoR I. KpnI. Restriction sites. Amplification is performed using cDNA as a template, as shown in SEQ ID NO:3, and utilizing... EcoR I and Kpn I. The PCR product was digested with restriction endonucleases, and the target fragment was recovered. Simultaneously, [the process was repeated - the original text is incomplete]. EcoR I and Kpn I. The YL156 vector was digested with enzymes and recovered to obtain the vector. The vector and fragment were ligated using T4 DNA ligase at 16℃ for 12 h. The ligation product was then transformed into MC1061 competent cells and plated onto LB plates with 50 μg / mL Kana resistance. The cells were incubated at 37℃. Single colonies were picked and cultured in LB liquid medium with 50 μg / mL Kana resistance at 190 rpm for 8-10 h at 37℃. The plasmid was extracted and double-digested with EcoRI and KpnI to verify the successful construction of the VIGS gene silencing vector. The size of the target band confirmed the successful construction of the VIGS gene silencing vector.
[0059]
[0060] Leaves from the third flush of tomatoes that had been dormant for 10 days were selected. After overnight recovery, the leaves were treated with 50 μg / ml EPS, and the EPS-induced ROS burst in the leaves was detected using a microplate reader. The results showed that the dormant leaves... SlLyk13 Subsequently, the reactive oxygen species burst triggered by extracellular polysaccharide EPS was significantly reduced compared to the silent GFP group, indicating that... SlLyk13 It may be involved in the recognition of extracellular polysaccharides in Ralstonia solanacearum. Figure 1 (A)
[0061] RNA was extracted from tomato leaves of gene-silencing plants. 1 μg of RNA was used for reverse transcription to synthesize cDNA, which was diluted 5-fold and used as a template. The gene silencing efficiency of the tomato leaves was detected using qRT-PCR. The results showed that TRV- SlLyk13 Target in silent sample SlLyk13 The expression level of was significantly reduced ( Figure 1 (B) Explanation SlLyk13 Successfully silenced, proving Figure 1 The result shown in A is reliable.
[0062] Example 2: Knockout of the target gene A) Construction of the knockout vector This invention utilizes online websites such as CRISPR-P and CRISPR-PLANT to design targeted [treatments / treatments]. SlLyk13 The gDNA of the first LysM domain, the target sequence, and the gDNA sequence are shown below: Targeting sequence (SEQ ID NO:4): 5’-ATGATATTCCTAAGAAGGAGATCAATAACAATCCTAGTCCTGATTTACTTCTTCTCAAATTGCACAACATGTTATTCCACTAGTTGCACAAATGGCTGTGATTTAGCTTTAGCTTCCTTCTTCATCTGGCCCGAATCGAATCTCCCTTTAATAAACCAACTATTTGACAACATCTCATACAGTGATATCCTTGAGTGGAATACTCAAATCACAAGCACGTTTATCCTAACCGAATCCAGAGTTCACGTTCCCTTTCGTTGTGATTGCCTTAATAATGGTGAGTTTCTGGGCCATGTATTTTCGTATAATGTTAGTGCCAATGAGACTTATGATCTCATTGCAACAAGGCGCTATTCAAGTTTGACGAATAAGGAGTTGTTGATGAGGGATAATAGGTATCCGGATAACAATATACCGGATCATGTGACCTTGAATGTGACTGTGAATTGCTCCTGTGGGAATAAACATGTGTCAAAGGATTATGGATTGTTTATCACGTATCCGATGAGGCCGGGGGAAAATTTGAGTTATATCGCGTTGGTGACTAATACTAGCTCCAAGCTGATAGAAATGTACAATCCAATGGTGAATTTCAGTGCTGGCAGCGGGTTGTTGTACATTCCAGGCAGAG-3’; gDNA (SEQ ID NO:5): 5’-CATACAGTGATATCCTTGAG-3’.
[0063] Using the 043 plasmid as a template, the target fragment was amplified using the following primer sequences: Plasmid-F (SEQ ID NO:6): 5’-ATATATGGTCTCGTTTGCATACAGTGATATCCTTGAGGTTTTAGAGCTAGAAATAGC-3’; Plasmid-R (SEQ ID NO:7): 5’-ATTATTGGTCTCGAAACCACGTATCCGATGAGGCCGGCAAACTACACTGTTAGATTC-3’; The amplification system (50 μL) consisted of the following components: 1 µL of 043 plasmid, 1 µL of 10 μmol / L plasmid-F, 1 µL of 10 μmol / L plasmid-R, 10 µL of 5×Pfu buffer, 1 µL of 10 mmol / L dNTP, 1 µL of Pfu, and 34 µL of ddH2O.
[0064] The amplification program includes 35 cycles of pre-denaturation at 95°C for 3 min, followed by denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min, a final extension at 72°C for 10 min, and storage at 12°C for 10 min.
[0065] After obtaining the amplification product, the target fragment and the PTX knockout vector were digested with PstI enzyme, and the vector and fragment were ligated using T4 DNA ligase. The mixture was then heat-transformed into MC1061 competent cells and cultured at 37°C for about 8 h on LB plates with 50 μg / mL Kana resistance. Single colonies were picked for colony PCR verification. The colonies that were verified to be correct were sequenced. Single clones whose sequencing results could be correctly matched with the predicted sequence were selected for plasmid extraction. The obtained plasmids were the successfully constructed CRISPR knockout vectors.
[0066] The vector was transformed into GV3101 competent cells by electroporation. After incubation at 28°C for 3 h, the cells were plated onto LB agar plates containing 25 μg / mL Kana and 25 μg / mL Gen. Single colonies were picked and transferred to LB liquid medium with the same resistance, and incubated at 28°C until OD500. 600 =1.0, mix the bacterial culture with 50% glycerol at a volume ratio of 1:1, store at -80℃ for later use, and obtain glycerol bacteria.
[0067] B) Obtaining the target gene knockout mutant through genetic transformation of tomatoes. Sterilized tomato Money Marker seeds were planted on 1 / 2 MS medium, and T1 generation transgenic tomatoes were obtained according to tomato genetic transformation methods. Leaf discs of T1 generation plants were taken, and genomic DNA was extracted from the tomatoes using the CTAB method. SlLyk13 PCR amplification was performed using CRISPR identification primers. SlLyk13 The amplification primer pair sequences are shown below: SlLyk13 -F1 (SEQ ID NO:8): 5'-CCTCTCCCCTTGCTCCGTGGATCCATGATATTCCTAAGAAGGAGATCAATAAC-3'; SlLyk13 -R1 (SEQ ID NO:9): 5'-CTGCCAGCACTGAAATTCAC-3'.
[0068] PCR amplification was performed using the primer pairs shown above.
[0069] The PCR amplification system (10 μL) consisted of the following components: 1 µL genomic DNA, 0.2 µL 10 μmol / L SlLyk13-F1, 0.2 µL 10 μmol / L SlLyk13-R1, 5 µL 2× Taq Mix, and ddH2O to a final volume of 10 µL.
[0070] The PCR amplification program included 35 cycles of pre-denaturation at 95℃ for 3 min, followed by denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, and extension at 72℃ for 1 min, a final extension at 72℃ for 10 min, and storage at 12℃ for 10 min.
[0071] The PCR amplification products were sequenced for verification, and the results are as follows: Figure 2 As shown, it can be seen sllyk13-M4 The mutant lacks 5 bp near the editing site, causing the 63rd amino acid to mutate into a stop codon, thus prematurely terminating protein expression.
[0072] The obtained T1 generation heterozygous plant seeds were planted in soil, and the plant genomic DNA was extracted and used... SlLyk13 CRISPR identification primers were used for PCR amplification, and the products were sequenced for verification. A T2 generation homozygous mutant plant with a 5 bp deletion near the editing site and a single-peak sequencing result was obtained. The mutant was cultured in nutrient soil. sllyk13-M4 Using a tomato moneymarker, the plant height was measured, and the results were as follows: Figure 3 As shown, no significant difference was found between the two in terms of growth and development, indicating that... SlLyk13 The mutation does not affect the growth and development of tomatoes.
[0073] Example 3: Disease resistance phenotype of knockout mutant against Ralstonia solanacearum The SpeC-resistant GMI1000 strain was inoculated into Money marker and root drenching in a root dredging method. [[ID= - M4 The mutant roots were examined for disease development over 12 days, and the money marker and [other markers] were observed within 12 days. - M4 The mutant plant looks like As shown in Figure A, the statistics of the Money marker and - M4 The incidence and disease index of the mutants are as follows: China B and As shown in C.
[0074] Depend on As can be seen from A to C, - M4 Compared to the susceptible tomato variety Money Marker, the mutant plants showed significantly reduced resistance to Ralstonia solanacearum, with higher incidence and disease index, and more severe disease outbreaks.
[0075] Approximately 7 days after inoculation, a small segment of about 0.2 g from the base of the tomato stem was cut and placed in 1 mL ddH2O for 1 h. The bacterial culture was collected, serially diluted, and 10 μL of the diluted bacterial culture was taken as a 10:10 concentration. -4 10 -5 The bacterial suspension was spread on CPG plates with the appropriate resistance, incubated at 28 °C for 1–2 days, and single colonies were counted. The results are as follows: As shown in D.
[0076] according to The bacterial count results at the base of the stem shown in Figure D are visible. - M4 The mutant showed a significantly higher level of activity compared to the wild-type plant, with a statistically significant difference.
[0077] In summary, these results demonstrate that Knockout significantly reduced the resistance of tomatoes to Ralstonia solanacearum, further illustrating... It plays an important role in the resistance of tomatoes to Ralstonia solanacearum.
[0078] Example 4 Overexpression Tomato resistance phenotypes to Ralstonia solanacearum design The primer pairs for full-length gene amplification are shown below: -F1 (SEQ ID NO:8): 5'-CCTCTCCCCTTGCTCCGTGGATCCATGATATTCCTAAGAAGGAGATCAATAAC-3'; -R2 (SEQ ID NO: 10): 5'-TGGAACGTCGTATGGGTAAGGCCTGGCATGTGACGATGAAAGTG-3'.
[0079] Add restriction enzyme sites to the upstream and downstream primers, respectively. I and I. Using the cDNA of the Money marker from infected tomatoes as a template, amplification was performed to obtain... Full-length gene, using restriction endonucleases I. I. PCR amplification products and binary expression vector pCAMBIA2300 were digested with enzymes; the vector and fragment were ligated using T4 DNA ligase at 16°C for 12 h. The ligation product was then heat-transformed into MC1061 competent cells and plated onto LB plates containing Kana inhibitors. After screening, the overexpression vector was obtained. The structure of the overexpression vector is shown below. As shown.
[0080] The correct overexpression vector pCAMBIA2300-35S:SlLYK13-HA was obtained after double enzyme digestion and sequencing verification. The vector was electroporated into Agrobacterium rhizogenes competent cells MSU440. Using Agrobacterium-mediated genetic transformation, pCAMBIA2300-35S:SlLYK13-HA was transformed into Moneymaker explants. The explants induced callus formation, which in turn induced shoot regeneration. These shoots were then transferred to rooting medium to obtain T1 generation transgenic plants. These T1 plants were then removed and cultured in soil. Root samples were collected, thoroughly ground in liquid nitrogen, and denatured at 95°C for 10 min after adding 50 μL of 2×SDS buffer. Western blot analysis was used to detect the expression of SlLYK13-HA in the roots of the transgenic plants. The results are as follows: As shown in Figure A.
[0081] The results showed that strong expression of SlLYK13-HA protein could be detected in the roots of transgenic tomatoes, indicating that the selected plant OxSlLYK13 was a positive transgenic line.
[0082] Money maker and OxSlLYK13 T1 generation seeds were planted in nutrient soil, and OD seeds were inoculated by root irrigation when the tomatoes reached 4 weeks of age. 600 The bacterial suspension of Ralstonia solanacearum GMI1000 at a concentration of 0.1 was used. Disease incidence and survival rates were recorded within 12 days after inoculation. The results are as follows: As shown in B~D.
[0083] The results showed that compared to the control plant Money Marker, OxSlLYK13 exhibited significantly reduced disease incidence, a significantly lower morbidity rate, and a significantly higher survival rate. These results indicate that... Overexpression of this substance can enhance the resistance of tomatoes to Ralstonia solanacearum.
[0084] In summary, through screening and experimental verification, this invention has discovered a substance that significantly affects resistance to bacterial wilt in tomatoes. Gene. Overexpression in tomatoes This invention utilizes genes that can effectively enhance the resistance of tomatoes to bacterial wilt, reducing the incidence of disease and increasing the survival rate. It provides an effective approach for breeding bacterial wilt-resistant tomato varieties.
[0085] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Tomato genes SlLyk13 and / or regulate tomato genes SlLyk13 The application of expressed biomaterials is characterized by, The applications include regulating plant resistance to bacterial wilt and / or breeding plants resistant to bacterial wilt; the tomato gene SlLyk13 The accession number in the Sol Genomics Network database is Solyc01g098410.
2. The application as described in claim 1, characterized in that, The pathogens causing bacterial wilt include Rhesus solani (a member of the Solanaceae family).
3. The application as described in claim 1, characterized in that, The regulation includes: overexpressing the tomato gene. SlLyk13 To improve plant resistance to bacterial wilt, or to knock down the aforementioned tomato gene. SlLyk13 Reduce plant resistance to bacterial wilt.
4. The application as described in any one of claims 1 to 3, characterized in that, The plant mentioned includes tomatoes.
5. Regulating tomato genes SlLyk13 The expressed biomaterial is characterized by, The biological material includes overexpression of tomato genes. SlLyk13 Biological materials and / or knockdown of tomato genes SlLyk13 Biomaterials.
6. The biomaterial as described in claim 5, characterized in that, The overexpressed tomato gene SlLyk13 Biological materials include those overexpressing the tomato gene. SlLyk13 Primer pairs containing the tomato gene SlLyk13 Overexpression recombinant vectors and / or vectors containing the tomato gene SlLyk13 Overexpression of microorganisms.
7. The biomaterial as described in claim 6, characterized in that, The overexpressed tomato gene SlLyk13 The primer pairs include an upstream primer as shown in SEQ ID NO:8 and a downstream primer as shown in SEQ ID NO:
10.
8. The biomaterial as described in claim 5, characterized in that, The knockdown of tomato genes SlLyk13 Biological materials include tomato genes SlLyk13 VIGS primer pairs, tomato gene SlLyk13 gRNA, knockdown of tomato gene SlLyk13 Recombinant vectors and / or knockdown of tomato genes SlLyk13 Recombinant microorganisms.
9. The biomaterial as described in claim 8, characterized in that, The tomato gene SlLyk13 The VIGS primer pair includes an upstream primer as shown in SEQ ID NO:1 and a downstream primer as shown in SEQ ID NO:2; the tomato gene SlLyk13 The gRNA is shown in SEQ ID NO:
4.
10. A method for improving plant resistance to bacterial wilt, characterized in that, The steps include: overexpressing the tomato gene in the target plant. SlLyk13 The tomato gene SlLyk13 The gene accession number is Solyc01g098410.