Application of ZMK1 and coding gene thereof in regulation and control of saline-alkaline tolerance of plants
By regulating the expression of the ZMK1 protein, gene editing technology was used to increase or decrease the sensitivity or tolerance of maize to salt and alkali stress, thus solving the problem of growth limitation of maize in saline-alkali environment and realizing an effective response to salt and alkali stress.
Patent Information
- Application Number
- CN202511989791.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-02-10
AI Technical Summary
How to regulate the response of maize to salt and alkali stress and improve its salt and alkali tolerance to cope with the growth limitations caused by soil salinization.
By regulating the expression of the ZMK1 protein, its activity and content in maize can be enhanced or inhibited. By utilizing recombinant vectors and expression systems of the ZMK1 encoding gene, gene editing of maize can be achieved, thereby increasing or decreasing its sensitivity or tolerance to salt and alkali stress.
ZMK1 overexpression lines exhibited significant salt- and alkali-stress-sensitive or tolerant phenotypes, with more purple leaves and lower plant height, indicating that ZMK1 protein plays a key role in regulating plant salt and alkali tolerance.
Smart Images

Figure FT_1
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ZMK1 and its encoding gene in regulating plant salt and alkali tolerance. Background Technology
[0002] Soil salinization is a growing trend worldwide, severely limiting crop growth and becoming a major factor restricting agricultural production. The harm caused by salt-alkali stress to plants lies in the high concentration of sodium (Na) in saline-alkali soils. + Excessively high pH levels can lead to the accumulation of salt ions within plant cells, causing ion toxicity and affecting normal cell function in multiple ways. In alkaline soil environments, most metal elements, except for alkali metals, will form insoluble salts, such as Na. + As the most abundant alkali metal element in nature, it will accumulate in alkaline soil, causing soil salinization.
[0003] With the rapid development of molecular biology, genomics, genetics, biochemistry and gene editing technology, the study of the molecular mechanisms of plant resistance to salt and alkali stress has been continuously deepened, and many new genes or proteins have been involved in regulating the salt and alkali stress response process. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to regulate the response of maize to salt and alkali stress.
[0005] To address the above technical problems, the present invention provides the application of protein ZMK1 or biomaterials related to said protein ZMK1, wherein the application is any one of Y1-Y5: Y1. Application in regulating plant salt and alkali tolerance; Y2. Application in the preparation of products that regulate plant salt and alkali tolerance; Y3. Application in cultivating plants with altered salt and alkali tolerance; Y4. Application in the preparation of products for cultivating plants with altered salt and alkali tolerance; Y5. Applications in plant breeding; The protein ZMK1 is a protein that is, as shown in A1), A2), or A3), the following: A1) The amino acid sequence is that of the protein SEQ ID No:2 in the sequence listing; A2) A protein that has more than 80% identity with and is functionally similar to the protein shown in A1, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No:2 in the sequence listing. A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0006] In one embodiment of this application, the regulation of plant salt tolerance or the alteration of salt tolerance is to promote the expression of the protein ZMK1 to increase the plant's sensitivity to salt stress.
[0007] The phenotype of high sensitivity to salt and alkali stress can be characterized by more purple leaves and lower plant height.
[0008] The regulation of plant salt tolerance or the salt tolerance can also be achieved by inhibiting the expression of the protein ZMK1 to improve the plant's tolerance to salt stress.
[0009] The plant breeding refers to the selection and breeding of salt-tolerant plant varieties.
[0010] In the above applications, the protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0011] In the above applications, the protein can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.
[0012] In the above applications, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0013] In the above applications, the 80% or more of identity can be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0014] In the above applications, the biomaterial related to the protein ZMK1 is any one of B1 to B5 below: B1. The nucleic acid molecule encoding the protein ZMK1; B2, an expression cassette containing the nucleic acid molecule described in B1; B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2; B4. Recombinant microorganisms containing the nucleic acid molecules described in B1, or recombinant microorganisms containing the expression cassette described in B2, or recombinant microorganisms containing the recombinant vector described in B3; B5. Transgenic plant cell lines, transgenic plant tissues, transgenic plant organs, or transgenic plants containing the nucleic acid molecules described in B1.
[0015] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0016] In the above application, the coding sequence of the nucleic acid molecule described in B1) is SEQ ID No. 1 in the sequence listing.
[0017] Recombinant expression vectors containing the expression cassette described in B2 can be constructed using existing plant expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as P1300super-MT1T2, pCAMBIA2300-eGFP, pCAMBIA2300, pCAMBIA1301, pCAMBIA1300, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., the polyadenylated nucleotide signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylation to the 3' end of the mRNA precursor, such as Agrobacterium crown gall tumor inducing (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUSGenes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methatrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.
[0018] In the above applications, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.
[0019] In the above applications, the plant is any one of the following: N1) Monocotyledons; N2) Plants of the order Poales; N3) Gramineae plants; N4) Plants of the genus *Zea*; N5) Corn.
[0020] The present invention also provides the protein.
[0021] The present invention also provides the aforementioned biomaterials.
[0022] The present invention also provides a method for improving the sensitivity of maize to salt and alkali stress, comprising enhancing, increasing or upregulating the expression level of the coding gene of the protein in maize, and / or the activity and / or content of the protein, to improve the sensitivity of the maize to salt and alkali stress.
[0023] The phenotype of high sensitivity to salt and alkali stress can be characterized by more purple leaves and lower plant height.
[0024] The present invention also provides a method for improving the salt and alkali tolerance of maize, comprising weakening, inhibiting or downregulating the expression level of the gene encoding the protein ZMK1 in maize, and / or the activity and / or content of the protein ZMK1, to improve the tolerance of the maize to salt and alkali stress.
[0025] The present invention also provides a method for cultivating salt-tolerant maize, comprising the steps of reducing the activity of the protein ZMK1 in the recipient maize or inhibiting the expression of the protein ZMK1 in the recipient maize to obtain salt-tolerant maize; the salt-tolerant maize has a stronger tolerance to salt-alkali stress than the recipient maize.
[0026] This invention demonstrates that, compared with the wild-type B73-329, the ZMK1 overexpression lines exhibit a significantly more sensitive phenotype to salt and alkali stress, indicating that the function of the ZMK1 protein is to reduce the plant's tolerance to high salt and alkali conditions. Attached Figure Description
[0027] Figure 1 This is the phenotype of the wild-type maize B73-329 and ZMK1 overexpression lines in Example 2 of the present invention under salt-alkali stress. Detailed Implementation
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0030] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0031] The maize B73-329 in the following examples has been disclosed in the literature “Liu M, Zhang S, Li W, Zhao X, WangXQ. Identifying yield-related genes in maize based on ear trait plasticity. Genome Biol. 2023;24(1):94” and is available to the public from the applicant.
[0032] The P1300super-MT1T2 in the following examples has been disclosed in the literature “A CRISPR / Cas9 toolkit for multiple genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, HanCY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186 / s12870-014-0327-y”, and is available to the public from the applicant.
[0033] Unless otherwise specified, the quantitative experiments in the following examples were all repeated three times, and the results were averaged.
[0034] Example 1 ZMK1 The CDS sequence of the gene is SEQ ID No. 1. ZMK1 The genome sequence of the gene is SEQ ID No.3, and the amino acid sequence of the protein ZMK1 encoded by it is SEQ ID No.3.
[0035] SEQ ID No.1 SEQ ID No.2 MAGCAPSRVASCGPWGGRAALESELSWDGSHYSISSGILPSLGARSNRRVKLRPFIVSPYDRRYRCWETFLIILVVYSAWVSPFEFGFIQKPTGALAAVDNVVNAFFAVDIILTFFVAYLDRMTYLLEDDPKRIAWRYTTSWFVLDVASTIPSEFARKILPPDLRSYGFFNMLRLWRLRRVSSLFARLEKDRHFNYFWVRCAKLICVTLFAVHCSACFYYLLADMYPTPTDTWIGNSMPDFHQRGLWIRYVVSVYWSITTLTTVGYGDLHAENTREMIFNIFYMLFNLGLTAYLIGNMTNLVVHGTSRTRKYRDTIQAATSFALRNQLPSRLQDQMISHLCLKFRTDSEGLQQQETLDVLPKAIRSSISQYLFFNLVQKVYLFEGVSNDLIFQLVSEMKAEYFPPREDVILQNEAPTDFYILVTGSAELIELQNGGEQMVGVAKAGDVVGEIGVLCYRPQLFTVRTKSLCQLLRMNRTAFLSLVQSNVADGTIIMNNLIRLLKQQNDNSVMMGVLKEIENMLARGRLDLPVTLCFAVNKGDDFMLHQLLKRGLDPNESDNNGHTALHIAASKGDEQCVKLLLEHGADPNARDSEGKVPLWEALCEKQNPVVELLVQSGAGLSSGDVALYACVAVEENDPELLENIIRYGGNVNSSMKDGTTPLHRAVCDGNVQMVELLLEHGADIDKQDNNGWSARALADQQGHDDIQSLFRSRKAHRQQHASKGRVAPVPIWRFNSEPTMPKMKHEEDAELRGKVVPQKLLRKRVSFQNSLFGVISSSHARQDTGRLLSKGLAGTGSPGCSHGSLVRVTIGCPEKGNAAGKLVLLPRSMTELLELGARKFGFKPTKVLTTGGAEIDEVELIRDGDHVVLVSDDWAPDVAQLRPNDK SEQ ID No.3 ZMK1 overexpression lines were obtained from the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University, and their construction method is as follows: 1. Culture medium preparation LB solid medium (1000mL): 10g tryptone, 5g yeast extract, 10g NaCl, 8g agarose, diluted with water to 1000mL, sterilized and cooled.
[0036] LB liquid medium (1000mL): 10g tryptone, 5g yeast extract, 10g NaCl were diluted with water to a final volume of 1000mL, then sterilized and cooled.
[0037] 2. Amplified fragments, gel recovery, enzyme digestion and ligation Design upstream and downstream primer sequences based on the ZMK1 gene sequence: F: 5'-ATGGCAGGGTGCGCACCCTCCAGGGT-3' (identical to the sequence of bits 1-26 of SEQ ID No. 1); R: 5'-TCACTTGTCGTTCGGTCTTAATTGTG-3' (reverse complementary to the sequence of positions 2639-2644 of SEQ ID No. 1).
[0038] After amplification, the target fragment was obtained to be approximately 2664 bp (containing the CDS sequence of ZMK1 with SEQ ID No. 1). The target fragment was then ligated into the starting vector P1300super-MT1T2 to obtain the recombinant vector P1300-MT1T2-ZMK1.
[0039] The structure of the recombinant vector P1300-MT1T2-ZMK1-5 is described as follows: The recombinant vector P1300-MT1T2-ZMK1-5 is obtained by replacing the sequence between the BciVI and FSPI enzyme recognition sites of the starting vector P1300super-MT1T2 with the target fragment sequence of ZMK1 (containing the sequence of SEQ ID No. 1), while keeping the other sequences of the starting vector P1300super-MT1T2 unchanged. The recombinant vector P1300-MT1T2-ZMK1-5 expresses the protein with the amino acid sequence shown in SEQ ID No. 2.
[0040] 3. Escherichia coli transformation culture 50 μl of DH5α Escherichia coli competent cells (Qingke Biotechnology product) were thawed on ice. The recombinant vector P1300-MT1T2-HSP70-5 was added and gently mixed. The mixture was incubated on ice for 30 min. The cells were then heat-shocked at 42°C for 30 s, and the centrifuge tubes were quickly transferred to ice for 2 min. 700 μl of sterile LB liquid medium (antibiotic-free) was added to each centrifuge tube, mixed, and incubated at 37°C, 200 rpm for 1 h to resuscitate the strain. The cells were centrifuged at 5000-6000 rpm for 5 min, and aspirated with some supernatant. The cells were plated (LB solid medium containing 50 μg / ml of KANA antibiotic) and incubated at 37°C for 12-16 h. Single colonies were picked based on colony growth. Colony PCR was performed using the Gel Extraction Kit (Omega, catalog number QYM10016), with the following primers: OsU3-FD3:GACAGGCGTCTTCTACTGGTGCTAC; TaU3-RD: CTCACAAATTATCAGCACGCTAGTC.
[0041] The PCR products were verified by electrophoresis to obtain positive clones. These clones were then selected for culture, and plasmids were extracted using a kit and sent for sequencing. The correctly sequenced plasmid DNA was successfully obtained.
[0042] 4. Agrobacterium-mediated transformation (2-3 days) 1) Thaw 50 μl of EHA105 Agrobacterium competent cells (Qingke Biotechnology product) on ice, add 1-2 μl of plasmid DNA, mix gently, and incubate on ice for 30 min.
[0043] 2) Freeze in liquid nitrogen for 1 minute, heat shock in a 37°C water bath for 5 minutes, and then quickly transfer the centrifuge tube to an ice bath for 2 minutes.
[0044] 3) Add 1 ml of sterile LB liquid medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 28°C and 180 rpm for 3 h to revive the strain.
[0045] 4) Centrifuge at 5000-6000 rpm for 5 minutes, then aspirate a portion of the supernatant and shake.
[0046] 5) Plate coating (LB solid medium, containing 50 ug / ml kana + 40 ug / ml rif) and incubate in the dark at 28℃ for 2-3 days.
[0047] Transformed plants were prepared by transforming the recipient maize B73-329 with Agrobacterium-mediated recombinant plasmid P1300-MT1T2-HSP70-5 in accordance with standard procedures in the field. After screening, culture, sequencing and expression level detection, ZMK1 overexpression lines were finally obtained.
[0048] Example 2: Application of the ZMK1 gene in plant salt tolerance Test samples: ZMK1 overexpression lines, with wild-type B73-329 as the control.
[0049] Four seeds were potted in pure vermiculite without potting soil, and each pot was irrigated with half a corn nutrient solution. After about 7-10 days of growth (three-leaf stage), the corn was irrigated with half a corn nutrient solution containing 100 mM NaHCO3 (salt-alkali stress), once every 7-10 days, two liters per pot each time. The growth of the corn and the degree of yellowing of the leaves were observed after about 30-40 days.
[0050] Each plant is planted in 3 pots.
[0051] The solvent for half of the corn nutrient solution is water, and the solutes and their concentrations are: potassium sulfate (0.75 mM), magnesium sulfate (0.65 mM), calcium nitrate (2 mM), potassium chloride (0.1 mM), potassium dihydrogen phosphate (0.25 mM), zinc sulfate (0.001 mM), manganese sulfate (0.001 mM), copper sulfate (0.0001 mM), ferrous sulfate (0.001 mM), and boric acid (0.001 mM).
[0052] The half-corn nutrient solution containing 100 mM NaHCO3 (salt-alkali stress) is obtained by adding NaHCO3 to half-corn nutrient solution at a concentration of 100 mM.
[0053] The results are as follows Figure 1 As shown, under the condition of 100 mM NaHCO3 treatment, the ZMK1 overexpression line showed a stronger salt-sensitive phenotype than the wild-type B73-329, with more purple leaves and lower plant height.
[0054] The above results indicate that ZMK1 can negatively regulate plant salt and alkali tolerance.
[0055] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of protein ZMK1 or biomaterials related to said protein ZMK1, characterized in that, The application is any one of Y1-Y5: Y1. Application in regulating plant salt and alkali tolerance; Y2. Application in the preparation of products that regulate plant salt and alkali tolerance; Y3. Application in cultivating plants with altered salt and alkali tolerance; Y4. Application in the preparation of products for cultivating plants with altered salt and alkali tolerance; Y5. Applications in plant breeding; The protein ZMK1 is a protein that is, as shown in A1), A2), or A3), the following: A1) The amino acid sequence is that of the protein SEQ ID No:2 in the sequence listing; A2) A protein that has more than 80% identity with and is functionally similar to the protein shown in A1, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No:2 in the sequence listing. A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
2. The application according to claim 1, characterized in that, The plant breeding refers to the selection and breeding of salt-tolerant plant varieties.
3. The application according to claim 1, characterized in that, The biomaterial related to the protein ZMK1 is any one of B1 to B7 below: B1. A nucleic acid molecule encoding the protein ZMK1 described in claim 1; B2, an expression cassette containing the nucleic acid molecule described in B1; B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2; B4. Recombinant microorganisms containing the nucleic acid molecules described in B1, or recombinant microorganisms containing the expression cassette described in B2, or recombinant microorganisms containing the recombinant vector described in B3; B5. Transgenic plant cell lines, transgenic plant tissues, transgenic plant organs, or transgenic plants containing the nucleic acid molecules described in B1.
4. The application according to claim 3, characterized in that, B1) The coding sequence of the nucleic acid molecule is SEQ ID No. 1 in the sequence listing.
5. The application according to any one of claims 1-4, characterized in that, The plant is any one of the following: N1) Monocotyledons; N2) Plants of the order Poales; N3) Gramineae plants; N4) Plants of the genus *Zea*; N5) Corn.
6. The protein as described in claim 1 or the biological material as described in any one of claims 1-4.
7. The biomaterial according to any one of claims 1-5.
8. A method for improving the salt and alkali tolerance of corn, characterized in that, The method includes reducing, inhibiting, or downregulating the expression level of the gene encoding the protein ZMK1 of claim 1 in maize, and / or the activity and / or content of the protein ZMK1 of claim 1, to improve the maize's tolerance to salt and alkali stress.
9. A method for cultivating salt-tolerant maize, characterized in that, The method includes the step of reducing the activity of the protein ZMK1 of claim 1 in the recipient maize or inhibiting the expression of the protein ZMK1 of claim 1 in the recipient maize to obtain salt-tolerant maize; the salt-tolerant maize has a stronger tolerance to salt-alkali stress than the recipient maize.
10. A method for cultivating salt-tolerant maize, characterized in that, The method includes the step of reducing the activity of the protein ZMK1 of claim 1 in the recipient maize or inhibiting the expression of the protein ZMK1 of claim 1 in the recipient maize to obtain salt-tolerant maize; the salt-tolerant maize has a stronger tolerance to salt-alkali stress than the recipient maize.