American pumpkin peel lignin-related KASP molecular marker and application thereof
By developing KASP molecular markers based on BSA pooled sequencing, the operational problems of breeding for pericarp lignin traits in squash were solved, enabling rapid screening and accurate identification of pericarp lignin traits, and improving the storage tolerance and insect resistance of squash.
Patent Information
- Application Number
- CN202511573327.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-31
- Publication Date
- 2026-02-10
AI Technical Summary
Existing technologies lack molecular markers closely linked to the lignin traits of pumpkin pericarp, resulting in weak operability in the breeding of pumpkin pericarp lignin traits and making it difficult to achieve effective auxiliary breeding for storage resistance and insect and disease resistance.
We developed a KASP molecular marker based on BSA pooled sequencing to locate the gene for lignin trait in the pericarp of pumpkin (Cucumis melo var. rubricae). We designed primer combinations for PCR amplification and determined the presence or absence of pericarp lignin by fluorescence signal, thus achieving rapid screening and marker-assisted breeding.
This method enables early screening and accurate identification of lignin traits in the pericarp of pumpkin, aiding in breeding and improving the storage tolerance and insect and disease resistance of pumpkin.
Smart Images

Figure CN121496083A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development for vegetable quality traits and molecular marker-assisted breeding technology. It relates to a KASP molecular marker for the lignin trait of pumpkin pericarp and its application, specifically to the rapid screening of the presence or absence of lignin in pumpkin pericarp and molecular marker-assisted breeding. Background Technology
[0002] American squash ( Cucurbita pepo Pumpkin (Cucurbita spp.) is an important horticultural crop, also known as American squash, and is a species of the genus Cucurbita in the Cucurbitaceae family. A hard pericarp effectively prevents insect and disease infestation and mechanical damage during transportation, and is a crucial factor affecting the fruit quality, shelf life, and storage and transport resistance of American squash. The pericarp hardness of American squash is closely related to the synthesis of secondary cell walls. Plant secondary cell walls are mainly composed of cellulose, lignin, and xylan, and are widely involved in growth, development, and stress responses, playing important roles in processes such as anther dehiscence, providing mechanical support, water transport, and resisting pathogen invasion (Hamant and Traas, 2010; Kesten et al., 2017; Miedes et al., 2014; Xu et al., 2014). The thickness of the secondary cell wall is closely related to the mechanical strength and stress resistance of the plant, with NAC and MYB being the main regulatory factors (Nakano et al., 2015). In squash, NST1 Mutations in this gene can inhibit the development of the secondary cell wall in the seed coat of pumpkin (Lyu et al., 2022). MYB26 acts as the initial switch for the formation of the secondary cell wall in the anther wall, and can be directly regulated... NST1 and NST2 It has an effect on secondary thickening (Yang et al., 2007; 2017).
[0003] Lignin is an important component of plant secondary cell walls, primarily deposited in mechanical, vascular, and protective tissues. Studies have shown that lignin, a component of secondary cell walls, plays a crucial role in the defense against pathogenic microorganisms. When *Pseudomonas yunnanensis* invades soybean, the expression of genes related to lignin synthesis is significantly upregulated. Two laccase genes have been identified in cotton. GhLac1 and GhLac15The lignification of secondary cell walls can enhance cotton's defense against Verticillium wilt (Hu et al., 2018; Zhang et al., 2018). However, the genes regulating the lignin content in the pericarp of pumpkin remain unclear, resulting in a lack of readily operable molecular markers closely linked to pumpkin pericarp lignin traits to aid in breeding programs for pumpkin's storage tolerance, insect resistance, and other quality aspects. Therefore, it is urgent to identify key genes controlling the presence or absence of lignin in pumpkin pericarp and to develop usable functional molecular markers related to pumpkin pericarp lignin. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to address the shortcomings of the prior art by providing a KASP molecular marker for the presence or absence of lignin in the pericarp of pumpkin and its application; the KASP molecular marker CpPL (Peel lignin) is closely linked to the lignin trait in the pericarp of pumpkin, and this molecular marker can be used to identify and screen different pumpkin materials for the presence or absence of lignin in the pericarp and for assisted selection breeding of their offspring.
[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows: In a first aspect, this invention provides a KASP molecular marker for identifying the presence or absence of lignin in the pericarp of different pumpkins, based on BSA pooled sequencing to locate genes for the lignin trait in the pericarp of pumpkins; specifically, it provides a KASP molecular marker for detecting the lignin trait in the pericarp of pumpkins (detecting the presence or absence of lignin in the pericarp of pumpkins), wherein the KASP molecular marker is an SNP marker located at 8697115 bp on chromosome 3 of pumpkin; the 100 bp sequence before and after the molecular marker site is as follows: AAATTATATACTAGTATAGACTCCATAGGTGAATACCTAAATAAAAAAAATGTAGTCAAACGGAGTATAATGGTGAGATCCCACTTCGATTGAAAAAAGAnACGAGTGTCAATGAAGACGCTTGGCTCCGAAAGGGGCTAGATAAACACAACTACTATCATTTTTTTACGCAATTTTCATATATGTAAGATATTTTGGATC The underlined 'n' represents an SNP site (a molecular marker), and the genotype of 'n' is A / T. The phenotype A corresponds to the presence of lignin in the pericarp, while the phenotype T corresponds to the absence of lignin in the pericarp.
[0006] A second aspect of the present invention also provides a primer set for the KASP molecular marker CpPL used to detect the presence or absence of lignin in the pericarp of pumpkin, the primer set comprising: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTAAGCGTCTTCATTGACACTCGTT-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTAAGCGTCTTCATTGACACTCGTA-3' Reverse primer R: 5'-CAAACGGAGTATAATGGTGAGATC-3'.
[0007] In a third aspect, the invention also provides the use of the aforementioned molecular markers for identifying the presence or absence of lignin in the pericarp of pumpkin, and for assisting in the selection and breeding of different pumpkin pericarp lignin materials or their offspring.
[0008] In a specific implementation case, the details are as follows: (1) Extract genomic DNA from the pumpkin sample to be tested; (2) PCR amplification of the obtained genomic DNA using primer combinations; (3) Detect the fluorescence signal of the PCR amplification result to determine the lignin in the pericarp of the American pumpkin to be tested, thereby identifying the homozygous AA genotype (with lignin in the pericarp), homozygous TT genotype (without lignin in the pericarp), and heterozygous A / T genotype (with lignin in the pericarp).
[0009] If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F1, then the tested American pumpkin is homozygous AA genotype, with a phenotype of lignin in the pericarp. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F2, then the tested American pumpkin is homozygous TT genotype, with a phenotype of no lignin in the pericarp. If the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter colors of both the forward primer F1 and the forward primer F2, then it is heterozygous A / T genotype, with a phenotype of lignin in the pericarp.
[0010] A fourth aspect of the present invention also provides a method for identifying single nucleotide polymorphisms linked to lignin traits in the pericarp of pumpkin, comprising the following steps: (1) The American squash material pe1 with lignin in the pericarp and the American squash material pe6 without lignin in the pericarp were used as parents to cross and then self-pollinate to construct the genetic segregating population F2; (2) Genomic DNA was extracted from the seedlings of the American squash parent and the F2 population of hybrid offspring using the CTAB (hexadecyl trimethyl ammonium bromide) method; (3) Use BSA (Bulked Segregant analysis) to locate regions or genes associated with lignin traits in the pericarp of squash.
[0011] (4) Identify single nucleotide polymorphism sequences closely linked to the lignin properties of pumpkin pericarp.
[0012] A fifth aspect of the present invention also provides a method for developing the above-mentioned molecular markers, comprising the following steps: (1) The American squash material pe1 with lignin in the pericarp and the American squash material pe6 without lignin in the pericarp were used as parents to cross and then self-pollinate to construct the genetic segregating population F2; (2) Genomic DNA was extracted from the seedlings of the American squash parent and the F2 population of hybrid offspring using the CTAB (hexadecyl trimethyl ammonium bromide) method; (3) 30 plants each with and without lignin in the pericarp were selected from the F2 population to construct mixed pools with and without lignin in the pericarp. BSA (bulked segregant analysis) was used to locate regions associated with the lignin trait in the pericarp of pumpkin.
[0013] (4) Identify SNP variants and InDel insertion / deletion variants that are closely linked to the lignin traits of pumpkin pericarp.
[0014] (5) Based on linkage variation, KASP (Kompetitive Allele Specific Polymerase Chain Reaction) method was used to screen molecular markers for lignin traits in squash pericarp. (6) A KASP molecular marker CpPL closely linked to the lignin properties of pumpkin pericarp was developed. The KASP molecular marker primer set consists of forward primers F1 and F2 and a reverse primer R. The primer set can be synthesized by Shanghai Sangon Biotech Co., Ltd. and amplified on an ABI Step One PCR instrument.
[0015] In a sixth aspect, the present invention also provides a method for identifying the presence or absence of lignin in the pericarp of pumpkin, specifically: (1) Extract genomic DNA from the pumpkin sample to be tested; (2) The obtained genomic DNA was amplified by PCR using the primer combination described above; (3) Detect the fluorescence signal of the PCR amplification result to determine whether there is lignin in the pericarp of the American pumpkin to be tested. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the forward primer F1, the American pumpkin to be tested is homozygous AA genotype, and the phenotype is that there is lignin in the pericarp. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence linker color of the forward primer F2, the American pumpkin to be tested is homozygous TT genotype, and the phenotype is that there is no lignin in the pericarp. If the fluorescence signal color of the PCR amplification result is different from the fluorescence linker colors of the forward primers F1 and F2, it is heterozygous A / T genotype, and the phenotype is that there is lignin in the pericarp.
[0016] Further, in step (2), after amplification, the fluorescence signal is detected and the genotyping is analyzed. If the genotyping is insufficient, amplification can continue. 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 3 cycles. 30℃, 1 minute (reading the fluorescence signal). Read the fluorescence signal every 3 additional cycles to check the genotyping, until complete genotyping.
[0017] Further, in step (2), the PCR reaction system is as follows: 5.0 μl of 20-50 ng / μl pumpkin genomic DNA, 5.0 μl of KASP Master Mix, 0.14 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio, and the concentration of the three primers is 10 ng / μl), and the total volume is 10.14 μl; The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 35 cycles. 30℃, 1 minute (read fluorescence signal).
[0018] The beneficial effects of this invention are: The KASP molecular marker designed and developed in this invention is closely linked to the lignin properties of the pericarp of pumpkin, which can be used for preliminary screening of materials with or without lignin in the early (seed) pericarp of pumpkin, so as to achieve the purpose of molecular marker-assisted breeding, thereby assisting in the breeding of pumpkin for its storage resistance, insect and disease resistance and other quality. Attached Figure Description
[0019] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0020] Figure 1This is a QTL mapping of major effects of lignin traits in pumpkin pericarp based on BSA.
[0021] Figure 2 This is a typing diagram of CpPL molecular markers in the parental materials pe1 and pe6 and their F1 generation; The genotype of pe1 is AA, which is red; the genotype of pe6 is TT, which is blue; and the genotype of F1 is A / T, which is green.
[0022] Figure 3 This is a partial genotyping diagram of CpPL molecular markers in the F2 generation of hybrid populations of different pericarp lignin-rich squash materials. Red indicates the AA genotype consistent with the pericarp-containing lignin material pe1; blue indicates the TT genotype consistent with the pericarp-free lignin material pe6; and green indicates the A / T genotype consistent with F1.
[0023] Figure 4 This is a statistical graph showing the presence or absence of lignin in the pericarp of different genotypes of Pumpkin F2 segregating populations. Detailed Implementation
[0024] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: The pumpkin germplasm resources used below are all known varieties: PE1 is a type of American squash with lignin in the pericarp; conventional white-skinned zucchini is selected. PE6 is a peelless lignin-type American squash material, using the conventional squash variety (golden thread squash).
[0025] Example 1: QTL mapping of major effects of lignin traits in pumpkin pericarp Parental materials were selected from the germplasm resources of pumpkin (Cucumis melo) in the laboratory. pe1 is a type of pumpkin with pericarp lignin; pe6 is a type of pumpkin without pericarp lignin. After hybridization of the above parents, self-pollination was performed to construct a genetically segregating population F2, obtaining individual plants with different pericarp lignin segregation.
[0026] Genomic DNA was extracted from the leaves of seedlings of the parental pumpkin (Cucumis melo var. pekinensis) and from the F2 population of hybrid offspring using the CTAB (hexadecyl trimethyl ammonium bromide) method. Extreme phenotypic materials from the progeny were selected to construct BSA pools for genome resequencing. Association analysis was performed using the ΔAll-index method, selecting 99% confidence intervals, such as... Figure 1 As shown, it was located in the interval between 8300000 and 9400000 on chromosome 3.
[0027] Example 2: Development of KASP molecular markers for lignin traits in squash pericarp Based on the gene mapping results of Example 1, SNPs and InDels of the parental materials (pe1, pe6) in the chromosome 3 region were extracted and analyzed, and related molecular markers were developed using KASP technology for fine mapping.
[0028] After screening using molecular markers, the KASP molecular marker CpPL, which is closely linked to the lignin trait of pumpkin pericarp, was finally obtained. This molecular marker is an SNP marker, located at position 8697115 bp on chromosome 3 of pumpkin; the 100 bp sequence before and after the marker site is as follows: AAATTATATACTAGTATAGACTCCATAGGTGAATACCTAAATAAAAAAAATGTAGTCAAACGGAGTATAATGGTGAGATCCCACTTCGATTGAAAAAAGA n ACGAGTGTCAATGAAGACGCTTGGCTCCGAAAGGGGCTAGATAAACACAACTACTATCATTTTTTTTACGCAATTTTCATATATGTAAGATATTTTGGATC.
[0029] The underlined 'n' represents the SNP locus, and the genotype of 'n' is A / T. The phenotype A corresponds to the presence of lignin in the pericarp, while the phenotype T corresponds to the absence of lignin in the pericarp.
[0030] The primer combination sequence designed based on molecular markers is as follows: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTAAGCGTCTTCATTGACACTCGTT-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTAAGCGTCTTCATTGACACTCGTA-3' Reverse primer R: 5'-CAAACGGAGTATAATGGTGAGATC-3'.
[0031] Each of the forward primers F1 and F2 has its own fluorescent adapter (displayed as different colors on the genotyping map; in this example, AA genotype is red, TT genotype is blue, and A / T genotype is green). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. For example, homozygous AA genotype can only react with F1, and homozygous TT genotype can only react with F2. Finally, the fluorescence difference is used to distinguish whether the tested material is homozygous AA or TT genotype. If the material being tested is heterozygous, both primers will amplify, producing a different fluorescence signal than homozygous material, thus achieving heterozygous genotype differentiation.
[0032] Specifically: The forward primer for the AA genotype is GAAGGTGACCAAGTTCATGCTAAGCGTCTTCATTGACACTCGTT, therefore it is in red. The forward primer corresponding to the TT genotype is GAAGGTCGGAGTCAACGGATTAAGCGTCTTCATTGACACTCGTA, therefore it is blue. When the tested American pumpkin shows the same color (red) as pe1, it indicates that it is of the AA genotype; When the tested American pumpkin shows the same color (blue) as pe6, it indicates that it is of the TT genotype; When the tested American pumpkin turns green, it indicates that it has the A / T genotype.
[0033] Example 3: Validation of KASP molecular markers for lignin traits in pumpkin pericarp in pumpkin parental materials and F1 progeny. I. DNA Extraction Genomic DNA was extracted from seedlings of American squash parental materials and F1 hybrid offspring seedlings using the CTAB (hexadecyl trimethyl ammonium bromide) method.
[0034] II. PCR Amplification PCR amplification was performed directly on an ABI Step One PCR instrument. The PCR reaction system consisted of: 5.0 μl of 20-50 ng / μl pumpkin genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio, and the primer concentrations designed in all three examples 2 were 10 ng / μl), for a total volume of 10.14 μl. The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, 60 seconds (annealing), 35 cycles. 30℃, 1 minute (read fluorescence signal).
[0035] The instrument can directly obtain genotyping information after detecting fluorescence signals, and the results are as follows: Figure 2 As shown, this molecular marker can clearly differentiate parental materials with different pericarp lignin content, and genotype can be determined based on differences in fluorescence signals. Among them, the American pumpkin material pe1, which contains pericarp lignin, is homozygous for genotype AA. Figure 2 The red coloration is observed in the middle; the pe6 material of the American squash, lacking lignin in the pericarp, is homozygous for genotype TT. Figure 2 The color is blue; the F1 generation from the cross between pe1 and pe6 represents the heterozygous A / T genotype. Figure 2 The color is green. This indicates that the KASP molecular marker CpPL can be used for genotyping of the pericarp-lignin-rich squash material pe1 and the pericarp-free squash material pe6 and their progeny populations.
[0036] Example 4: Validation of KASP molecular markers for lignin traits in squash pericarp in offspring F2 segregating populations I. DNA Extraction Genomic DNA was extracted from seedlings of American squash parental materials and seedlings of the self-pollinated F2 population after hybridization using the CTAB (hexadecyl trimethyl ammonium bromide) method.
[0037] II. PCR Amplification PCR amplification was performed directly on the IntelliQube high-throughput genotyping platform. The PCR reaction system was as follows: 0.8 μl of 10-50 ng / μl pumpkin genomic DNA, 0.8 μl of KASP Master Mix, and 0.02 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio, and the primer concentrations designed in all three examples 2 were 10 ng / μl), for a total volume of 1.62 μl. The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, 60 seconds (annealing), 35 cycles. 30℃, 1 minute (read fluorescence signal).
[0038] The instrument can directly obtain genotyping information after detecting fluorescence signals, and the results are as follows: Figure 3 As shown. Genotyping was performed in the F2 segregating population using CpPL molecular markers, and all F2 plants were fully genotyped. Genotypes of F2 plants were determined based on fluorescence signals: plants with the same red color as the parent pe1 (containing pericarp lignin) had the genotype AA; plants with the same blue color as the parent pe6 (lacking pericarp lignin) had the genotype TT; and plants with the same green color as the F1 generation had the genotype A / T. Figure 4 As shown, analysis of the presence or absence of lignin in the pericarp of F2 individual plants revealed that in the F2 segregating population, AA and A / T genotype plants contained lignin in the secondary cell walls of their pericarp, while TT genotype plants did not. This indicates that the KASP molecular marker CpPL is closely linked to the lignin trait in the pericarp of pumpkin (Cucumis melo var. rubra) and can be used for genotyping different pumpkin pericarp lignin materials.
[0039] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. A KASP molecular marker for detecting lignin properties in the pericarp of pumpkin, characterized in that, The KASP molecular marker is an SNP marker located at 8697115 bp on chromosome 3 of pumpkin. The 100 bp sequences before and after the molecular marker site are as follows: AAATTATATACTAGTATAGACTCCATAGGTGAATACCTAAATAAAAAAAATGTAGTCAAACGGAGTATAATGGTGAGATCCCACTTCGATTGAAAAAAGA n ACGAGTGTCAATGAAGACGCTTGGCTCCGAAAGGGGCTAGATAAACACAACTACTATCATTTTTTTACGCAATTTTCATATATGTAAGATATTTTGGATC。 2. The KASP molecular marker for detecting lignin properties in the pericarp of pumpkin as described in claim 1, characterized in that: The underlined n represents the SNP locus, and the genotype of n is A / T. The phenotype A corresponds to the presence of lignin in the pericarp, while the phenotype T corresponds to the absence of lignin in the pericarp.
3. The KASP molecular marker for detecting lignin properties in the pericarp of pumpkin as described in claim 1 or 2, characterized in that: Primer combinations for detecting the lignin properties of pumpkin pericarp include: Forward primer F1: 5'- GAAGGTGACCAAGTTCATGCTAAGCGTCTTCATTGACACTCGTT-3' Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTAAGCGTCTTCATTGACACTCGTA-3' Reverse primer R: 5'-CAAACGGAGTATAATGGTGAGATC-3'.
4. The use of the KASP molecular marker for detecting the lignin properties of pumpkin pericarp as described in any one of claims 1 to 3, characterized in that: To determine whether lignin is present in the pericarp of pumpkin.
5. The use according to claim 4, characterized in that... Includes the following steps: (1) Extract genomic DNA from the pumpkin sample to be tested; (2) PCR amplification of the obtained genomic DNA using primer combinations; (3) The presence or absence of lignin in the pericarp of the pumpkin to be tested can be determined based on the fluorescence signal of the PCR amplification results, thereby identifying the homozygous AA genotype, homozygous TT genotype, and heterozygous A / T genotype.
6. The use according to claim 5, characterized in that... Step (3) is as follows: If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F1, then the tested American pumpkin is homozygous AA genotype. If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the forward primer F2, then the tested American pumpkin is homozygous TT genotype. If the fluorescence signal color of the PCR amplification result is different from the fluorescence adapter color of the forward primer F1 and forward primer F2, then the tested American pumpkin is a heterozygous A / T genotype.
7. The use according to claim 6, characterized in that: The phenotype of homozygous AA genotype is characterized by the presence of lignin in the pericarp; The phenotype of homozygous TT genotype is that the pericarp lacks lignin; The phenotype of the heterozygous A / T genotype is that the pericarp contains lignin.
8. The use according to claim 6 or 7, characterized in that: The PCR amplification reaction system was as follows: 5.0 μl of 20-50 ng / μl pumpkin genomic DNA, 5.0 μl of KASP Master Mix, 0.14 μl of KASP Assay Mix (F1:F2:R = 2:2:5 volume ratio, all three primers were 10 ng / μl), for a total volume of 10.14 μl. The PCR reaction program was as follows: 30℃ for 1 minute, then read the fluorescence signal; 94℃ for 15 minutes pre-denaturation; 94℃ for 20 seconds denaturation; 61℃, -0.6℃ / cycle, annealing for 60 seconds, 10 cycles; 94℃ for 20 seconds denaturation; 55℃ for 60 seconds annealing, 35 cycles; 30℃ for 1 minute, then read the fluorescence signal.