SNP molecular marker closely linked with purple leaf character of sweet potato and KASP primer

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker capable of identifying the character of a purple leaf of a sweet potato, a KASP primer and a use method, and belongs to the technical field of biology, the molecular marker can realize stable and accurate typing in an F1 segregation population and the like, and the typing result is highly consistent with the phenotype of the purple leaf. The application of the KASP marker can realize early-stage, high-throughput and low-cost identification of the purple leaf character of the sweet potato, and has important significance for cultivating a functional leaf vegetable type sweet potato variety with high nutritional value and improving the molecular breeding level of the sweet potato.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a SNP molecular marker closely linked to the purple leaf trait of sweet potato, a KASP primer and a use method. BACKGROUND

[0002] Sweet potato is an important food and vegetable crop in the world. However, it is a homologous allohexaploid crop that is propagated asexually, and has characteristics such as a large genome, high heterozygosity and a complex genetic background, which leads to slow progress in molecular biology research and breeding technology, far behind major diploid crops such as rice and corn. This complexity makes it particularly important and challenging to develop efficient and reliable molecular markers suitable for sweet potato. In sweet potato, the first generation (such as RAPD) and the second generation (such as SSR) of molecular markers that were widely used in the early stage have been difficult to meet the needs of modern high-precision and high-efficiency breeding due to their low throughput, poor polymorphism or low degree of automation. With the development of sequencing technology, the third generation of molecular markers based on single nucleotide polymorphism has become the mainstream. SNP markers are widely distributed in the genome, have high density and good genetic stability, and are more directly associated with phenotypic traits, providing a new breakthrough for genetic research of complex genomes such as sweet potato. Although SNP markers have obvious advantages, the choice of their genotyping technology directly affects the breadth of application. Among the many SNP genotyping technologies, competitive allele-specific PCR technology has a significant cost advantage compared to TaqMan and other methods that require custom site-specific probes, because it uses a universal fluorescent reporter system. At the same time, it has high accuracy and high throughput characteristics, making it very suitable for genotype screening of large-scale breeding populations. Unfortunately, this effective and trait-specific marker is particularly scarce in sweet potato.

[0003] Currently, the reported molecular markers of sweet potato purple traits are all focused on the anthocyanin content of tubers, and there is no available co-segregation marker for the leaf purple trait, which is important for indicating breeding practice, and it is impossible to achieve early selection. This trait is not only rich in high-value antioxidant components, but also a dominant morphological marker that can be identified at the seedling stage, with great breeding potential. However, its practical application faces double challenges: in terms of phenotype, it is deeply affected by the development conversion of "young leaf purple, mature leaf green" and environmental factors, resulting in a narrow window for traditional visual selection and a high misjudgment rate; in terms of genetics, due to the complexity of the sweet potato hexaploid genome, the purple trait may be controlled by multiple loci, and the relationship between dominance and recessiveness is easily modified in a hybrid background, causing a serious disconnection between phenotype and true genetic composition. Therefore, the development of a specific KASP marker that can be stably and accurately typed at the seedling stage (including the cotyledon stage) has become an urgent need to break through the breeding bottleneck of purple leaf traits and fill the technical gap in this field.

[0004] According to the results of extensive literature and patent database retrieval, there are relatively few functional molecular markers developed for important traits of sweet potato at present, and there is no relevant report on single nucleotide polymorphism molecular markers based on competitive allele-specific PCR typing technology for the assisted selection of the purple leaf trait of sweet potato. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a SNP molecular marker associated with the purple leaf trait of sweet potato and a KASP primer thereof.

[0006] The technical solution of the present application is a KASP primer group, which is composed of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 3.

[0007] A kit containing the KASP primer group described above.

[0008] The KASP primer group or kit described above is applied to the assisted breeding or identification of the leaf color trait of sweet potato.

[0009] Further, the genomic DNA of a sweet potato sample is amplified using the KASP primer group or kit, and genotyping is performed, and according to the genotyping results, if it is a CT heterozygous type, the leaf of the sweet potato sample is purple, and if it is a TT homozygous type, the leaf of the sweet potato sample is green.

[0010] The application of the SNP molecular marker in the assisted breeding or identification of the leaf color trait of sweet potato, the SNP molecular marker is located at the position of 23643389bp of chromosome 12 of sweet potato, the reference gene is located at the 141th base of the nucleotide shown in SEQ ID No. 6 in the version of Ipomoea trifida (NSP306) Genome Assembly (v3), the position base has C / T polymorphism, when the genotype is CT heterozygous type, the leaf of sweet potato is purple, and when the genotype is TT homozygous type, the leaf of sweet potato is green.

[0011] Compared with the prior art, the present application has the following beneficial effects:

[0012] The present application firstly analyzes a genetic segregation population constructed by pure purple leaf material through extreme pool genome sequencing technology, identifies a SNP site co-segregated with sweet potato purple leaf trait. Further, a molecular marker primer specific to KASP platform is designed for the site. The marker can realize stable and accurate typing in F1 segregation population, etc., and the typing result is highly consistent with the purple leaf phenotype. The KASP marker can be used for early, high-throughput and low-cost molecular marker assisted selection of sweet potato purple leaf trait, and applied to the breeding and variety purity identification of high anthocyanin content leafy sweet potato varieties. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 Table 1: Typing results of KASP primer pair on test population materials. DETAILED DESCRIPTION

[0014] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0015] Example 1: Screening of target SNP site and KASP primer design

[0016] (1) Genetic population and extreme pool construction: The present application uses a stable hereditary sweet potato material as the female parent, which is a whole plant purple material. During the entire growth period, all aboveground tissues such as stems, petioles and leaves of the material show stable and uniform deep purple. Since sweet potato is self-incompatible and inter-specific hybridization is difficult, a single male parent cannot be specified in this study. Therefore, the purple female parent is used for open pollination with a mixed pollen population in the field to construct an F1 genetic segregation population. In the population, extreme purple leaf single plants and extreme green leaf single plants with consistent phenotypes are selected, and DNA is extracted and mixed equally to construct a purple leaf pool (purple pool) and a green leaf pool (green pool).

[0017] (2) Pool sequencing and association analysis: High-throughput sequencing is performed on the two extreme pools and the purple female parent. The obtained sequencing data is compared with the Ipomoea trifida (NSP306) Genome Assembly (v3) reference genome (https: / / sweetpotato.uga.edu / download_v3 / ), the sequencing data is quality controlled, and high-quality SNP sites are screened out. On this basis, SNP sites with heterozygous genotypes in the purple pool and homozygous genotypes in the green pool are further screened out. By analyzing the distribution of these sites on the genome, the genomic region where the candidate sites are significantly enriched is located, and combined with gene annotation information, the core candidate SNP site associated with the purple leaf trait is finally determined.

[0018] One of the best effective SNP sites was screened from the above candidate sites: the SNP site is located at the position of 23643389 of Chr12 of Ipomoea trifida (NSP306) Genome Assembly (v3) genome, and is located at the 141st base of the nucleotide sequence shown in SEQ ID No. 6. The genotype of the SNP site is completely linked with the leaf color trait: the genotype of the purple female parent and all purple leaf individuals is C / T heterozygous, and the genotype of all green leaf individuals is T / T homozygous. In the purple leaf pool, the proportion of reference base (C) to variant base (T) in the sequencing reads of the site is about 1:5; in the purple female parent, the proportion is about 1:4.

[0019] (3) KASP primer design: according to the flanking sequence, primer3plus primer design software is used to design specific upstream primers (F1, F2) for two alleles of the SNP and a universal downstream primer (R).

[0020] F1: TCATCTGAATCAGGGCACGAC (SEQ ID No. 1)

[0021] F2: TCATCTGAATCAGGGCACGAT (SEQ ID No. 2)

[0022] R: TCATCCTTTGGTGGTTGCTG (SEQ ID No. 3)

[0023] Example 2 Synthesis of KASP molecular marker primer

[0024] The specific KASP primer designed in Example 1 is added with a probe sequence recommended in the KASP reagent instruction at the 5' end of the forward primer. The specific processing method is as follows: the sequence GAAGGTGACCAAGTTCATGCT is added at the 5' end of the F1 sequence, and the sequence GAAGGTCGGAGTCAACGGATT is added at the 5' end of the F2 sequence. The primer is synthesized by Shanghaigene Biotechnology Co., Ltd.

[0025] KASP-F1: GAAGGTGACCAAGTTCATGCTTCATCTGAATCAGGGCACGAC (SEQ ID No. 4)

[0026] KASP-F2: GAAGGTCGGAGTCAACGGATTTCATCTGAATCAGGGCACGAT (SEQ ID No. 5)

[0027] KASP-R: TCATCCTTTGGTGGTTGCTG

[0028] Example 3: KASP molecular marker verification

[0029] (1) Material preparation: Collect 120 tender leaves, the composition of which is as follows:

[0030] 1) F1 segregating population: The whole plant is purple and the trait is stable, which is used in this invention as the purple maternal parent. It is obtained by open pollination (mixed pollen, and it is impossible to specify a single male parent); the leaf color of the offspring plants is purple-green segregated and there is no bloodline duplication, which is used to verify the co-segregation of markers.

[0031] 2) Green control material: Sweet potato plants with consistently green leaf color observed over many years were used as homozygous background controls.

[0032] (2) DNA extraction: Take 2g of fresh young leaves, grind them into a fine powder with liquid nitrogen, and then preheat to 65℃ to extract DNA from the test material using the CTAB method. Dissolve the DNA in 1×TE solution. Add RNase to a final concentration of 100μg / μl. Perform 1% agarose gel electrophoresis at a constant voltage of 100 V for 30 minutes to detect DNA concentration and quality.

[0033] (3) PCR amplification and genotyping analysis, the specific methods are as follows:

[0034] The reaction system is as follows:

[0035]

[0036] PCR amplification conditions are as follows:

[0037]

[0038] The PCR reaction and result detection and analysis of this invention were performed on a water bath PCR instrument and a high-speed fluorescence scanner produced by Chengdu Hanchen Guangyi Biotechnology Co., Ltd.

[0039] (4) Genotyping of amplification products: High-speed fluorescence scanner and data analysis software (Chengdu Hanchen Guangyi Technology Co., Ltd.) were used to scan and analyze the primer PCR amplification products of 120 materials. The genotyping results are shown below (primer scanning genotyping results are shown below). Figure 1 (As shown in the image). The results show that KASP genotyping clearly divided all tested materials into two genotype clusters. The genotype cluster located between the FAM and HEX channels is C / T heterozygous, corresponding to the purple leaf phenotype; the genotype cluster located in the HEX channel is T / T homozygous, corresponding to the green leaf phenotype. The genotyping results were completely consistent with the actual phenotypes observed in the field, proving that this marker can accurately distinguish the genotypes of the purple leaf trait in sweet potatoes.

Claims

1. A KASP primer set, characterized in that, The primer set consists of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No.

3.

2. A kit containing the KASP primer set of claim 1.

3. The application of the KASP primer set according to claim 1 or the kit according to claim 2 in the auxiliary breeding or identification of sweet potato leaf color traits.

4. The application according to claim 3, characterized in that, The genomic DNA of sweet potato samples was amplified and genotyped using the KASP primer set or kit. Based on the genotyping results, if the sample was CT heterozygous, the leaves of the sweet potato sample were purple; if the sample was TT homozygous, the leaves of the sweet potato sample were green.

5. Application of SNP molecular markers in the assisted breeding or identification of sweet potato leaf color traits. The SNP molecular marker is located at position 23643389bp on sweet potato chromosome 12, with the reference gene being version Ipomoea trifida (NSP306) GenomeAssembly (v3), located at base 141 of the nucleotide shown in SEQ ID No.

6. This position exhibits C / T polymorphism. When the genotype is CT heterozygous, the sweet potato leaves are purple; when the genotype is TT homozygous, the sweet potato leaves are green.

Images