SNP (Single Nucleotide Polymorphism) site combination and application thereof in improving quality traits of recurrent selection population of cotton

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) site combination and an application of the SNP site combination in improving the quality character of a recurrent selection group of cotton. The SNP site combination comprises any combination of SNP sites FL-FS-A101, FL-D021, FL-A071, FM-A101, FM-LP-D031, FM-D061, FS-A072, FS-D021, FS-A133 and MSA09. The SNP site combination provided by the invention can be used for cotton quality character prediction and screening identification, fertility site molecular detection is added in cotton whole-genome assisted recurrent selection breeding to assist directional quality genetic improvement of cotton germplasm resources and high-quality cotton breeding, and the SNP site combination has the advantages of high efficiency, accuracy, simplicity and convenience in operation, wide application, low cost and the like, and has a wide application prospect. The method can significantly improve the efficiency and accuracy of cotton fiber quality improvement, has a wide application prospect, shows a detection result in the form of DNA, can detect each tissue and development stage of cotton, is not limited by the environment and seasons, does not have the influence of expression or not, does not need to analyze the length of a fragment, only needs to analyze the variation of SNP, and has a wide application prospect. The method is suitable for rapid, high-throughput and automatic screening.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and crop genetics and breeding technology, specifically relating to a combination of SNP loci and its application in improving the quality traits of cotton recurrent selection populations. Background Technology

[0002] The fiber quality parameters of cotton directly determine the raw material processing performance and end-product quality of the textile industry. In crop genetic improvement systems, variety trait optimization is the most cost-effective way to improve yield potential and the synergistic expression of agronomic traits. With the technological iteration of the textile industry and the upgrading of consumer demand, the relatively backward fiber quality of upland cotton has become a key bottleneck restricting the industry's development. Given the core influence of fiber characteristics on yarn quality, genetic manipulation of fiber development-related traits has become a key target of modern breeding technology systems. Cotton fiber quality traits include the average length of the upper half of the fiber, strength, fineness, elongation, uniformity, and maturity. These traits are controlled by multiple genes and are easily affected by environmental factors. Traditional breeding methods for improving cotton fiber quality have disadvantages such as long cycles, low efficiency, high costs, and great susceptibility to environmental influences. In order to accelerate the breeding of high-yield, high-quality, and multi-resistant new cotton varieties, molecular marker-assisted selection can significantly improve selection efficiency.

[0003] SNPs (Single Base Nodules) are variations in a single base in the genome, widely distributed in crop genomes. They are important molecular markers for studying genetic diversity and trait associations. SNP microarray technology typically contains hundreds of thousands of SNP loci, enabling the simultaneous detection of multiple SNPs and providing efficient and accurate data for crop breeding and genetic research. SNPs have a low mutation rate and are more stable than other molecular markers (such as STRs). SNPs are suitable for high-throughput automated analysis, enabling rapid processing of large numbers of samples, which gives them a significant advantage in large-scale genetic analysis, especially for large-scale breeding projects. With technological advancements, the cost of SNP detection has gradually decreased, making its application more widespread in various species.

[0004] SNP markers are widely used in crop molecular breeding. Compared with whole-genome sequencing, SNP markers can not only be used for genetic diversity analysis of crop germplasm resources, but also for detecting SNP variations associated with specific traits, such as the average length and strength of the upper half of fibers. By rapidly screening SNPs associated with target traits, selection efficiency can be significantly improved, the breeding process of new varieties can be accelerated, and the breeding cycle can be significantly shortened. SNP markers provide basic data for genomic selection and improve selection efficiency by predicting individual traits.

[0005] SNP combinatorial analysis represents a shift from a "single-gene" model to a "genome network-complex trait" research paradigm. It is a crucial tool in genomics and biobreeding research, offering significant advantages over single SNP analysis. Combining multiple SNPs can reveal interactions between genes that are often overlooked in single SNP analyses. By weighting and combining the effect sizes of multiple SNPs, more comprehensive crop phenotypic prediction models can be constructed.

[0006] With the development of molecular biology techniques, SNP markers have been widely applied in plant genetic mapping, gene localization, and marker-assisted breeding due to their advantages such as wide distribution, large number, and ease of detection. Microarray or sequencing technologies can rapidly identify individual plants with target trait loci during the seedling stage, and hybridization during the flowering stage can purposefully aggregate multiple target gene loci onto a single plant in a recurrent population. However, there are currently few SNP locus combinations for detecting and improving cotton quality traits. Therefore, we present an SNP locus combination and its application in improving the quality traits of cotton recurrent selection populations. Summary of the Invention

[0007] The purpose of this invention is to provide a combination of SNP sites and its application in improving the quality traits of cotton recurrent selection populations.

[0008] The present invention achieves the above objectives through the following technical solutions: This invention provides a combination of SNP sites, which includes any combination of SNP sites FL-FS-A10_1, FL-D02_1, FL-A07_1, FM-A10_1, FM-LP-D03_1, FM-D06_1, FS-A07_2, FS-D02_1, FS-A13_3 and MS_A09. The base sequences of these SNP sites are shown in Table 1. Table 1. SNP loci information related to cotton quality traits and fertility. ; The locations of the above SNP sites are based on cotton chromosomes A07, A09, A10, A13, D02, D03, and D06 in genome version number Gossypium_hirsutum / ZJU-TM-1_V2.1.

[0009] This invention also provides an application of the SNP site combination described above in improving the quality traits of cotton recurrent selection populations. When cotton plants have grown 2-3 true leaves, samples are taken to detect cotton fertility-related SNP sites and cotton fiber quality-related SNP sites in order to screen and obtain fertile individual plants with good cotton quality traits. When the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is homozygous C / C, the fertility of that single plant is fertile; when the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is heterozygous C / T, the fertility of that single plant is sterile.

[0010] As a further optimization of the present invention, the cotton quality traits include the average length of the upper half of the fiber, the fiber breaking strength, and the fiber micronaire value.

[0011] As a further optimization of the present invention, the SNP site combination: FL-FS-A10_1, FL-D02_1, FL-A07_1 is used for early prediction and screening of the average length trait of the upper half of cotton fibers. The SNP locus combination: FM-A10_1, FM-LP-D03_1, FM-D06_1, is used for early prediction and screening of cotton fiber micronaire value traits. The SNP locus combination: FS-A07_2, FS-D02_1, FS-A13_3, is used for early prediction and screening of cotton fiber breaking strength trait. The SNP locus, MS_A09, is used for early prediction and screening to identify cotton fertility traits.

[0012] As a further optimization of the present invention, the nucleotide sequences of the above-mentioned SNP site combinations are as shown in SEQ ID NO. 1-20: (1) The nucleotide sequence of the SNP site FL-FS-A10_1 is shown below: SEQ ID NO.1: F: TTCCATCTCTTCAATGCAATCAAAGATAT; SEQ ID NO.2: R: GGCTGCATGATTCTAGTTTGTATGG; (2) The nucleotide sequence of SNP site FL-D02_1 is shown below: SEQ ID NO.3: F:AAACCCTAAACCTAAACTACAAACCC; SEQ ID NO.4: R: TACTATAATTGGAGCACTCTAATTACCGA; (3) The nucleotide sequence of SNP site FL-A07_1 is shown below: SEQ ID NO.5: F: AGCATTAAGAAGATTTTCTCTAAATCTTACT; SEQ ID NO.6: R:ACATCAGAAATATTGAAATTCTAATCGATGAT; (4) The nucleotide sequence of SNP site FM-A10_1 is shown below: SEQ ID NO.7: F: GAGTTTGTGAAAATATGTCCAGTAGACA; SEQ ID NO.8: R:TTGGGAAAAAAAAGAGTTTGTCCCT; (5) The nucleotide sequence of SNP site FM-LP-D03_1 is shown below: SEQ ID NO.9: F:TCCTTATCCCTAGGCCATTACTG; SEQ ID NO.10: R: GACTTTAGGGGTTTTGGGGG; (6) The nucleotide sequence of SNP site FM-D06_1 is shown below: SEQ ID NO.11: F:ACCCATACCCCTACCTTTTTTATAGTC; SEQ ID NO.12: R:ATAGTAAAACGGGTTTTTTAGACCAGT; (7) The nucleotide sequence of SNP site FS-A07_2 is shown below: SEQ ID NO.13: F: GTTCGATCGCAATGGGAACTTGA; SEQ ID NO.14: R:ACCTTTCCGTCACGATCTAGAAT; (8) The nucleotide sequence of SNP site FS-D02_1 is shown below: SEQ ID NO.15: F: ATAAAGGCATAACGTTAGTAGGTGC; SEQ ID NO.16: R: AGAGAAAAGAGAGAAATCCTCGAGAC; (9) The nucleotide sequence of SNP site FS-A13_3 is shown below: SEQ ID NO.17: F: TTGGGTTTTAAACTGTTCATGTGAG; SEQ ID NO.18: R: ATGTTTTTGGAGGAGGAGGAGA; (10) The nucleotide sequence of SNP site MS_A09 is shown below: SEQ ID NO.19: F: CTAGACTTCTCTGCCTTCTTTGGT; SEQ ID NO. 20: R:GGAGACCATGTCTGAAGAAGAGAA.

[0013] The beneficial effects of this invention are as follows: 1) The SNP locus combinations provided by this invention can be used for cotton quality trait prediction and screening identification. In addition, it adds molecular detection of fertility loci in cotton whole-genome assisted recurrent selection breeding, assisting in the directional genetic improvement of cotton germplasm resources and the breeding of high-quality cotton. It has the advantages of high efficiency, accuracy, simple operation, wide application and low cost. It can significantly improve the efficiency and accuracy of cotton fiber quality improvement and has broad application prospects. The detection results are expressed in the form of DNA and can be detected in various tissues and developmental stages of cotton. It is not limited by the environment and season, and is not affected by issues such as expression. It does not require analysis of fragment length, but only analysis of SNP variation. It is suitable for rapid, high-throughput and automated screening.

[0014] 2) The SNP site combination provided by this invention has detection results directly expressed in the form of DNA. It can be detected in various tissues and developmental stages of cotton, is not limited by environment and season, and is not affected by issues such as expression or non-expression. It does not require analysis of fragment length, but only analysis of SNP variation, making it suitable for rapid, high-throughput, and automated screening. Attached Figure Description

[0015] Figure 1 This is a map showing the distribution of SNP sites on chromosomes.

[0016] Figure 2 This is a cumulative plot of random SNP sites along the average length of the upper half of cotton fibers. In the plot, the horizontal axis represents the average length of the upper half of the fiber (ranging from 20 to 40 mm), and the vertical axis represents different SNP sites and combinations of SNP sites. Each combination is followed by the corresponding sample size n.

[0017] Figure 3 This is a cumulative plot of random SNP sites for the micronaire value of cotton fiber. In the plot, the horizontal axis represents the micronaire value of fiber (range 1-6), and the vertical axis represents different SNP sites and combinations of SNP sites. The corresponding sample size n is marked after each combination. Figure 4 This is a cumulative plot of random SNP sites for cotton fiber breaking strength. In the plot, the horizontal axis represents the fiber breaking strength (range 10-50 cN / dtex), and the vertical axis represents different SNP sites and combinations of SNP sites. The corresponding sample size n is marked after each combination. Figure 5This is a cumulative plot of specific SNP sites on the average length of the upper half of cotton fibers. In the plot, the horizontal axis represents the average length of the upper half of the fiber (ranging from 20 to 40 mm), and the vertical axis represents different SNP sites and combinations of SNP sites. Each combination is labeled with the corresponding sample size n.

[0018] Figure 6 A cumulative plot of specific SNP sites for cotton fiber micronaire value. In the plot, the horizontal axis represents the fiber micronaire value (range 1-6), and the vertical axis represents different SNP sites and SNP site combinations. The corresponding sample number n is marked after each combination. Figure 7 This is a cumulative plot of specific SNP sites for the specific breaking strength of cotton fibers. In the plot, the horizontal axis represents the specific breaking strength of the fibers (range 10-50 cN / dtex), and the vertical axis represents different SNP sites and combinations of SNP sites. The corresponding sample number n is marked after each combination. Detailed Implementation

[0019] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0020] 1. Materials The experimental materials in this study were constructed by backcrossing 12 core upland cotton germplasms as the backbone parents of recurrent selection and the single-gene dominant nuclear male sterile material "Shida 98-6A" as the female parent (Li Jianbin. Establishment of a molecular recurrent selection breeding system for cotton based on dominant nuclear male sterility [D]. Shihezi University, 2024. DOI:10.27332 / d.cnki.gshzu.2024.001706.).

[0021] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0022] 2. Method 2.1 Construction of cotton SNP loci combinations SNP loci were collected from literature and reported cotton fiber quality trait SNP loci were used to construct SNP loci combinations from cotton microarrays.

[0023] 2.2 Cotton DNA Extraction (1) Field sampling was conducted based on the constructed cotton breeding population. To ensure the quality of library construction, the genomic DNA was tested using the following methods. Library construction was carried out after the samples were qualified. The qualified samples were: 1) Agarose gel electrophoresis showed that the main band of genomic DNA was complete and clear, and there was no degradation or RNA contamination; 2) Nanodrop detection showed that the OD260 / 280 ratio was between 1.8 and 2.2, and there was no protein or visible impurity contamination; 3) Qubit3.0 detection showed that the concentration was greater than 20 ng / μl and the total amount was greater than 2 μg. (2) After the sample genomic DNA is qualified, the library is constructed according to the targeted sequencing experimental procedure. The main experimental steps are as follows: 1) Design and synthesize primers according to the experimental purpose and site information, and then mix the primers; 2) Use genomic DNA as a template to amplify the target site with KAPA2G Fast Multiplex Mix; 3) Add sequencing adapters through secondary PCR; 4) Pool all products and purify them with AMPure XP Beads. (3) Library quality control After the library is constructed, its quality is tested. Only after the test results meet the requirements can it be sequenced. The test methods are as follows: 1) Use Qubit3.0 for preliminary quantification; 2) Use Agilent2100 to test the insert size of the library. Only after the insert size meets the expectations and there is no adapter contamination can the next experiment be carried out; 3) Use the German ANALYTIKJENA QTOWER real-time fluorescence quantitative PCR instrument to accurately quantify the effective concentration of the library. That is, the effective concentration > 2nM is a qualified library.

[0024] (4) The library was pooled according to the target amount of data to be sequenced, and the paired-end 150bp (PE150) sequencing was performed using the Illumina HiSeq platform.

[0025] 2.3 Sequencing Analysis The PCR amplification products were sequenced, and the genotypes of SNP loci were analyzed. Based on the association between genotypes and fiber quality traits, the quality traits of cotton fibers were predicted. In this invention, the fiber quality phenotypes of fertile plants in each round of selection were evaluated, and the "superior" genotypes of individual plants and corresponding trait loci in the population were combined with the quality data of individual plants to analyze the combined loci.

[0026] (1) Randomly selected SNP sites related to the average length of the upper half of the fiber: FL-A11_1, FL-A10_1, FL-FS_A10_1; Single SNP sites: FL-A11_1, FL-A10_1, FL-FS_A10_1; SNP combination sites: FL-A11_1+FL-A10_1, FL-FS_A10_1+FL-A11_1, FL-FS_A10_1+FL-A10_1, FL-A11_1+FL-A10_1+FL-FS_A10_1. The SNP site information related to the average length of the upper half of cotton fiber is shown in Table 2. Table 2. SNP site information related to the average length of the upper half of cotton fibers. ; Notes: FL (Fiber Length) is the average length of the upper half of the fiber; FS (Fiber Strength) is the fiber breaking strength; FM (Fiber Micronaire) is the micronaire value. Experimental conclusions: such as Figure 2 As shown, the average length of the upper half of cotton fibers at single SNP sites FL-A11_1, FL-A10_1, and FL-FS_A10_1 is 30-31 mm, which belongs to medium-staple cotton. The average length of SNP combination sites FL-A11_1+FL-A10_1, FL-FS_A10_1+FL-A11_1, FL-FS_A10_1+FL-A10_1, and FL-A11_1+FL-A10_1+FL-FS_A10_1 is also 30-31 mm, which also belongs to medium-staple cotton. This indicates that there is no correlation between random SNP combination sites and the average length phenotype of the upper half of cotton fibers.

[0027] (2) Randomly selected SNP sites related to fiber micronaire value: FM-A08_1, FM-A11_1, FM-LP-D05_1; Single SNP sites: FM-A08_1, FM-A11_1, FM-LP-D05_1; SNP combination sites: FM-A08_1+FM-A11_1, FM-A08_1+FM-LP-D05_1, FM-A11_1+FM-LP-D05_1, FM-A08_1+FM-A11_1+FM-LP-D05_1. The SNP site information related to cotton fiber micronaire value is shown in Table 3. Table 3. SNP loci information related to micronaire value of cotton fibers ; Experimental conclusions: such as Figure 3As shown, the fibrinologon values ​​of single SNP sites FM-A11_1 and FM-LP-D05_1 are in the range of 3.7-4.2, which belongs to the A-level standard. The fibrinologon values ​​of SNP combination sites FM-A08_1+FM-A11_1, FM-A08_1+FM-LP-D05_1, FM-A11_1+FM-LP-D05_1, and FM-A08_1+FM-A11_1+FM-LP-D05_1 are in the range of 4.2-5.0, which belongs to the B2-level standard. This indicates that random SNP combination sites cannot make the fibrinologon value reach the A-level range.

[0028] (3) Randomly selected SNP sites related to fiber breaking strength: FS-A13_2, FS-D05_2, FS-D07_1; single SNP sites: FS-A13_2, FS-D05_2, FS-D07_1; SNP combination sites: FS-D07_1+FS-A13_2, FS-A13_2+FS-D05_2, FS-D05_2+FS-D07_1, FS-A13_2+FS-D05_2+FS-D07_1. The SNP site information related to cotton fiber breaking strength is shown in Table 4. Table 4. SNP site information related to cotton fiber breaking strength. ; Experimental conclusions: such as Figure 4 As shown, the fiber breaking strength of single SNP sites FS-A13_2, FS-D05_2, and FS-D07_1 ranges from 29 to 31, indicating strong fiber breaking strength. Similarly, the fiber breaking strength of SNP combination sites FS-D07_1+FS-A13_2, FS-A13_2+FS-D05_2, FS-D05_2+FS-D07_1, and FS-A13_2+FS-D05_2+FS-D07_1 also ranges from 29 to 31, indicating strong fiber breaking strength. This data demonstrates that there is no significant difference in the fiber breaking strength values ​​between randomly selected site combinations and single SNP sites, suggesting that this SNP combination site is not significantly correlated with the cotton fiber breaking strength phenotype.

[0029] 2.4 Investigating the effects of specific SNP locus combinations on cotton quality traits To investigate the effects of specific SNP combinations on cotton quality traits, the following steps were taken: Step 1: Screening for loci in fertile plants associated with the average length of the upper half of the fiber, fiber micronaire value, and fiber breaking strength; among them, the fertility results of some individual plants in the population (based on the genotype of the MS_A09 locus) are shown in Table 5: Table 5 Record of Fertility Results of Individual Plants in the Population ; Specifically, when the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is homozygous C / C, the fertility of that single plant is fertile; when the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is heterozygous C / T, the fertility of that single plant is sterile. Step 2: Determine and calculate the average length of the upper half of the fiber, fiber micronaire value, and fiber breaking strength of the fertile single plant corresponding to the "superior" genotype at each quality locus. Step 3: Use R language to calculate the average upper fiber length, fiber micronaire value, and average fiber breaking strength of the fertile individual plants corresponding to all quality-related site combinations. Step 4: Through the above steps, we can obtain the average length of the upper half of the fiber, the fiber micronaire value, and the average fiber breaking strength of the fertile single plants corresponding to all site combinations. From all the listed site combinations, we can screen out the site combinations with significant site cumulative effect.

[0030] To investigate the effects of specific SNP locus combinations on cotton quality traits, SNP loci related to the average length of the upper half of the fiber, the fiber breaking strength, and the fiber micronaire value were selected to construct multi-SNP locus combinations. Phenotypic analysis was then performed on the average length of the upper half of the cotton fiber, the fiber breaking strength, and the fiber micronaire value.

[0031] Single SNP sites: FL-FS-A10_1, FL-D02_1, FM-A10_1, FM-LP-D03_1, FM-D06_1, FS-A07_2, FS-D02_1, FS-A13_3; and SNP site combinations: FL-FS-A10_1+FL-D02_1, FL-FS-A10_1+FL-D02_1+FL-A07_1, FM-A10_1+FM-D06_1, FM-LP-D03_1+FM-D0 The effects of SNP combinations 6_1, FM-A10_1+FM-LP-D03_1, FM-A10_1+FM-LP-D03_1+FM-D06_1, FS-A07_2+FS-A13_3, FS-D02_1+FS-A13_3, and FS-D02_1+FS-A07_2+FS-A13_3 on cotton quality traits differ, reflecting the association between specific SNP combinations and cotton fiber quality phenotypic traits. Information on SNP sites related to cotton quality traits is shown in Table 6. Table 6. SNP loci information related to cotton quality traits and fertility. ; Experimental conclusions: such as Figure 5 As shown, this figure illustrates the effect of specific SNP locus combinations on the average length of the upper half of cotton fibers. The horizontal axis represents the average length of the upper half of the fiber (in millimeters), and the vertical axis lists specific SNP locus combinations, including FL-FS-A10_1, FL-D02_1, and their various combinations, such as FL-FS-A10_1+FL-D02_1, FL-FS-A10_1+FL-D02_1+FL-A07_1 (single plants with only the FL-A07_ locus combination). Each combination is followed by the corresponding sample size n. Figure 2 It can be seen that the average length of the upper half of cotton fibers from single SNP sites FL-FS-A10_1 and FL-D02_1 ranges from 29 to 30 mm, belonging to medium-staple cotton. The average length of the upper half of cotton fibers from the combination of multiple SNP sites FL-FS-A10_1+FL-D02_1+FL-A07_1 is 32.3 mm, belonging to medium-long-staple cotton. There are significant differences in the range of average length of the upper half of cotton fibers from different SNP site combinations, indicating that there is a significant association between specific SNP site combinations and the phenotype of average length of the upper half of fibers.

[0032] like Figure 6 As shown, the figure illustrates the effect of specific SNP locus combinations on the micronaire value of cotton fiber. The horizontal axis represents the micronaire value, and the vertical axis lists different SNP locus combinations, including FM-A10_1, FM-LP-D03_1, FM-D06_1, and their various combinations, such as FM-A10_1+FM-D06_1, FM-LP-D03_1+FM-D06_1, FM-A10_1+FM-LP-D03_1, and FM-A10_1+FM-LP-D03_1+FM-D06_1. Each combination is followed by the corresponding sample size n. Figure 6 It can be seen that the average micronaire values ​​of cotton fibers from single SNP sites FM-A10_1 and FM-LP-D03_1 are 4.3 and 3.6, respectively, which belong to the B2 and B1 micronaire value standards (the B2 micronaire value standard is 4.3-4.9, and the B1 micronaire value standard is 3.5-3.6). However, the average fiber elongation of multiple SNP site combinations FM-A10_1+FM-LP-D03_1 and FM-A10_1+FM-LP-D03_1+FM-D06_1 is in the range of 3.7-4.2, which belongs to the A micronaire value standard (the A micronaire value standard is 3.7-4.2), and is better than the B2 and B1 standards. This indicates that the fiber micronaire value is affected by these SNP site combinations.

[0033] like Figure 7The figure shows the effect of specific SNP site combinations on the breaking strength of cotton fibers. The horizontal axis represents the breaking strength of fibers, in cN / dtex (centine Newtons per dtex), and the vertical axis lists specific SNP site combinations, including FS-A07_2, FS-D02_1, FS-A13_3, and their various combinations such as FS-A07_2+FS-A13_3, FS-D02_1+FS-A13_3, FS-D02_1+FS-A07_2+FS-A13_3, etc. The corresponding sample size n is indicated after each combination. Figure 6 It can be seen that the average breaking strength of cotton fibers from single SNP sites FS-A07_2, FS-D02_1, and FS-A13_3 is less than 30 cN / dtex, belonging to the "strong" level of cotton fiber breaking strength. However, the average breaking strength of fibers from multiple site combinations FS-A07_2+FS-A13_3, FS-D02_1+FS-A13_3, and FS-D02_1+FS-A07_2+FS-A13_3 is greater than 30 cN / dtex, belonging to the "very strong" level of cotton fiber breaking strength. This indicates a significant difference in the breaking strength of cotton fibers among different SNP site combinations, suggesting a significant correlation between specific SNP site combinations and the fiber breaking strength phenotype.

[0034] The data shows that only specific combinations of quality sites can significantly improve the average length of the upper half of the fiber, the micronaire value of the fiber, and the fiber breaking strength of fertile plants.

[0035] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A combination of SNP sites, characterized in that, The SNP site combinations include any combination of SNP sites FL-FS-A10_1, FL-D02_1, FL-A07_1, FM-A10_1, FM-LP-D03_1, FM-D06_1, FS-A07_2, FS-D02_1, FS-A13_3 and MS_A09, and their base sequences are shown in the table below: ； The locations of the above SNP sites are based on cotton chromosomes A07, A09, A10, A13, D02, D03, and D06 in genome version number Gossypium_hirsutum / ZJU-TM-1_V2.

1.

2. The application of the SNP locus combination as described in claim 1 in improving the quality traits of cotton recurrent selection populations, characterized in that, Samples were taken when the cotton plants had 2-3 true leaves to detect cotton fertility-related SNP sites and cotton fiber quality-related SNP sites in order to screen for fertile individual plants with good cotton quality traits. When the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is homozygous C / C, the fertility of that single plant is fertile; when the genotype detection result of the fertility-related SNP locus MS_A09 in a single plant population is heterozygous C / T, the fertility of that single plant is sterile.

3. The application according to claim 2, characterized in that, The cotton quality traits include the average length of the upper half of the fiber, the fiber breaking strength, and the fiber micronaire value.

4. The application according to claim 2, characterized in that, The SNP locus combination: FL-FS-A10_1, FL-D02_1, FL-A07_1, is used for early prediction and screening of the average length trait of the upper half of cotton fibers. The SNP locus combination: FM-A10_1, FM-LP-D03_1, FM-D06_1, is used for early prediction and screening of cotton fiber micronaire value traits. The SNP locus combination: FS-A07_2, FS-D02_1, FS-A13_3, is used for early prediction and screening of cotton fiber breaking strength trait. The SNP locus, MS_A09, is used for early prediction and screening to identify cotton fertility traits.

5. The application according to claim 2, characterized in that, The nucleotide sequences of the above SNP site combinations are shown in SEQ ID NO.1-20: (1) The nucleotide sequence of the SNP site FL-FS-A10_1 is shown below: SEQ ID NO.1: F: TTCCATCTCTTCAATGCAATCAAAGATAT; SEQ ID NO.2: R: GGCTGCATGATTCTAGTTTGTATGG; (2) The nucleotide sequence of SNP site FL-D02_1 is shown below: SEQ ID NO.3: F:AAACCCTAAACCTAAACTACAAACCC; SEQ ID NO.4: R: TACTATAATTGGAGCACTCTAATTACCGA; (3) The nucleotide sequence of SNP site FL-A07_1 is shown below: SEQ ID NO.5: F: AGCATTAAGAAGATTTTCTCTAAATCTTACT; SEQ ID NO.6: R:ACATCAGAAATATTGAAATTCTAATCGATGAT; (4) The nucleotide sequence of SNP site FM-A10_1 is shown below: SEQ ID NO.7: F: GAGTTTGTGAAAATATGTCCAGTAGACA; SEQ ID NO.8: R:TTGGGAAAAAAAAGAGTTTGTCCCT; (5) The nucleotide sequence of SNP site FM-LP-D03_1 is shown below: SEQ ID NO.9: F:TCCTTATCCCTAGGCCATTACTG; SEQ ID NO.10: R: GACTTTAGGGGTTTTGGGGG; (6) The nucleotide sequence of SNP site FM-D06_1 is shown below: SEQ ID NO.11: F:ACCCATACCCCTACCTTTTTTATAGTC; SEQ ID NO.12: R:ATAGTAAAACGGGTTTTTTAGACCAGT; (7) The nucleotide sequence of SNP site FS-A07_2 is shown below: SEQ ID NO.13: F: GTTCGATCGCAATGGGAACTTGA; SEQ ID NO.14: R:ACCTTTCCGTCACGATCTAGAAT; (8) The nucleotide sequence of SNP site FS-D02_1 is shown below: SEQ ID NO.15: F: ATAAAGGCATAACGTTAGTAGGTGC; SEQ ID NO.16: R: AGAGAAAAGAGAGAAATCCTCGAGAC; (9) The nucleotide sequence of SNP site FS-A13_3 is shown below: SEQ ID NO.17: F: TTGGGTTTTAAACTGTTCATGTGAG; SEQ ID NO.18: R: ATGTTTTTGGAGGAGGAGGAGA; (10) The nucleotide sequence of SNP site MS_A09 is shown below: SEQ ID NO.19: F: CTAGACTTCTCTGCCTTCTTTGGT; SEQ ID NO. 20: R:GGAGACCATGTCTGAAGAAGAGAA.

Images