Application of nicotinic acid or lactobacillus sake LZ217 in preparation of medicine for treating gastritis

By increasing the level of niacin in the host, Lactobacillus sakei LZ217 downregulates the pro-inflammatory factor IL-6 and upregulates the anti-inflammatory factor IL-10 in the preparation of drugs, thereby alleviating gastritis caused by Helicobacter pylori, reshaping the gastric microecology, and solving the treatment problem of Helicobacter pylori gastritis in existing technologies.

CN121513005APending Publication Date: 2026-02-13ZHEJIANG GONGSHANG UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202610026278.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-09
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Current technology lacks probiotic preparations that can effectively treat gastric mucosal inflammation caused by Helicobacter pylori, and existing antibiotic therapies have problems such as large side effects, increased drug resistance, and high recurrence rates.

Method used

Lactobacillus sakei LZ217 was used to increase the level of niacin in the host, which alleviated the infiltration of inflammatory cells in the gastric tissue by downregulating the expression of pro-inflammatory factor IL-6 and/or upregulating the expression of anti-inflammatory factor IL-10, and reshaped the gastric microecological balance by increasing the relative abundance of Firmicutes, Faecalibacterium, and Clostridium difficile.

Benefits of technology

Lactobacillus sakei LZ217 can effectively alleviate gastric mucosal inflammation caused by Helicobacter pylori, restore gastric microecological homeostasis, reduce inflammatory response and enhance immune regulation, which is superior to traditional co-aggregation and competitive exclusion strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121513005A_ABST
    Figure CN121513005A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganism application and the like, and particularly relates to application of nicotinic acid or lactobacillus sake LZ217 in preparation of a medicine for treating gastritis. The invention discloses application of nicotinic acid in preparation of a medicine for treating / relieving helicobacter pylori induced gastritis. The invention also provides an application of the lactobacillus sake LZ217 in preparation of a medicine for treating / relieving the helicobacter pylori induced gastritis, and the effect of treating / relieving the helicobacter pylori induced gastritis is achieved by improving the nicotinic acid level in a host body.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of microbial applications, specifically relating to the application of nicotinic acid or Lactobacillus sacchariformis LZ217 in the preparation of drugs for treating gastritis. Background Technology

[0002] Helicobacter pylori is a microaerophilic Gram-negative bacillus that can colonize the human gastric mucosa and is an important pathogenic factor for chronic gastritis, peptic ulcers, and even gastric cancer. Currently, the main clinical approach is to use triple or quadruple therapy containing antibiotics for eradication, but this method has problems such as significant side effects, increased drug resistance, and high recurrence rates. There is an urgent need to develop safer and more effective new intervention methods.

[0003] Probiotics, with their potential to regulate gut microbiota, enhance mucosal barriers, and alleviate inflammation, have been widely explored as adjunctive or alternative strategies for managing Helicobacter pylori infection. Lactic acid bacteria, as an important category of probiotics, have their anti-Helicobacter pylori activity largely attributed to non-specific mechanisms such as acid production, co-aggregation, or competitive adhesion. For example, Chinese patent publication CN114317334B discloses a strain of *Lactobacillus sakei* CCFM1199, which primarily reduces gastric pathogen colonization by co-aggregating with *Helicobacter pylori* and reducing its adhesion to host cells. Chinese patent application publication CN111607538A also indicates that *Lactobacillus rhamnosus* CCFM1119 can reduce *Helicobacter pylori* load and improve gastrointestinal symptoms in patients. This type of technology is essentially a pathogen-oriented physical clearance or competitive exclusion strategy. Its effect depends on the strain directly reducing the number of Helicobacter pylori during the infection process. Although it has some significance for prevention or early intervention, for a state where infection has been established and gastric mucosal inflammation and immune imbalance have been caused, the existing technology has not yet revealed the clear material basis and mechanism for specifically regulating the host inflammatory response, repairing tissue damage and restoring microecological homeostasis.

[0004] Niacin (vitamin B3) is an essential nutrient for the human body and is known to participate in energy metabolism and lipid regulation. However, whether it participates in the regulation of the gastric immune microenvironment during Helicobacter pylori infection and whether it can act as a key effector molecule for anti-inflammatory effects of specific lactic acid bacteria has not been reported to date. Summary of the Invention

[0005] The problem to be solved by the present invention is to provide the application of nicotinic acid or Lactobacillus sakei LZ217 in the preparation of drugs for treating gastritis.

[0006] To address the aforementioned problems, this invention provides the use of nicotinic acid in the preparation of medicaments for treating (including alleviating) Helicobacter pylori-induced gastritis.

[0007] As an improvement to the application of the present invention, at least one of the following is possible:

[0008] (a) Downregulates the expression of pro-inflammatory cytokine IL-6 and / or upregulates the expression of anti-inflammatory cytokine IL-10;

[0009] (b) Increase the relative abundance of Firmicutes, Faecalibacterium, and Clostridium difficile in the gastric flora;

[0010] (c) Relieves inflammatory cell infiltration in gastric tissue.

[0011] The present invention also provides the application of Lactobacillus sakei LZ217 in the preparation of drugs for treating (including alleviating) Helicobacter pylori-induced gastritis: Lactobacillus sakei LZ217 has the accession number CGMCC NO. 10259.

[0012] This strain is clearly described in ZL201510311918.2.

[0013] As an improvement to the application of the present invention: the drug exerts its therapeutic (including alleviating) effect on Helicobacter pylori-induced gastritis by increasing the level of niacin in the host.

[0014] As a further improvement to the application of the present invention: the enhancement of niacin levels in the host body includes increasing the concentration of niacin in serum and / or the cellular microenvironment.

[0015] As a further improvement to the application of the present invention: the relief and / or treatment of Helicobacter pylori-induced gastritis is at least one of the following:

[0016] (a) Relieves inflammatory cell infiltration in gastric tissue;

[0017] (b) Downregulates the expression of the pro-inflammatory cytokine IL-6;

[0018] (c) Upregulates the expression of the anti-inflammatory factor IL-10;

[0019] The present invention also provides a probiotic preparation for treating (including alleviating) Helicobacter pylori-induced gastritis, wherein the preparation uses Lactobacillus sakei LZ217 as the sole active strain and exerts its therapeutic effect by increasing niacin levels in the host.

[0020] As an improvement to the probiotic preparation of the present invention, the viable count of Lactobacillus sakei LZ217 in the preparation is not less than 1×10⁻⁶. 7 CFU / g or 1×10 7 CFU / mL.

[0021] The formulation is a dosage form suitable for oral administration.

[0022] This invention addresses the lack of effective probiotic preparations in the prior art for treating gastric mucosal inflammation caused by Helicobacter pylori. Specifically, this invention provides the application of a strain of Lactobacillus sakei LZ217 in regulating host niacin levels and alleviating Helicobacter pylori-induced gastritis.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. This invention reveals and verifies for the first time that *Lactobacillus sakei* LZ217 can alleviate gastric mucosal inflammation caused by *Helicobacter pylori* through a novel mechanism of increasing host niacin levels. This mechanism of action is independent of traditional physical antibacterial methods such as co-aggregation and competitive exclusion, providing a novel pathological intervention target and solution for the treatment of established *Helicobacter pylori* gastritis.

[0025] 2. This invention has demonstrated through exogenous supplementation experiments that nicotinic acid itself can relieve gastritis, regulate immunity and restore gut microbiota, thus establishing its status as a key functional substance in the above-mentioned treatment pathway.

[0026] 3. Niacin intervention can reshape the gastric microecological balance by increasing the relative abundance of Firmicutes, Faecalibacterium, and Clostridium difficile 1, and decreasing the relative abundance of Cyanobacterium PCC 6307.

[0027] In summary, this invention provides a strain of Lactobacillus sakei that can alleviate gastritis caused by Helicobacter pylori by regulating the host's niacin level, thereby mitigating the immune and microecological effects, and its application, which has significant innovative value and application prospects. Attached Figure Description

[0028] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0029] Figure 1 This is an experimental flowchart of the construction of a mouse model of Helicobacter pylori gastritis and the intervention of Lactobacillus sakei LZ217, and a schematic diagram of its effect on mouse body weight;

[0030] Figure 1 middle:

[0031] A is a schematic diagram showing the time sequence of group treatments in animal experiments;

[0032] B is a schematic diagram showing the changes in the body weight of mice in each group during the experiment;

[0033] C shows photomicrographs of H&E stained gastric tissue sections from each group.

[0034] Figure 2 This is a schematic diagram showing the detection results of the gene expression levels of inflammatory factors in the gastric mucosa tissue of mice in each group.

[0035] Figure 2 middle:

[0036] A represents the relative quantitative result of the expression of the pro-inflammatory factor IL-6 gene;

[0037] B represents the relative quantitative result of the expression of the anti-inflammatory factor IL-10 gene.

[0038] Figure 3 This is a schematic diagram showing the detection results of the effect of Lactobacillus sakei LZ217 on niacin levels in in vivo and in vitro models;

[0039] Figure 3 middle:

[0040] A represents the quantitative detection results of nicotinic acid concentration in the serum of mice in each group;

[0041] B represents the quantitative detection result of nicotinic acid concentration in the cell culture supernatant.

[0042] Figure 4 This is a schematic diagram illustrating the therapeutic effect of exogenous niacin on mice with Helicobacter pylori gastritis;

[0043] Figure 4 middle:

[0044] A is a schematic diagram of the operation process for the niacin treatment experiment;

[0045] B is a schematic diagram showing the changes in body weight of mice in each group during the treatment period;

[0046] C shows photomicrographs of H&E stained gastric tissue sections from each group.

[0047] Figure 5 This is a schematic diagram illustrating the analysis results of the effect of exogenous niacin on the gene expression of inflammatory factors in the gastric mucosa;

[0048] Figure 5 middle:

[0049] A represents the relative quantitative result of the expression of the pro-inflammatory factor IL-6 gene;

[0050] B represents the relative quantitative result of the expression of the anti-inflammatory factor IL-10 gene.

[0051] Figure 6 This is a schematic diagram illustrating the regulatory effect of exogenous nicotinic acid on the gastric flora structure of Helicobacter pylori-infected mice.

[0052] Figure 6 middle:

[0053] A is a bar chart showing the relative abundance of gastric microbiota at the phylum level;

[0054] B is a bar chart showing the relative abundance of gastric flora in each group at the genus level.

[0055] Figure 7A schematic diagram of the results of differential bacterial community identification between groups based on LEfSe analysis;

[0056] Figure 7 middle:

[0057] A is a dendrogram of the cluster analysis of gastric microbiota in each group;

[0058] B is the LDA value distribution map, showing the bacterial communities with significant differences between groups. Detailed Implementation

[0059] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and do not constitute any limitation on the scope of protection of the present invention.

[0060] Unless otherwise specified, the reagents and culture media used in the following examples are commercially available, and the relevant experimental methods are conventional techniques in the art.

[0061] The bacterial strains and cells involved in the following examples are all from the prior art, and the information is as follows:

[0062] Lactobacillus sakei LZ217, with accession number CGMCC No.10259.

[0063] Helicobacter pylori ZJC03, with accession number CCTCC NO: M20211218.

[0064] Lactobacillus rhamnosus GG (LGG) was purchased from Danisco.

[0065] AGS human gastric adenocarcinoma cells were purchased from the National Cell Preservation Center (catalog number TCHU232).

[0066] Laboratory animals: 6-week-old male C57BL / 6J mice, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0067] The culture medium preparation methods involved in the following examples are as follows:

[0068] (1) MRS solid culture medium: Weigh 52.4 g of MRS culture medium powder (Qingdao Haibo Biotechnology), add 15.0 g of agar, heat to dissolve in 1 L of ultrapure water, autoclave at 121℃ for 15 min, and set aside.

[0069] MRS liquid medium: except for the use of 15.0 g agar, the rest is the same as MRS solid medium.

[0070] (2) Columbia Blood Agar (CBA) medium: Weigh 5.2 g of Columbia medium powder into 100 mL of ultrapure water, autoclave at 121℃ for 15 min, cool to about 50℃, add 7% (v / v) sterile defibrinated sheep blood and 1% (v / v) Helicobacter pylori selective additive under aseptic conditions, mix well and pour into plates, solidify and use for later use.

[0071] Method for preparing bacterial suspension:

[0072] (1) *Lactobacillus sakei* LZ217 and LGG bacterial suspensions: Frozen bacterial cultures were inoculated onto MRS agar plates (MRS solid medium) and anaerobically cultured at 37°C for 48 h. Single colonies were picked and inoculated into MRS liquid medium and anaerobically cultured at 37°C for 18–24 h, activating two generations. The culture was centrifuged at 3000 × g for 10 min at 4°C to collect the bacterial cells, washed twice with PBS buffer (1×, pH 7.2–7.4), and finally resuspended in PBS buffer to adjust the bacterial concentration to 3 × 10⁻⁶. 8 CFU / mL.

[0073] (2) Helicobacter pylori ZJC03 bacterial suspension: The frozen bacterial strain was spread on CBA plates and incubated at 37°C for 72 h for resuscitation. After two generations of activation, the bacteria were washed off with PBS buffer and the bacterial concentration was adjusted to 3 × 10⁻⁶. 8 CFU / mL.

[0074] Example 1: The intervention effect of Lactobacillus sakei LZ217 on a mouse model of Helicobacter pylori-induced gastritis.

[0075] Six-week-old male C57BL / 6J mice were selected and acclimatized for one week under a standard environment of 22±2℃, 50±10% humidity, and 12-hour light-dark alternation. They were then randomly divided into 4 groups (n=6):

[0076] Blank control group (Control group): 400 μL PBS buffer was administered by gavage daily.

[0077] Model group (Hp group): Infection phase: Daily gavage administration of 400 μL of Helicobacter pylori ZJC03 bacterial suspension (3×10⁻⁶) 8 (CFU / mL), for 2 consecutive weeks; then switch to daily gavage administration of 400 μL PBS buffer for 3 weeks.

[0078] LZ217 intervention group (Hp+LZ217 group): The infection phase was the same as the model group; after the infection ended, the patient was switched to daily gavage administration of 400 μL of Lactobacillus sakei LZ217 bacterial suspension (3×10⁻⁶). 8 (CFU / mL), for 3 weeks.

[0079] LGG intervention group (Hp+LGG group): The infection phase was the same as the model group; after the infection ended, the patient was switched to daily gavage administration of 400 μL of Lactobacillus rhamnosus GG suspension (3×10⁻⁶). 8 (CFU / mL), for 3 weeks.

[0080] After the final intervention, all mice were euthanized by cervical dislocation, and the whole stomach tissue was dissected under aseptic conditions. After being rinsed with pre-cooled PBS buffer, some tissues were immediately frozen at -80°C, and some tissues were fixed in 4% paraformaldehyde for subsequent histological analysis.

[0081] The treatment time points of the above animal experimental treatment groups are as follows: Figure 1 As shown in A, the changes in body weight of mice in each group during the experiment are as follows: Figure 1 As shown in B. During the acclimatization period, all mice showed a normal weight gain trend. During the Helicobacter pylori infection phase, the weight gain of mice in each group tended to plateau. After entering the treatment intervention period, mice in the Lactobacillus sakei LZ217 intervention group showed a better weight gain trend, but the difference was not statistically significant compared with the model group and the Lactobacillus rhamnosus GG intervention group.

[0082] Example 2: Histopathological analysis of gastric tissue

[0083] Mouse gastric tissue collected in Example 1 was dissected along the greater curvature of the stomach, rinsed with pre-cooled sterile saline, and some tissue was fixed in 4% paraformaldehyde for 24 h. After dehydration with graded ethanol and paraffin embedding, the tissue was sectioned (4 μm thick) and stained with hematoxylin and eosin (H&E).

[0084] The H&E staining results of the gastric tissue of each group of mice are as follows: Figure 1 As shown in Figure C, the gastric mucosa of mice in the Control group was intact, with neatly arranged epithelial cells and no obvious inflammatory cell infiltration in the submucosa and lamina propria. The gastric mucosa of mice in the Hp group was severely damaged, with extensive inflammatory cell infiltration (indicated by the black arrows in the figure). The gastric mucosa structure of mice in the Hp+LZ217 group was significantly restored, and the degree of inflammatory cell infiltration was significantly reduced. The degree of inflammation improvement in the Hp+LGG group was not as significant as that in the Lactobacillus sakei LZ217 intervention group. These results indicate that Lactobacillus sakei LZ217 can effectively alleviate gastric mucosal inflammatory damage caused by Helicobacter pylori infection.

[0085] Example 3: Detection of gene expression levels of inflammatory factors in gastric tissue

[0086] 50 mg of mouse gastric mucosa tissue collected in Example 1 was used to extract total RNA according to the instructions of the total RNA extraction kit. The RNA was then converted into cDNA using a reverse transcription kit. Amplification was performed using a StepOne Plus real-time quantitative PCR instrument. The reaction program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s, 60℃ annealing / extension for 30 s, for a total of 40 cycles. Primer sequences were synthesized by Shanghai Sangon Biotech, and the specific sequences are shown in Table 1. Using GAPDH as an internal reference gene, the relative quantification of the target gene mRNA expression was calculated using the 2^(-ΔΔCT) method.

[0087] RT-qPCR test results are as follows Figure 2 As shown. Experimental data were standardized using GAPDH as an internal reference gene. Compared with the Control group, the expression level of the pro-inflammatory cytokine IL-6 was significantly increased in the Hp group; while the expression level of IL-6 in the Lactobacillus sakei LZ217 intervention group was significantly decreased compared with the Hp group, while the expression level of the anti-inflammatory cytokine IL-10 was significantly increased. The Lactobacillus rhamnosus GG intervention group had no significant effect on the expression levels of IL-6 and IL-10 compared with the Hp group. The results indicate that Lactobacillus sakei LZ217 can effectively alleviate the inflammatory response caused by Helicobacter pylori by regulating the expression of inflammatory factors.

[0088] Note: As is common knowledge, the internal reference gene GAPDH is used as a reference for the standardized analysis of target gene expression levels.

[0089] Table 1 Primer Information Parameters

[0090] Primer name Sequence (5' -3') GAPDH F ACCCTTAAGAGGGATGCTGC (SEQ ID NO:1) GAPDH R CCCAATACGGCCAAATCCGT (SEQ ID NO:2) IL-10 F GCTGTCATCGATTTCTCCCCT (SEQ ID NO:3) IL-10 R GACACCTTGGTCTTGGAGCTTAT (SEQ ID NO:4) IL-6 F GACAAAGCCAGAGTCCTTCAGA (SEQ ID NO:5) IL-6 R TGTGACTCCAGCTTATCTCTTGG (SEQ ID NO:6)

[0091] Example 4: Determination of niacin content in mouse serum

[0092] Blood was collected from the eyeballs of mice in Example 1. After standing for 30 min, the blood was centrifuged at 3000 ×g for 15 min at 4℃, and the supernatant serum was collected. Ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-Q-Trap / MS) was used to perform targeted quantitative analysis of the nicotinic acid content in the serum.

[0093] Serum niacin content measurement results are as follows Figure 3 As shown in Figure A, serum niacin levels in the *H. pylori* group were significantly lower than in the control group. Serum niacin levels in the *Lactobacillus sakei* LZ217 intervention group were significantly higher than in the *H. pylori* group, while there was no significant difference between the *Lactobacillus rhamnosus* GG intervention group and the *H. pylori* group. These results indicate that *Lactobacillus sakei* LZ217 can specifically increase niacin levels in host serum.

[0094] Example 5: Effect of Lactobacillus sakei LZ217 on niacin levels in a cell model

[0095] Human gastric adenocarcinoma cells AGS were treated at a rate of 3 × 10⁻⁶. 5 Cells were seeded at a density per well in 12-well plates and cultured at 37°C in a 5% CO2 incubator until a monolayer was formed. Except for the Blank group, all wells in the other groups contained AGS cells. Helicobacter pylori and Lactobacillus sakei LZ217 were adjusted to a bacterial suspension using fresh Ham's F-12K basal medium. The experiment was divided into 4 groups, and the final culture volume of each well was increased to 1 mL using fresh Ham's F-12K basal medium.

[0096] Blank group: Uninoculated human gastric adenocarcinoma AGS cells (i.e., containing only 1 mL of Ham's F-12K basal medium).

[0097] Control group: Inoculated with human gastric adenocarcinoma cells AGS;

[0098] Hp group: Inoculated with human gastric adenocarcinoma cells AGS, 100 μL of a 3×10⁻⁶ m³ solution was added. 8 Helicobacter pylori ZJC03 bacterial suspension at CFU / mL;

[0099] Hp+LZ217 group: Inoculated with human gastric adenocarcinoma cells AGS, and simultaneously added 100 μL of a 3×10⁻⁶ m³ / h solution. 8 A suspension of Helicobacter pylori ZJC03 at CFU / mL was mixed with 100 μL of a 3×10⁻⁶ CFU / mL solution. 8 A suspension of Lactobacillus sakei LZ217 at CFU / mL.

[0100] After co-culturing for 6 hours, the cell culture supernatant from each group was collected and centrifuged at 5000×g for 10 minutes at 4℃. The nicotinic acid content in the supernatant was determined by ultra-high performance liquid chromatography (UHPLC). The nicotinic acid determination results are as follows: Figure 3 As shown in Figure B, there was no significant difference in niacin levels between the Control and Blank groups, indicating that niacin levels in the cellular microenvironment remained stable under uninfected conditions. Compared to the Control group, the niacin level in the cell supernatant of the Hp group was significantly reduced, demonstrating that Helicobacter pylori infection leads to niacin depletion in the host cellular microenvironment. However, compared to the Hp group, the niacin level in the Hp+LZ217 co-treatment group significantly increased. This further demonstrates that Lactobacillus sakei LZ217 can also reverse the decrease in niacin levels caused by Helicobacter pylori infection in an in vitro cell model.

[0101] Example 6: The intervention effect of niacin on Helicobacter pylori-infected gastritis

[0102] Male C57BL / 6 mice were selected and randomly divided into 3 groups (n=6) after acclimatization:

[0103] Control group: 400 μL PBS buffer was administered by gavage daily;

[0104] Hp group: Infection phase: Daily gavage administration of Helicobacter pylori ZJC03 bacterial suspension (3×10⁻⁶) 8 (CFU / mL) for 2 consecutive weeks, then switch to PBS buffer by gavage for 3 consecutive weeks;

[0105] Hp+NA group: The infection stage was the same as the Hp group. After the infection ended, the patient was given 400 μL of 5 mmol / L nicotinic acid solution by gavage daily for 3 weeks.

[0106] See the experimental flowchart. Figure 4 A. There was no significant difference in body weight among the groups of mice, such as Figure 4 B.

[0107] After the intervention, gastric tissue was collected for H&E staining and RT-qPCR analysis. Figure 4 As shown in C (the black arrow in the figure indicates inflammatory cell infiltration), the degree of inflammatory infiltration in the gastric tissue of the Hp+NA group was significantly reduced compared to the Hp group. Figure 5 As shown, IL-6 gene expression in gastric tissue of the Hp+NA group was significantly lower than that of the Hp group ( Figure 5 A), while IL-10 expression was significantly increased ( Figure 5 (B). The results showed that exogenous niacin supplementation could effectively alleviate Helicobacter pylori-induced gastric mucosal inflammation and immune imbalance.

[0108] Example 7: 16S rRNA sequencing analysis of gastric mucosal flora

[0109] Gastric mucosal tissues from mice in each group in Example 6 were collected, and total microbial DNA was extracted using a kit. The V3-V4 region of the 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform.

[0110] The sequencing results are as follows Figure 6 As shown. At the level of the door ( Figure 6 In the A) and Control groups, Firmicutes were the dominant phylum. Compared with the Control group, the relative abundance of Firmicutes was significantly lower in the Hp group, while the relative abundance of Cyanobacteria was significantly higher; in the Hp+NA group, the relative abundance of Firmicutes was significantly higher than that of the Hp group, while the relative abundance of Cyanobacteria was significantly lower.

[0111] At the genus level ( Figure 6In the Hp group (B group), compared with the Control group, the relative abundance of *Femobacterium*, *Lactobacillus*, and *Clostridium* 1 was significantly decreased, while the relative abundance of *Cyanobacterium* 6307 and *Trichophyton* NK4A136 group was significantly increased. In the Hp+NA group, the relative abundance of *Femobacterium* and *Clostridium* 1 was significantly increased compared with the Hp group, while the relative abundance of *Cyanobacterium* 6307 and *Trichophyton* NK4A136 group was significantly decreased.

[0112] LEfSe analysis results ( Figure 7 The data shows that the characteristic bacteria of the Control group are subgroups of Proteobacteria and Lactobacilli; the characteristic bacteria of the Hp group are subgroups of Cyanobacteria; and the characteristic bacteria of the Hp+NA group are subgroups of Firmicutes, including the genera *Faecalibacterium* and *Clostridium* _1.

[0113] The above results indicate that Helicobacter pylori infection leads to dysbiosis of the gastric flora in mice, and niacin intervention can effectively reverse this disorder and restore the flora balance, especially by increasing the relative abundance of beneficial bacteria in Firmicutes.

[0114] In summary, this invention, through in vitro and in vivo experiments, demonstrates that *Lactobacillus sakei* LZ217 can effectively alleviate gastric mucosal inflammation caused by *Helicobacter pylori* infection, and its mechanism of action is closely related to increasing host niacin levels. Specifically:

[0115] 1. In a mouse model of Helicobacter pylori infection, intervention with Lactobacillus sacchariflorus LZ217 can significantly improve gastric tissue pathological damage and reduce inflammatory cell infiltration, and its effect is better than that of the control strain Lactobacillus rhamnosus GG.

[0116] 2. Lactobacillus sakei LZ217 can significantly regulate the expression of inflammatory factors in gastric tissue, inhibit the pro-inflammatory factor IL-6, and promote the production of the anti-inflammatory factor IL-10.

[0117] 3. This strain can specifically increase the level of niacin in host serum and cell models, and exogenous supplementation of niacin can reproduce its anti-inflammatory and gastric microecological regulation effects, confirming that niacin is its key active ingredient.

[0118] 4. Niacin can restore the microecological imbalance caused by Helicobacter pylori infection by reshaping the gastric flora structure, increasing the relative abundance of beneficial bacteria such as Firmicutes and Faecalibacterium.

[0119] Therefore, Lactobacillus sakei LZ217 and its key metabolite nicotinic acid have significant development value and application prospects in the preparation of functional foods or drugs for the prevention and / or relief of Helicobacter pylori-induced gastritis.

[0120] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Application of nicotinic acid in the preparation of drugs for treating Helicobacter pylori-induced gastritis.

2. The application according to claim 1, characterized in that... At least one of the following: (a) Downregulates the expression of pro-inflammatory cytokine IL-6 and / or upregulates the expression of anti-inflammatory cytokine IL-10; (b) Increase the relative abundance of Firmicutes, Faecalibacterium, and Clostridium difficile in the gastric flora; (c) Relieves inflammatory cell infiltration in gastric tissue.

3. The application of Lactobacillus sakei LZ217 in the preparation of drugs for treating Helicobacter pylori-induced gastritis, characterized by: Lactobacillus sakei LZ217 has the accession number CGMCC NO.10259.

4. The application according to claim 3, characterized in that: The drug works by increasing the level of niacin in the host to treat Helicobacter pylori-induced gastritis.

5. The application according to claim 4, characterized in that: The enhancement of niacin levels in the host body includes increasing the concentration of niacin in serum and / or the cellular microenvironment.

6. The application as described in any one of claims 3 to 5, characterized in that, The treatment for Helicobacter pylori-induced gastritis includes at least one of the following: (a) Relieves inflammatory cell infiltration in gastric tissue; (b) Downregulates the expression of the pro-inflammatory cytokine IL-6; (c) Upregulates the expression of the anti-inflammatory factor IL-10.

7. A probiotic preparation for treating Helicobacter pylori-induced gastritis, characterized in that: The formulation uses Lactobacillus sakei LZ217 as the sole bacterium and exerts its therapeutic effect by increasing niacin levels in the host.

8. The probiotic preparation according to claim 7, characterized in that, The viable count of Lactobacillus sakei LZ217 in the formulation is not less than 1×10⁻⁶. 7 CFU / g or 1×10 7 CFU / mL.

Citation Information

Patent Citations

  • Method for preparing soybean milk fermented milk by lactobacillus strains capable of producing high-yield folic acid

    CN105028661A

  • Lactobacillus rhamnosus and application thereof in inhibition of helicobacter pylori

    CN111607538A

  • A strain of Lactobacillus sakei capable of co-aggregating with Helicobacter pylori and its applications

    CN114317334B

  • Bacteriocin, and preparation method and application thereof

    CN104987370A

  • Lactic acid bacteria for preventing and treating gastritis caused by helicobacter pylori and application of lactic acid bacteria

    CN112080444A