Use of a nutritional composition in the manufacture of an immunomodulatory product
By combining lactoferrin and selenium-enriched gastrointestinal digestive products, the problem of the lack of reports on the synergistic anti-inflammatory effect of lactoferrin and selenium on the children's immune system in existing technologies has been solved. This approach achieves significant inhibition of inflammatory factor secretion and regulation of immune function, making it suitable for food and pharmaceuticals.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- MEAD JOHNSON PEDIATRIC NUTRITION TECH (GUANGZHOU) CO LTD
- Filing Date
- 2026-01-16
- Publication Date
- 2026-04-21
AI Technical Summary
The synergistic anti-inflammatory effect of the combination of lactoferrin and selenium on the immune system in children has not been reported in the prior art, and the immunomodulatory effect of the existing composition after in vitro simulated digestion is unclear.
A nutritional composition is provided comprising lactoferrin gastrointestinal digests and selenium gastrointestinal digests, which are applied to an immunomodulatory product after mimicking gastrointestinal digestion. The concentration range is 80-180 μg/mL for lactoferrin and 12-28 ng/mL for selenium, and is used to alleviate excessive immune responses and oxidative stress, and inhibit the secretion of inflammatory factors and signaling pathways.
It significantly inhibits LPS-induced excessive NO release from macrophages, reduces cellular ROS release, regulates macrophage phagocytic function, and reduces the expression of inflammatory factors, achieving a synergistic anti-inflammatory effect. It is suitable for food, functional food, or pharmaceuticals.
Smart Images

Figure CN121513178B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nutritional products technology, and specifically to the application of a nutritional composition in the preparation of immunomodulatory products. Background Technology
[0002] Children's immune systems are susceptible to excessive inflammatory responses triggered by external stimuli (such as pathogens), leading to over-secretion of NO, reactive oxygen species (ROS), and inflammatory factors (IL-1β, TNF-α), which damage tissues. IL-1β and TNF-α are core pro-inflammatory cytokines and key mediators of the inflammatory response; their levels directly reflect the intensity of the inflammatory response. ROS is a marker of oxidative stress. Excessively high levels of ROS can damage cells and activate inflammatory pathways.
[0003] Lactoferrin is an iron-binding glycoprotein abundant in breast milk, with the highest concentration in colostrum. Its concentration decreases throughout lactation, reaching approximately 6.15 g / L in colostrum from 0-5 days postpartum, approximately 3.65 g / L in breast milk from 6-15 days, approximately 2.46 g / L in transitional milk from 16-30 days, and decreasing to 1.76 g / L in mature milk from 31-360 days. Lactoferrin is involved in a wide range of biological functions, including anti-infection, anti-inflammation, and reducing harmful host responses to acute enteritis. As a key immunonutrient in breast milk, lactoferrin plays an important immune role. In piglets fed lactoferrin, immune cells produce a strong pro-inflammatory response when triggered by bacteria. These studies demonstrate the benefits of dietary lactoferrin in preventing infection, late-onset sepsis, and necrotizing enterocolitis.
[0004] Selenium is an essential trace element for the human body and is crucial for maintaining the normal function of the immune system. Studies have shown that selenium deficiency can weaken the immune response and may increase the risk of infection. Therefore, adequate selenium supplementation (which can be obtained through foods such as Brazil nuts, seafood, and eggs) can not only help the body effectively resist pathogens or other foreign substances, but also play a certain balancing and regulatory role in maintaining immune homeostasis when the immune system overreacts.
[0005] Therefore, lactoferrin and sodium selenite can be used as nutritional fortifiers, but current technology has not shown the effects of combining these two components. In particular, there are no reports, either domestically or internationally, on the specific effects of this combination on children's immunity. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide an application of a nutritional composition containing lactoferrin and selenium, which are compounded in the form of gastrointestinal digestibles and have a better synergistic anti-inflammatory effect than lactoferrin and selenium alone.
[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0008] The first aspect of the present invention provides the application of a nutritional composition in the preparation of an immunomodulatory product, the nutritional composition comprising lactoferrin gastrointestinal digestate and selenium gastrointestinal digestate; wherein, the content of lactoferrin gastrointestinal digestate in the nutritional composition is 80-180 μg / mL; and the content of selenium gastrointestinal digestate, calculated as selenium, is 12-28 ng / mL.
[0009] In this invention, the lactoferrin is derived from cow's milk, sheep's milk and their products, including but not limited to whole milk powder, skim milk powder, casein and whey protein powder, preferably whey protein powder.
[0010] In this invention, the selenium source used can be, but is not limited to, sodium selenite, sodium selenate, selenium yeast, selenomethionine, L-seleno-methylselenocysteine, etc. Those skilled in the art will understand that regardless of the selenium source used, its effective component is elemental selenium. Therefore, the concentration ranges mentioned in this invention refer to concentrations converted to elemental selenium. For example, when sodium selenite is used as the selenium source, since its molecular weight is 173 and the atomic weight of selenium is 79, the mass fraction of elemental selenium in sodium selenite is approximately 79 / 173 ≈ 45.66%. Those skilled in the art can easily calculate the required amount of the selenium compound to be added based on the mass fraction of selenium in the selected selenium source.
[0011] In this invention, the lactoferrin gastrointestinal digests and selenium gastrointestinal digests are digests obtained by sequentially digesting lactoferrin / selenium source through simulated gastric fluid and simulated intestinal fluid. The components of both simulated gastric fluid (SGF) and simulated intestinal fluid (SIF) are well-known, and both can be prepared according to methods known in the prior art.
[0012] Specifically, the simulated gastric juice composition is: 6.9 mM potassium chloride, 0.9 mM potassium dihydrogen phosphate, 72.2 mM sodium chloride, 0.1 mM magnesium chloride, 0.5 mM ammonium carbonate, 0.15 mM calcium chloride, 4000 U / ml pepsin, pH=3.0. The simulated intestinal juice composition is: 6.8 mM potassium chloride, 0.8 mM potassium dihydrogen phosphate, 123.4 mM sodium chloride, 0.33 mM magnesium chloride, 0.6 mM calcium chloride, 20 mM bile salts, 200 U / ml trypsin, pH=7.0.
[0013] The nutritional composition of this invention utilizes gastrointestinal digests of lactoferrin and selenium. In an in vitro simulated digestion model, lactoferrin and selenium are digested in the stomach and intestines, and are ultimately absorbed into the bloodstream and lymphatic system, reaching immune cells. The simulated digestion process yields not the original lactoferrin, but a mixture of lactoferrin peptides produced after its breakdown by pepsin, trypsin, etc. These peptides possess immunomodulatory activity different from, and even stronger than, the intact protein. For selenium, a more easily absorbed and utilized form is obtained, and the resulting experimental results can more accurately predict its actual effects after oral administration.
[0014] Furthermore, using concentrations obtained after digestion treatment offers the key advantage of making in vitro cell experiments more closely resemble actual physiological processes within the human body. This significantly enhances the scientific rigor of the research results and their guiding value for future practical applications (such as the development of functional foods and nutritional supplements). This represents a crucial advancement from an "ideal chemical environment" to a "simulated physiological environment."
[0015] In a preferred embodiment of the present invention, the nutritional composition contains 90 μg / mL of lactoferrin gastrointestinal digestate and 13.68 ng / mL of selenium gastrointestinal digestate, calculated as selenium.
[0016] Since the equivalents of lactoferrin and selenium remain unchanged before and after digestion, the concentrations of lactoferrin and selenium digests can be calculated based on the dilution factor during digestion.
[0017] In this invention, the immune regulation includes alleviating excessive immune responses and / or alleviating oxidative stress.
[0018] An excessive immune response can trigger an excessive inflammatory response, leading to the over-secretion of NO, ROS, and inflammatory factors (IL-1β, TNF-α), which damage tissues. Oxidative stress can cause elevated ROS levels; excessively high levels of ROS can damage cells and activate inflammatory pathways. The nutritional composition provided by this invention can effectively alleviate inflammatory responses by mitigating excessive immune responses and oxidative stress.
[0019] In this invention, the immune regulation includes inhibiting the excessive release of NO from macrophages induced by LPS.
[0020] NO release is a common indicator of macrophage anti-inflammatory activity, and inhibiting excessive NO production can treat and alleviate certain inflammatory diseases. Experiments have confirmed that the lactoferrin and selenium gastrointestinal digestive products in the nutritional composition of this invention can synergistically inhibit LPS-induced excessive NO release from macrophages within a certain content range.
[0021] In this invention, the immune regulation includes inhibiting the excessive release of reactive oxygen species induced by LPS in cells.
[0022] ROS can activate NF-κB, causing it to translocate to the cell nucleus, thereby promoting the transcription of inflammatory factors. Excessive intracellular ROS can also damage mitochondria by reducing mitochondrial membrane potential. Experiments have confirmed that the nutritional composition of this invention can significantly inhibit the excessive release of reactive oxygen species induced by LPS.
[0023] In this invention, the immune regulation includes regulating the phagocytic function of macrophages under LPS stimulation, causing them to revert from an overactivated state to a resting state.
[0024] The phagocytic function of macrophages is one of the main mechanisms by which the body defends against the invasion of foreign substances, and can directly or indirectly reflect the immune response capacity of macrophages. Experiments have confirmed that the nutritional composition of this invention has a significant immunomodulatory effect on LPS-induced macrophage overphagosis.
[0025] In this invention, the immune regulation includes reducing the expression of LPS-induced inflammatory factors, including IL-1β and TNF-α. Experiments have confirmed that the nutritional composition of this invention can significantly inhibit the secretion of inflammatory factors IL-1β and TNF-α, and has a synergistic effect.
[0026] Furthermore, the immune regulation includes inhibiting the activation of the TLR4 / NF-κB inflammatory signaling pathway and reducing the expression of TLR4 mRNA and / or NF-κB mRNA. Experiments have confirmed that the nutritional composition of the present invention can significantly inhibit the expression of the inflammatory pathway proteins TLR4 and NF-κB mRNA.
[0027] The present invention also provides an immunomodulatory formulation comprising an effective amount of the nutritional composition described herein, and a pharmaceutically or food-grade acceptable carrier.
[0028] The immune-modulating preparations in this invention can be foods, functional foods, pharmaceuticals, etc., and can be applied to children, adults and the elderly, especially children.
[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0030] 1. The nutritional composition provided by this invention has a synergistic inhibitory effect on inflammation and is highly safe, making it worthy of widespread application. Experiments have confirmed that, within the specific content range of lactoferrin and selenium in the gastrointestinal digestive products of this invention, it can reduce the release rate of NO from LPS-induced RAW264.7 macrophages, reduce excessive release of cellular ROS, and thus alleviate oxidative stress; it also reduces the expression of LPS-induced inflammatory factors IL-1β and TNF-α through immunomodulation, and downregulates the expression of proteins related to inflammatory pathways at the protein level, thus mitigating the effects of inflammatory responses.
[0031] 2. The nutritional composition provided by this invention can be applied to food, functional food or medicine, and can effectively regulate immune function and alleviate inflammatory response. Attached Figure Description
[0032] Figure 1 The effects of lactoferrin (A) and lactoferrin gastrointestinal digestive products (B) on NO secretion in cells stimulated by LPS;
[0033] Figure 2 The effects of different concentrations of lactoferrin gastrointestinal digests (A) and sodium selenite gastrointestinal digests (B) on cell viability under LPS stimulation;
[0034] Figure 3 The effects of different concentrations of lactoferrin gastrointestinal digests (A) and sodium selenite gastrointestinal digests (B) on NO release from cells under LPS stimulation;
[0035] Figure 4 The effect of different concentrations of nutrient compositions on NO release from cells stimulated by LPS;
[0036] Figure 5 The percentage reduction in cellular NO release under LPS stimulation compared to the positive control group is indicated by different concentrations of the nutrient composition. L represents lactoferrin gastrointestinal digests, S represents sodium selenite gastrointestinal digests, and the values in parentheses represent the concentrations of the corresponding digests. Detailed Implementation
[0037] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0039] Unless otherwise specified, the experimental methods used in the following examples and comparative examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0040] 1. Materials and Reagents
[0041] Lactoferrin and sodium selenite were provided by Mead Johnson Nutrition (China) Co., Ltd.; DEMEN high-glucose culture medium and fetal bovine serum were provided by Hyclone Pharmaceuticals, Inc., USA; lipopolysaccharide (LPS), pepsin, trypsin, acetonitrile, and trifluoroacetic acid were provided by Sigma-Aldrich Pharmaceuticals, Inc., USA; potassium chloride, potassium dihydrogen phosphate, sodium chloride, magnesium chloride, ammonium carbonate, calcium chloride, hydrochloric acid, sodium hydroxide, and urea were provided by Sinopharm Chemical Reagent Co., Ltd.; PBS buffer and double antibiotics were provided by Apexis (Shanghai) Biotechnology Co., Ltd.; nitric oxide assay kit and CCK-8 assay kit were provided. Reactive oxygen species detection kit, neutrophil proliferation and cytotoxicity detection kit, RNAeasy™ animal RNA extraction kit (centrifugal column), Beyotime Biotechnology Co., Ltd. (Shanghai); Enzyme-free water, reverse transcription kit, SYBR fluorescent dye, Novizan Biotechnology Co., Ltd. (Nanjing); Mouse high-sensitivity interleukin-1β (IL-1β) enzyme-linked immunosorbent assay kit, Mouse high-sensitivity tumor necrosis factor-α (TNF-α) enzyme-linked immunosorbent assay kit, Elite Biotechnology Co., Ltd. (Wuhan); Phosphoric acid blue, Gibco Inc. (USA).
[0042] 2. Instruments and Equipment
[0043] IL-161CT air-jacketed CO2 incubator, Stuker Instruments (Shanghai) Co., Ltd.; XD-202 inverted biological microscope, Jiangnan Yongxin Optical Instruments (Nanjing) Co., Ltd.; C100-SE digital cell counter, Reward Life Sciences (Shenzhen) Co., Ltd.; Multiskan Sky High full-wavelength microplate reader, NanoDrop One ultra-micro UV-Vis spectrophotometer, ICAP TQ inductively coupled plasma mass spectrometer, Thermo Fisher Scientific, Inc.; e2695 liquid chromatograph, Waters Corporation, USA; multi-functional microplate reader, Berten Instruments, Inc.; Agilent 1100 high-performance liquid chromatography system, Agilent Technologies, Inc.
[0044] 3. Preparation of simulated gastric and intestinal fluids
[0045] Preparation of simulated gastric juice: 6.9 mM potassium chloride, 0.9 mM potassium dihydrogen phosphate, 72.2 mM sodium chloride, 0.1 mM magnesium chloride, 0.5 mM ammonium carbonate, 0.15 mM calcium chloride, 4000 U / mL pepsin, pH=3.0.
[0046] Preparation of simulated intestinal fluid: 6.8 mM potassium chloride, 0.8 mM potassium dihydrogen phosphate, 123.4 mM sodium chloride, 0.33 mM magnesium chloride, 0.6 mM calcium chloride, 20 mM bile salts, 200 U / mL trypsin, pH=7.0.
[0047] 4. Preparation of gastrointestinal digestive products
[0048] 4.1 Lactoferrin in gastrointestinal digestive products
[0049] Lactoferrin was dissolved in deionized water at a concentration of 50 mg / mL and stirred overnight to prepare a lactoferrin solution. The solution was then stabilized in a 37°C water bath for 2-3 min, and then mixed with simulated gastric juice containing 4000 U / mL pepsin at a 1:1 (v / v) ratio. 6 M hydrochloric acid was then added dropwise to maintain the pH at 3.0. After 120 min of reaction, 2 M sodium hydroxide was immediately added to adjust the pH to 7.0 to terminate pepsin hydrolysis, yielding a lactoferrin gastric digestion sample. Next, an equal volume of simulated intestinal juice containing 200 U / mL trypsin was added to the lactoferrin gastric digestion sample, maintaining the pH at 7.0. After 120 min of reaction, an intestinal digestion sample of lactoferrin was obtained. Finally, the intestinal digestion sample of lactoferrin was heated at 95°C for 5 min to inactivate the enzymes, and then diluted to multiple concentrations with DEMEN medium containing 10% fetal bovine serum to obtain different concentrations of lactoferrin gastrointestinal digest for cell experiments.
[0050] 4.2 Sodium selenite gastrointestinal digestive products
[0051] Sodium selenite was dissolved in deionized water at a concentration of 17 mg / mL and stirred overnight to prepare a sodium selenite solution. The sodium selenite solution was then stabilized in a water bath at 37°C for 2-3 min, and then mixed with simulated gastric juice containing 4000 U / mL pepsin at a 1:1 (v / v) ratio. Subsequently, 6 M hydrochloric acid was added dropwise to maintain the pH of the system at 3.0. Immediately after the reaction was completed for 120 min, 2 M sodium hydroxide was added to adjust the pH to 7.0 to terminate the hydrolysis by pepsin, yielding a sodium selenite gastric digestion sample. Next, an equal volume of simulated intestinal juice containing 200 U / mL trypsin was added to the sodium selenite gastric digestion sample, maintaining the pH at 7.0. After the reaction was completed for 120 min, a sodium selenite intestinal digestion sample was obtained. Finally, the sodium selenite enteric digest was heated at 95°C for 5 min to inactivate enzymes, and then diluted to multiple concentrations with DEMEN medium containing 10% fetal bovine serum to obtain sodium selenite gastrointestinal digest at different concentrations for cell experiments.
[0052] 5. Examples and Comparative Examples
[0053] Example 1
[0054] This embodiment provides a nutritional composition in which the concentrations of lactoferrin gastrointestinal digests and sodium selenite gastrointestinal digests are 90 μg / mL and 30 ng / mL, respectively (with a selenium concentration of 13.68 ng / mL).
[0055] Example 2
[0056] This embodiment provides a nutritional composition in which the concentrations of lactoferrin gastrointestinal digests and sodium selenite gastrointestinal digests are 180 μg / mL and 60 ng / mL, respectively (with a selenium concentration of 27.4 ng / mL).
[0057] Comparative Example 1
[0058] This comparative example provides a lactoferrin gastrointestinal digestive product with a concentration of 40 μg / mL.
[0059] Comparative Example 2
[0060] This comparative example provides a lactoferrin gastrointestinal digestive product with a concentration of 80 μg / mL.
[0061] Comparative Example 3
[0062] This comparative example provides a lactoferrin gastrointestinal digestive product with a concentration of 90 μg / mL.
[0063] Comparative Example 4
[0064] This comparative example provides a lactoferrin gastrointestinal digestive product with a concentration of 180 μg / mL.
[0065] Comparative Example 5
[0066] This comparative example provides a lactoferrin gastrointestinal digestive product with a concentration of 400 μg / mL.
[0067] Comparative Example 6
[0068] This comparative example provides a sodium selenite gastrointestinal digestive product with a concentration of 20 ng / mL (selenium concentration of 9.12 ng / mL).
[0069] Comparative Example 7
[0070] This comparative example provides a sodium selenite gastrointestinal digestive product with a concentration of 30 ng / mL (selenium concentration of 13.68 ng / mL).
[0071] Comparative Example 8
[0072] This comparative example provides a sodium selenite gastrointestinal digestive product with a concentration of 60 ng / mL (selenium concentration of 27.4 ng / mL).
[0073] Comparative Example 9
[0074] This comparative example provides a sodium selenite gastrointestinal digestive product with a concentration of 120 ng / mL (selenium concentration of 54.8 ng / mL).
[0075] Comparative Example 10
[0076] This comparative example provides a sodium selenite gastrointestinal digest with a concentration of 400 ng / mL (selenium concentration of 182.8 ng / mL).
[0077] Comparative Example 11
[0078] This comparative example provides a nutritional composition in which the concentrations of lactoferrin gastrointestinal digests and sodium selenite gastrointestinal digests are 400 μg / mL and 20 ng / mL, respectively (with a selenium concentration of 9.12 ng / mL).
[0079] Comparative Example 12
[0080] This comparative example provides a nutritional composition in which the concentrations of lactoferrin gastrointestinal digests and sodium selenite gastrointestinal digests are 400 μg / mL and 120 ng / mL, respectively (with a selenium concentration of 54.8 ng / mL).
[0081] Experimental process
[0082] 6. LF-Se treatment of macrophages
[0083] Cell model: An inflammation model was established by stimulating RAW264.7 macrophages with LPS (10 μg / mL).
[0084] Cells in logarithmic growth phase were fed with 1 × 10⁻⁶ cells. 5 Cells were seeded at a concentration of 100 μL / well in 96-well plates, with three replicates per treatment group. The seeded cells were incubated at 37°C in a 5% CO2 incubator for 24 h, and the cell culture supernatant was aspirated.
[0085] Negative control group: Add 100 μL of fresh culture medium and continue culturing for 1 h, then add another 10 μL of fresh culture medium.
[0086] Positive control group: Add 100 μL of fresh culture medium and continue culturing for 1 h, then add 10 μL of culture medium solution containing 10 μg / mL LPS.
[0087] Experimental sample groups: lactoferrin, sodium selenite gastrointestinal digests, and nutrient compositions of different concentrations were added and cultured for 1 h, and then 10 μL of LPS solution with a concentration of 10 μg / mL was added to form the sample groups.
[0088] 7. Testing Indicators
[0089] 7.1 Detection of cellular NO secretion
[0090] Cell culture, modeling, and intervention procedures were as described previously. Collect the cell culture supernatant, and transfer 50 μL to the wells of a new 96-well plate. Following the instructions of the nitric oxide assay kit, add 50 μL of Griess Reagent I and 50 μL of Griess Reagent II sequentially, and measure the absorbance at 540 nm. Use sodium nitrite as a standard curve to calculate the NO content in the supernatant.
[0091] 7.2 Cellular phagocytic capacity
[0092] Cell culture, modeling, and intervention procedures were as described previously. Following the instructions of the neutral erythrocyte proliferation and cytotoxicity assay kit, after culture, the cell culture supernatant was aspirated, and 100 μL of 1 mg / mL neutral red solution was added to each well. The cells were incubated at 37°C for 1 h. Unphagocytosed neutral red was washed away with PBS buffer, five times per well. 100 μL of cell lysis buffer was added, and the cells were lysed in the dark for 2 h. The absorbance at 540 nm was measured.
[0093] 7.3 Detection of cellular ROS levels
[0094] Cell culture, modeling, and intervention procedures were as described above. Following the instructions of the reactive oxygen species (ROS) detection kit, after culture, the cell culture supernatant was aspirated, and 200 μL of DEMEN medium containing 10 μmol / L 2',7'-dichlorofluorescein diacetate was added. The cells were incubated at 37°C in the dark for 20 min. Then, the supernatant was removed, and each well was washed three times with DEMEN medium in the dark. 200 μL of DEMEN medium was added, and fluorescence intensity was detected at an excitation wavelength of 488 nm and an emission wavelength of 525 nm.
[0095] 7.4 Detection of cellular inflammatory factor levels
[0096] Cell culture, modeling, and intervention procedures were as described above. Cell culture supernatants from each group were collected and centrifuged at 1000 r / min for 15 min. The levels of TNF-α and IL-1β in the cell culture supernatants of each group were detected using ELISA. Samples were processed according to the ELISA kit instructions, and absorbance values were measured at 450 nm using a microplate reader. A standard curve was plotted, and the levels of TNF-α and IL-1β were calculated.
[0097] 7.5 Measurement of iNOS mRNA expression level in cells.
[0098] Cells in the logarithmic growth phase were injected with 2.5 × 10⁻⁶ cells. 6 Cells were seeded at a concentration of [number] cells / ml in 6-well plates, 2.5 mL / well. The remaining cell culture, modeling, and intervention procedures were as described above. After culture, total RNA was extracted from each group of cells according to the instructions of the RNAeasy™ Animal RNA Extraction Kit. The RNA concentration and purity of the samples were determined using a Nano drop One micro-bioanalyzer.
[0099] The expression level of mRNA was determined by real-time quantitative polymerase chain reaction (qPCR). Total RNA was reverse transcribed into cDNA according to the reverse transcription kit instructions. The reaction conditions were: 25℃, 10 min; 37℃, 120 min; 85℃, 5 min; 4℃, Hold. The target gene was then amplified using the following program: 50℃, 2 min; 95℃, 10 min; 95℃, 10 s; 60℃, 30 s; 45 cycles. GAPDH was used as an internal control. The primer sequences are as follows: F-terminus of GAPDH is CAAGCTCATTTCCTGGTATGAC, R-terminus is GATAGGGCCTCTCTTGCTCAG; F-terminus of INOS is GTTCTCAGCCCAACAATACAAGA, R-terminus is GTGGACGGGTCGATGTCAC. 2... -ΔΔCt The relative expression level of INOS mRNA was calculated using this method.
[0100] 7.6 Measurement of mRNA expression levels of cellular pathway proteins TLR4 and NF-κB
[0101] Total RNA extraction and qPCR procedures were the same as in 7.5. GAPDH was used as an internal control. Primer sequences were as follows: TLR4 F-terminus: TCTGGGGAGGCACATCTTCT, R-terminus: CAGGTCCAAGTTGCCGTTTC; NF-κB primer sequence F-terminus: ATGTAGTTGCCACGCACAGA, R-terminus: GGGGACAGCGACACCTTTTTA. 2... -ΔΔCtThe relative expression levels of TLR4 and NF-κB mRNA were calculated using a method.
[0102] 8. Data Statistical Analysis
[0103] SPSS 25 was used to perform statistical analysis of the experimental results. One-way ANOVA was used for analysis of variance, and Duncan's test was used to compare the differences between the means.
[0104] 9. Results and Analysis
[0105] 9.1 Effects of lactoferrin and its gastrointestinal digestive products on cellular NO release
[0106] When the human immune system is stimulated by external factors, macrophages participate in immune responses and immune regulation by phagocytosis and the production and secretion of cytokines. Once activated, macrophages trigger a respiratory burst by reducing coenzyme II oxidase, which simultaneously promotes the expression of inducible nitric oxide synthase (iNOS) and the generation of nitrogen (NO), assisting the body in combating the invasion of foreign antigens and achieving an immune response. The amount of NO released is a common indicator of the anti-inflammatory activity of macrophages; inhibiting excessive NO production can treat and alleviate certain inflammatory diseases.
[0107] Table 1. Effects of lactoferrin on NO secretion in cells stimulated by LPS
[0108]
[0109] Table 2. Effects of lactoferrin gastrointestinal digests on NO secretion in cells stimulated by LPS.
[0110]
[0111] Figure 1 The effects of different concentrations of lactoferrin and its gastrointestinal digests on NO secretion in RAW264.7 cells stimulated by LPS were shown in Tables 1-2. As can be seen from the tables, NO release was significantly increased in the positive control group compared to the negative control group (P<0.0001). Adding different concentrations of lactoferrin or its gastrointestinal digests 1 h before LPS stimulation resulted in a dose-dependent decrease in NO secretion, indicating that the early addition of lactoferrin and its gastrointestinal digests can alleviate LPS stimulation and enhance cellular immunomodulatory capabilities. When lactoferrin was added 1 h before LPS stimulation at a concentration of 20 μg / mL, NO secretion was significantly higher in the cells than in the positive control group (P<0.01). Figure 1The result in A) may be due to an increase in cell number at this concentration; when the concentration was 10 and 45 μg / mL, there was no significant difference in NO secretion between the cells and the positive control group; when the concentration was 100-600 μg / mL, the NO secretion of the cells was significantly lower than that of the positive control group (P<0.05). Adding lactoferrin gastrointestinal digest 1 h before LPS stimulation, at concentrations of 40-400 μg / mL, significantly reduced NO secretion compared to the positive control group (P<0.05).
[0112] Furthermore, when the concentrations of lactoferrin and its gastrointestinal digests were the same, the latter resulted in lower NO secretion from cells. When LPS stimulation led to a NO secretion of 9.80 μg / mL, a lactoferrin concentration of 600 μg / mL was required, while when gastrointestinal lactoferrin digests were added, only a concentration of 400 μg / mL of lactoferrin was needed. This indicates that gastrointestinal lactoferrin digests have a stronger immunomodulatory effect on LPS-stimulated RAW264.7 cells than lactoferrin itself.
[0113] 9.2 Effects of a single component of gastrointestinal digestive products on RAW264.7 cells stimulated by LPS
[0114] The cytotoxicity of gastrointestinal digests to RAW264.7 cells was determined using a CCK-8 assay. The effects of different concentrations of lactoferrin and sodium selenite gastrointestinal digests on the viability of RAW264.7 cells stimulated with LPS were investigated. Figure 2 As shown.
[0115] In this experiment, lactoferrin gastrointestinal digests at a concentration of 40-400 μg / mL were added 1 hour before LPS stimulation of cells; sodium selenite gastrointestinal digests at a concentration of 20-400 ng / mL were added 1 hour before LPS stimulation of cells. Figure 2 As can be seen, under the experimental conditions, the gastrointestinal digests of lactoferrin and sodium selenite did not reverse LPS-induced macrophage activation, but they were not cytotoxic. The concentration ranges of the gastrointestinal digests that were not cytotoxic were selected for subsequent experiments: lactoferrin gastrointestinal digests at a concentration of 40-400 μg / mL; and sodium selenite gastrointestinal digests at a concentration of 20-400 ng / mL.
[0116] 9.3 Effects of different concentrations of single-component gastrointestinal digestive products on cellular NO release
[0117] The effects of different concentrations of lactoferrin and sodium selenite gastrointestinal digests on NO secretion in RAW264.7 cells stimulated by LPS, such as... Figure 3 As shown in Table 3.
[0118] Table 3. Effects of different concentrations of lactoferrin and sodium selenite on NO release from cells under LPS stimulation.
[0119]
[0120] From Table 3 and Figure 3 The results showed that adding lactoferrin gastrointestinal digests at concentrations of 40-400 μg / mL 1 hour before LPS stimulation significantly reduced cellular NO secretion compared to the positive control group (P<0.05), with a dose-dependent decreasing effect. Similarly, adding sodium selenite gastrointestinal digests at concentrations of 20-400 ng / mL 1 hour before LPS stimulation significantly reduced cellular NO secretion compared to the positive control group (P<0.0001), with a dose-dependent decreasing effect. Therefore, different concentrations of either lactoferrin gastrointestinal digests or sodium selenite gastrointestinal digests have a significant effect on reducing NO secretion.
[0121] 9.4 In vitro anti-inflammatory effects of the nutritional composition
[0122] (1) Release of NO from cells
[0123] NO release is a common indicator of macrophage anti-inflammatory activity; inhibiting excessive NO production can treat and alleviate certain inflammatory diseases. The effects of different concentrations of nutrient compositions on LPS-stimulated NO release in the examples and comparative examples are shown in Table 4. Figure 4-5 As shown.
[0124] Table 4. Effects of different concentrations of nutrient compositions on NO release from cells under LPS stimulation.
[0125]
[0126] As shown in Table 4 and Figure 4-5 As shown, the addition of two-component nutrient combinations before LPS stimulation significantly reduced NO secretion compared to the positive control group (P<0.01), and also lower than any single-component group, indicating that the combination can further reduce NO secretion induced by LPS stimulation. However, in different concentrations of the combination, according to the synergistic effect judgment formula, ΔE(a+b)>ΔE(a)+ΔE(b), ΔE(L180+S27.4)>ΔE(L180)+ΔE(S27.4); and ΔE(a / 2+b / 2)>ΔE(a) and>ΔE(b), ΔE(L90+S13.68)>ΔE(90) and>ΔE(13.68); while at high doses of lactoferrin gastrointestinal digests, the NO secretion in the combination group with sodium selenite gastrointestinal digests was lower than that of the single-component lactoferrin gastrointestinal digests at the same concentration.
[0127] Unexpectedly, it was found that when each component was used alone, its effect on NO release from cells stimulated by LPS was strongly dose-dependent. However, when the two gastrointestinal digestive products were combined, this dose-dependency disappeared. Therefore, it can be determined that a better synergistic effect can be achieved when the concentration of lactoferrin gastrointestinal digestive product in the nutritional composition is 90-180 μg / mL and the concentration of selenium gastrointestinal digestive product is 13.68-27.4 μg / mL.
[0128] (2) Cellular phagocytic capacity
[0129] The phagocytic function of macrophages is one of the main mechanisms by which the body defends against the invasion of foreign substances, and can directly or indirectly reflect the immune response capacity of macrophages. Table 5 shows the effects of different concentrations of nutrient compositions on the phagocytic capacity of cells stimulated by LPS in the examples and comparative examples.
[0130] Table 5. Effects of different concentrations of nutrient compositions on LPS-induced macrophage phagocytic capacity.
[0131]
[0132] Please refer to Table 5. Compared with the negative control group, the addition of LPS significantly increased phagocytic capacity (P<0.01). When lactoferrin or sodium selenite was added 1 h before LPS stimulation, phagocytic capacity decreased significantly compared to the positive control group. At high doses of lactoferrin, phagocytic capacity decreased significantly compared to the positive control group (P<0.05). Adding a compound 1 h before LPS stimulation showed that a specific concentration ratio of lactoferrin to selenium in the compound (LF: 90-180 μg / mL, Se: 13.68-27.4 ng / mL) significantly modulated LPS-induced macrophage over-phagocytosis. At high doses of lactoferrin, the compound with selenium showed similar modulating effects on phagocytic capacity as the single-component lactoferrin at the same concentration. Unexpectedly, when each component was used alone, its effect on LPS-induced macrophage hyperphagocytosis was strongly dose-dependent. However, when the two digests were combined, this dose-dependency disappeared. The combination of low-concentration digests (LF 90 μg / mL + Se 13.68 ng / mL) showed the strongest regulatory effect, and the phagocytic capacity was significantly lower than that of the positive control group (P<0.05).
[0133] (3) Cellular ROS release
[0134] ROS is a highly reactive chemical substance containing oxygen free radicals and a major mediator of cellular oxidative stress. Pro-inflammatory factors such as ROS can activate NF-κB, causing it to translocate to the cell nucleus, thereby promoting the transcription of inflammatory factors. Excessive intracellular ROS can also damage mitochondria by reducing mitochondrial membrane potential. The effects of different concentrations of nutrient compositions in the examples and comparative examples on phagocytic capacity of cells stimulated by LPS are shown in Table 6.
[0135] Table 6. Effects of different concentrations of nutrient compositions on ROS release from cells stimulated by LPS.
[0136]
[0137] Please refer to Table 6. Compared with the negative control group, the addition of LPS significantly increased cellular ROS secretion (P<0.0001). Adding lactoferrin gastrointestinal digest 1 h before LPS stimulation significantly reduced cellular ROS secretion compared to the positive control group (P<0.05). Adding sodium selenite gastrointestinal digest 1 h before LPS stimulation, under medium and high doses, reduced cellular ROS secretion compared to the positive control group, but the difference was not significant. Adding different concentrations of the compound 1 h before LPS stimulation significantly reduced ROS secretion compared to the positive control group (P<0.0001), and also reduced it compared to any single group, indicating that the compound can attenuate the increase in ROS secretion induced by LPS stimulation.
[0138] Secondly, according to the results in Table 6, lactoferrin (LF) and selenium (Se) at a concentration ratio of LF: 90-180 μg / mL and Se: 13.68-27.4 ng / mL significantly modulate LPS-stimulated ROS release in cells. Furthermore, the effect of LPS-induced macrophage overgrowth induced by a single lactoferrin digestion product was strongly dose-dependent, but this dose-dependency disappeared when the two digestion products were combined; moreover, the combination altered the effect of a single sodium selenite digestion product on reducing LPS-stimulated ROS secretion. Therefore, it can be determined that the low concentration combination of digestion products (LF 90 μg / mL + Se 13.68 ng / mL) exhibited the strongest regulatory effect and was the most potent antioxidant among all combinations.
[0139] (4) Expression of inflammatory factors
[0140] IL-β and TNF-α are the most common pro-inflammatory factors. Experiments were conducted using lactoferrin digestion solution, selenium digestion solution, and their mixtures. The results are shown in Tables 7-8.
[0141] Table 7. Effects of different concentrations of nutrient compositions on IL-β in cells stimulated by LPS.
[0142]
[0143] Table 8. Effects of different concentrations of nutrient compositions on TNF-α in cells stimulated by LPS.
[0144]
[0145] Please refer to Table 7. Compared with the negative control group, the IL-1β secretion in the positive control group was significantly increased (P<0.0001). Adding lactoferrin gastrointestinal digest 1 h before LPS stimulation significantly reduced IL-1β secretion compared to the positive control group (P<0.05). Adding sodium selenite gastrointestinal digest 1 h before LPS stimulation also significantly reduced IL-1β secretion compared to the positive control group (P<0.05). Adding a combination of lactoferrin and sodium selenite gastrointestinal digest 1 h before LPS stimulation significantly reduced IL-1β secretion compared to the positive control group (P<0.01), and also reduced it compared to any single group, indicating that the combination can attenuate LPS-induced IL-1β secretion.
[0146] Furthermore, Table 7 shows that when each component is used alone, the effect of LPS-induced IL-1β secretion on cells is strongly dose-dependent; however, this dose-dependency disappears when the two digestive products are combined. Lactoferrin (LF) and selenium (Se) gastrointestinal digestive products, at a concentration ratio of LF: 90-180 μg / mL and Se: 13.68-27.4 ng / mL, exhibit significant immunomodulatory effects on LPS-stimulated IL-1β secretion. It can be determined that the low-concentration combination of digestive products (LF 90 μg / mL + Se 13.68 ng / mL) shows a strong regulatory effect, with the highest synergistic efficiency in the low concentration range, making it the optimal ratio for inhibiting IL-1β secretion.
[0147] Regarding Table 8, for TNF-α, the secretion of TNF-α in the positive control group was significantly increased compared with the negative control group (P<0.0001). Adding lactoferrin or selenium-enriched gastrointestinal digests 1 h before LPS stimulation reduced TNF-α levels compared to the positive control group, but not significantly (P>0.05). However, adding different concentrations of the compound 1 h before LPS stimulation significantly reduced TNF-α secretion compared to the positive control group (P<0.01), and also lower than any single group, indicating that the compound induced TNF-α secretion by LPS stimulation. Furthermore, the results showed that when each component was used alone, its effect on LPS-induced TNF-α secretion was strongly dose-dependent, but this dose-dependency disappeared when two digests were combined.
[0148] Furthermore, as shown in Table 8, lactoferrin (LF) and selenium (Se) exhibited significant immunomodulatory effects on TNF-α secreted by cells stimulated by LPS when the concentration ratio was LF: 90-180 μg / mL and Se: 13.68-27.4 ng / mL. It was determined that the low concentration combination of digestate (LF 90 μg / mL + Se 13.68 ng / mL) showed the strongest synergistic regulatory effect.
[0149] (5) Expression of cell pathway proteins TLR4 and NF-κB mRNA
[0150] LPS binds to macrophages via the cell membrane surface receptor TLR4, activating cellular immune regulation through the MAPK and NF-κB pathways. NF-κB, as a nuclear transcription factor, is readily activated, inducing a signaling cascade, nuclear translocation, initiating transcription of downstream genes, and promoting protein expression and the synthesis and secretion of inflammation-related factors. This study investigated the effects of different compound digests on the mRNA expression of TLR4 and NF-κB pathway proteins in cells; the results are shown in Tables 9-10.
[0151] Table 9. Effects of different concentrations of nutrient compositions on TLR4 mRNA expression in cells stimulated by LPS.
[0152]
[0153] Table 10 Effects of different concentrations of nutrient compositions on NF-κb mRNA expression in cells stimulated by LPS
[0154]
[0155] Please refer to Tables 9-10. Compared with the negative control, the expression levels of TLR4 and NF-κb mRNA in cells significantly increased after LPS stimulation. Adding lactoferrin and sodium selenite digest 1 h before LPS stimulation significantly reduced TLR4 and NF-κb mRNA expression in cells compared to the positive control (P<0.05). These results indicate that the immunomodulatory effects of lactoferrin and sodium selenite digest on LPS-stimulated cells involve the TLR4-NF-κb pathway. Adding different concentrations of the compound combination 1 h before LPS stimulation significantly lowered TLR4 and NF-κb mRNA expression in the compound group compared to the positive control (P<0.05), and the compound group also showed significantly lower levels than any single component. Therefore, compared to lactoferrin or sodium selenite, the compound combination can better inhibit the expression of inflammatory pathway proteins.
[0156] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.
Claims
1. The application of a nutritional composition in the preparation of immunomodulatory products, characterized in that, The nutritional composition contains lactoferrin gastrointestinal digests and selenium gastrointestinal digests; The nutritional composition contains lactoferrin gastrointestinal digests at a content of 80-180 μg / mL; and selenium gastrointestinal digests at a content of 12-28 ng / mL (based on selenium element); the immunomodulation includes inhibiting the activation of the TLR4 / NF-κB inflammatory signaling pathway and reducing the expression of TLR4 mRNA and / or NF-κB mRNA. Preparation of the lactoferrin gastrointestinal digest: Lactoferrin was dissolved in deionized water at a concentration of 50 mg / mL and stirred overnight to obtain a lactoferrin solution. Then, the lactoferrin solution was stabilized in a water bath at 37°C for 2-3 min, followed by mixing with simulated gastric juice containing 4000 U / mL pepsin at a 1:1 volume ratio. Subsequently, 6 M hydrochloric acid was added dropwise to maintain the pH of the system at 3.
0. After reacting for 120 min, 2 M sodium hydroxide was added to adjust the pH of the system to 7.0, yielding a lactoferrin gastric digest sample. Next, an equal volume of simulated intestinal juice containing 200 U / mL trypsin was added to the lactoferrin gastric digest sample, maintaining the pH of the system at 7.
0. After reacting for 120 min, an intestinal digest sample of lactoferrin was obtained. Finally, the intestinal digest sample of lactoferrin was heated at 95°C for 5 min to inactivate the enzymes, thus obtaining the lactoferrin gastrointestinal digest. Preparation of the selenium-enriched gastrointestinal digest: Sodium selenite was dissolved in deionized water at a concentration of 17 mg / mL and stirred overnight to obtain a sodium selenite solution. The sodium selenite solution was then stabilized in a water bath at 37°C for 2-3 min, followed by mixing with simulated gastric juice containing 4000 U / mL pepsin at a 1:1 volume ratio. Subsequently, 6 M hydrochloric acid was added dropwise to maintain the pH of the system at 3.
0. After reacting for 120 min, 2 M sodium hydroxide was added to adjust the pH to 7.0, yielding a sodium selenite gastric digest sample. Next, an equal volume of simulated intestinal juice containing 200 U / mL trypsin was added to the sodium selenite gastric digest sample, maintaining the pH at 7.
0. After reacting for 120 min, a sodium selenite intestinal digest sample was obtained. Finally, the sodium selenite intestinal digest sample was heated at 95°C for 5 min to inactivate the enzymes, thus obtaining the selenium-enriched gastrointestinal digest. Preparation of simulated gastric juice: 6.9 mM potassium chloride, 0.9 mM potassium dihydrogen phosphate, 72.2 mM sodium chloride, 0.1 mM magnesium chloride, 0.5 mM ammonium carbonate, 0.15 mM calcium chloride, 4000 U / mL pepsin, pH=3.0; Preparation of simulated intestinal fluid: 6.8 mM potassium chloride, 0.8 mM potassium dihydrogen phosphate, 123.4 mM sodium chloride, 0.33 mM magnesium chloride, 0.6 mM calcium chloride, 20 mM bile salts, 200 U / mL trypsin, pH=7.
0.
2. The application according to claim 1, characterized in that, The nutritional composition contains 90 μg / mL lactoferrin gastrointestinal digests and 13.68 ng / mL selenium gastrointestinal digests.
3. The application according to claim 1 or 2, characterized in that, The immune modulation includes mitigating excessive immune responses and / or mitigating oxidative stress.
4. The application according to claim 1 or 2, characterized in that, The immune regulation includes inhibiting the excessive release of nitric oxide from macrophages induced by lipopolysaccharide.
5. The application according to claim 1 or 2, characterized in that, The immune regulation includes inhibiting the excessive release of reactive oxygen species induced by lipopolysaccharide.
6. The application according to claim 1 or 2, characterized in that, The immune regulation includes modulating the phagocytic function of macrophages under lipopolysaccharide stimulation, causing them to revert from an overactivated state to a resting state.
7. The application according to claim 1 or 2, characterized in that, The immune regulation includes reducing the expression of lipopolysaccharide-induced inflammatory factors, namely IL-1β and TNF-α.
8. An immunomodulatory agent, characterized in that, The formulation comprises an effective amount of the nutritional composition as described in claim 1 or 2, and a pharmaceutically or food-grade acceptable carrier.