Oligopeptide from old rice and application of oligopeptide in regulation and control of lipid metabolism
By screening and synthesizing oligopeptides FVPQ, SGW, EQGW, and SWGQ derived from aged rice protein, the PPARγ pathway is activated, solving the side effects problem of chemical drugs in regulating lipid metabolism disorders. This provides a safe and effective natural lipid-lowering solution with broad application prospects.
Patent Information
- Application Number
- CN202511643228.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-11
- Publication Date
- 2026-02-13
AI Technical Summary
Existing chemical drugs have significant side effects when regulating lipid metabolism disorders, and there is a lack of safe and effective natural lipid-lowering active substances.
By screening and synthesizing oligopeptides FVPQ, SGW, EQGW, and SWGQ derived from aged rice protein, and utilizing their activation of the PPARγ pathway to exert lipid-lowering effects, these peptides were prepared into drugs or health products. They were artificially synthesized using the Fmoc solid-phase synthesis method, and their safety and efficacy were confirmed through cell experiments.
The oligopeptides are non-toxic and not digested by the gastrointestinal tract. They exert their lipid-lowering effect through the PPARγ pathway, have clear targets and regulatory mechanisms, and are suitable for pharmaceuticals and health products, with broad market prospects.
Smart Images

Figure CN121517499A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of bioactive peptides and the treatment of lipid metabolism disorders. Specifically, this application provides oligopeptides derived from aged rice and their application in regulating lipid metabolism. Background Technology
[0002] With global economic development and changing lifestyles, lipid metabolism disorders have become a major contributing factor to various chronic diseases. These metabolic disorders not only significantly increase the risk of obesity and metabolic syndrome but are also closely associated with various liver-related diseases. Therefore, timely prevention and treatment are crucial. Currently, conventional treatment mainly relies on chemical drugs such as statins and fibrates. Although these drugs are effective in regulating blood lipid levels and reducing metabolic risk, long-term use often results in side effects such as liver damage and gastrointestinal discomfort. Therefore, developing safe and effective natural lipid-lowering substances has become a key research focus.
[0003] In recent years, bioactive peptides derived from plant proteins have attracted increasing attention due to their potential in regulating lipid metabolism. Lipid metabolism disorders, especially the excessive accumulation of fatty acids, are often regulated through nuclear receptors such as peroxisome proliferator-activated receptor γ (PPARγ). PPARγ is a key transcription factor in lipid homeostasis regulation, exerting its function by regulating its own expression and the expression of various downstream metabolism-related genes, such as CD36 and FABP family members involved in fatty acid uptake, lipid droplet formation, and genes like CPT1A and HADHA, which play crucial roles in the mitochondrial β-oxidation pathway. In recent years, PPARγ has been identified as an effective therapeutic target for lipid metabolism disorders. Numerous studies have shown that various bioactive peptides derived from food can improve lipid accumulation, oxidative stress, and cholesterol metabolism disorders by regulating the PPARγ signaling pathway.
[0004] Aged rice (or rice stored for extended periods) is japonica rice from the genus *Oryza* of the Poaceae family that has undergone processing and storage for many years, resulting in discoloration. Its sensory quality declines during storage, rendering it unsuitable as a staple food. Therefore, how to enhance its value has become a key research focus. Despite the long storage time, its protein components still possess strong stability and activity potential. Existing studies have shown that long-term storage has a limited impact on the total protein content of aged rice; although some structural denaturation may occur, its hydrolysates still possess good biological activity. In recent years, the role of food-derived peptides in regulating lipid metabolism has received increasing attention. Studies have found that rice protein peptides can improve alcoholic liver disease in mice by activating the PPARγ pathway, highlighting their potential for regulating lipid metabolism. However, there is currently no direct evidence to suggest whether aged rice protein hydrolysates have a similar lipid-lowering effect. Given the structural similarity between aged rice protein and fresh rice protein, its hydrolysates may retain active domains regulating lipid metabolism, thus potentially exerting their effects through the PPARγ pathway. Summary of the Invention
[0005] The applicant screened oligopeptides with strong biological activity using technologies such as ultrafiltration, mass spectrometry sequencing, and bioinformatics. Using HepG2 cells as a model, the MTT assay was employed to evaluate the effects of the oligopeptides on cell viability and the safe concentration range. Furthermore, the effects on cellular lipid accumulation and the expression of PPARγ-related genes (such as FABPs, CD36, CPT1A, HADHA, and PPARγ itself) were assessed in a palmitic acid-induced HepG2 cell steatosis model. Technical support will be provided for the development of related products.
[0006] On the one hand, this application provides oligopeptides derived from aged rice, wherein the amino acid sequence of the oligopeptides is FVPQ, SGW, EQGW or SWGQ.
[0007] On the other hand, this application provides the use of the above-mentioned oligopeptides in the preparation of lipid-lowering drugs.
[0008] Furthermore, the blood lipids refer to total cholesterol and / or triglycerides.
[0009] Furthermore, the drug is an oral dosage form.
[0010] On the other hand, this application provides a lipid-lowering drug, which includes the above-mentioned oligopeptide.
[0011] On the other hand, this application provides the application of the above-mentioned oligopeptides in the preparation of health products that help maintain healthy blood lipid levels.
[0012] Furthermore, the drug is an oral dosage form.
[0013] On the other hand, this application provides health supplements that help maintain healthy blood lipid levels, wherein the health supplements include the aforementioned oligopeptides.
[0014] In addition to oral dosage forms, the oligopeptides of this application can also be prepared into dosage forms such as injections.
[0015] In addition to oligopeptides, the pharmaceuticals or health products of this application may also include excipients acceptable in the pharmaceutical or health product fields. These excipients include, but are not limited to, solvents, solubilizers, suspending agents, antioxidants, pH adjusters, osmotic pressure adjusters, coating agents, capsules, binders, fillers, sustained-release agents, lubricants, etc. Those skilled in the art can use these excipients according to regulations and conventional techniques in the pharmaceutical field to prepare formulations such as aqueous injections, powder injections, tablets, capsules, and oral liquids.
[0016] On the other hand, this application provides a solid-phase synthesis method for preparing the above-mentioned oligopeptides, the method comprising: (1) resin swelling; (2) removal of Fmoc protecting groups; (3) amino acid coupling reaction; (4) removal of Fmoc protecting groups after coupling; (5) repeating the coupling and removal steps; (6) resin washing and drying; (7) peptide chain cleavage and side chain deprotection; and (8) quality detection of the artificially synthesized oligopeptides.
[0017] The purpose of this invention is to address the significant side effects of current lipid metabolism regulation therapies. This invention first obtains rice protein hydrolysate via alkaline protease hydrolysis, then screens for bioactive peptides using ultrafiltration, mass spectrometry sequencing, and bioinformatics techniques. Finally, candidate oligopeptides are prepared using the Fmoc solid-phase synthesis method, and cell experiments confirm that they exert lipid-lowering effects by activating the PPARγ signaling pathway. The four oligopeptides derived from aged rice protein described in this invention—phenylalanine-valine-proline-glutamine (Phe-Val-Pro-Gln, FVPQ), serine-glycine-tryptophan (Ser-Gly-Trp, SGW), glutamate-glutamine-glycine-tryptophan (Glu-Gln-Gly-Trp, EQGW), and serine-tryptophan-glycine-glutamine (Ser-Trp-Gly-Gln, SWGQ)—can exert lipid-lowering effects through the PPARγ pathway. They are non-toxic, not digested by the gastrointestinal tract, and possess biological activity. They are naturally derived and can also be synthesized artificially. They have small molecular weights, are easily modified and engineered, and have clearly defined targets and regulatory mechanisms. They are expected to be widely used as functional components in pharmaceuticals and have broad market prospects. Attached Figure Description
[0018] Figure 1A This is a high-performance liquid chromatography (HPLC) result of FVPQ.
[0019] Figure 1B This is a chromatogram of the high performance liquid chromatography (HPLC) results for SGW.
[0020] Figure 1CThis is a chromatogram of the high performance liquid chromatography (HPLC) results for EQGW.
[0021] Figure 1D This is a chromatogram of the high performance liquid chromatography (HPLC) results for SWGQ.
[0022] Figure 2A This is a graph showing the mass spectrometry analysis results of FVPQ.
[0023] Figure 2B This is a graph showing the mass spectrometry analysis results of SGW.
[0024] Figure 2C This is a graph showing the mass spectrometry analysis results of EQGW.
[0025] Figure 2D This is a graph showing the mass spectrometry analysis results from SWGQ.
[0026] Figure 3A The image shows the results of MTT assay for detecting the viability of HepG2 cells under different peptide treatments.
[0027] Figure 3B This image shows the results of Oil Red O staining of cells after FVPQ treatment.
[0028] Figure 3C This is a graph showing the quantitative results of lipid accumulation in cells after FVPQ treatment.
[0029] Figure 3D This image shows the results of Oil Red O staining of cells after SGW treatment.
[0030] Figure 3E This is a graph showing the quantitative results of lipid accumulation in cells after SGW treatment.
[0031] Figure 3F This image shows the results of Oil Red O staining of cells after EQGW treatment.
[0032] Figure 3G The graph shows the quantitative results of lipid accumulation in cells after EQGW treatment.
[0033] Figure 3H This image shows the results of Oil Red O staining of cells after SWGQ treatment.
[0034] Figure 3I This is a graph showing the quantitative results of lipid accumulation in cells after SWGQ treatment.
[0035] Figure 3J The figure shows the effect of four oligopeptide treatments on intracellular total cholesterol (TC) levels.
[0036] Figure 3K The figure shows the effect of four oligopeptide treatments on intracellular triglyceride (TG) levels.
[0037] Figure 4ATo investigate the effects of different concentrations of FVPQ on the mRNA expression levels of PPARγ signaling pathway-related genes (FABP1, FABP2, FABP4, CD36, CPT1A, HADHA, and PPARγ) in PA-induced HepG2 cells.
[0038] Figure 4B To investigate the effects of different concentrations of SGW on the mRNA expression levels of PPARγ signaling pathway-related genes (FABP1, FABP2, FABP4, CD36, CPT1A, HADHA, and PPARγ) in PA-induced HepG2 cells.
[0039] Figure 4C To investigate the effects of different concentrations of EQGW on the mRNA expression levels of PPARγ signaling pathway-related genes (FABP1, FABP2, FABP4, CD36, CPT1A, HADHA, and PPARγ) in PA-induced HepG2 cells.
[0040] Figure 4D To investigate the effects of different concentrations of SWGQ on the mRNA expression levels of PPARγ signaling pathway-related genes (FABP1, FABP2, FABP4, CD36, CPT1A, HADHA, and PPARγ) in PA-induced HepG2 cells. Detailed Implementation
[0041] Example 1: Extraction of protein from aged rice
[0042] The pulverized aged rice was mixed with n-hexane at a ratio of 1:4 (mass / volume) and stirred continuously at 25°C for 4 hours. The residue was then collected by vacuum filtration and subjected to two consecutive degreasing processes under the same conditions. After degreasing, the dried degreased aged rice flour was placed in a fume hood and allowed to stand for 12 hours, after which it was stored at 4°C for later use.
[0043] Weigh 25 g of defatted aged rice flour and stir continuously for 1 hour in 250 mL of 0.05 mol / L NaOH solution. Then, centrifuge at 7000 rpm for 20 minutes, collect the supernatant, and adjust the pH to 4.6 using 1 mol / L HCl. Let stand for 12 hours to promote protein precipitation, collect the precipitate, and wash three times with distilled water. Then adjust the pH to 7.0 and freeze-dry the precipitate at −60℃ for 48 hours. The resulting aged rice protein sample is stored at −20℃ for subsequent use.
[0044] Example 2: Preparation of crude peptides by alkaline protease hydrolysis
[0045] Dissolve 5 grams of aged rice protein in 100 ml of distilled water to prepare a protein solution, and adjust the pH to 10.5. Then add alkaline protease with an enzyme activity of 10,000 U / g and hydrolyze at a constant temperature of 40°C for 3 hours. After hydrolysis, heat the mixture to 95°C and incubate for 10 minutes to inactivate the enzyme. Centrifuge at 5500 rpm for 15 minutes at 4°C and collect the supernatant (crude aged rice peptides).
[0046] Example 3: Preparation and Identification of Crude Peptide <3kDa Fraction
[0047] Take 10 mL of aged rice protein hydrolysate and transfer it to a 3 kDa centrifuge ultrafiltration tube. Centrifuge at 8000 rpm for 15 minutes at 4℃ to obtain a crude aged rice peptide solution with a molecular weight of less than 3 kDa. Freeze-dry and store at -20℃.
[0048] The sample was analyzed by LC-MS / MS equipped with an online nanospray ionization source. The entire system was an Orbitrap Eclipse mass spectrometer (ThermoFisher Scientific, MA, USA) connected in series with an UltiMate 3000 system (ThermoFisher Scientific, MA, USA). A total of 1 μL of sample was loaded (C18 column: 20 cm × 75 μm id, 1.9 μm particle size). The sample was separated by a gradient of 60 min, with the column flow rate controlled at 300 nL / min, the column temperature at 40 °C, and the electrospray voltage at 2 kV. The gradient started from 2.2% B phase, increased non-linearly to 44% at 45 min, increased to 90% within 3 min, and maintained for 12 min.
[0049] The mass spectrometer operates in data-dependent acquisition mode, automatically switching between MS and MS / MS acquisition. The mass spectrometry parameters are set as follows: (1) MS: Scan range (m / z): 200-1200; Resolution: 60,000; AGC target: 4e5; Maximum injection time: 50 ms; (2) HCD-MS / MS: Resolution: 15,000; AGC target: 5e4; Maximum injection time: 22ms; Collision energy: 30%; Dynamic exclusion time: 30 s.
[0050] Tandem mass spectra were analyzed using PEAKS Studio version 10.6 (Bioinformatics Solutions Inc., Waterloo, Canada). The database used was uniprot-Oryza_sativa_subsp_indica (version 2024, 37343 entries). Enzymatic digestion was performed with the option set to None. Search parameters included a fragment ion mass tolerance of 0.02 Da and a precursor ion mass tolerance of 10 ppm. Protein card values indicated the presence of at least one unique peptide; peptide card values were -10lgP ≥ 20. Peptides not found in the database were obtained by setting ALC (%) ≥ 90. Some typical results are shown in Table 1.
[0051] Example 4: Screening of bioactive peptides based on bioinformatics technology
[0052] As functional components for drug development, bioactive peptides need to be non-toxic and possess high bioactivity. Gastrointestinal metabolism is a major limiting factor for peptide absorption, while oligopeptides composed of 2-5 amino acids with a molecular weight less than 1000 Da can avoid enzymatic degradation in the gastrointestinal tract. Therefore, based on bioinformatics technology, target oligopeptides meeting development requirements were screened from peptides with a molecular weight less than 3 kDa according to criteria such as molecular weight <1000 Da, non-toxicity, high bioactivity, and resistance to gastrointestinal digestion. Peptide toxicity was predicted using the online platform ToxinPred (https: / / webs.iiitd.edu.in / raghava / toxinpred / index.html), which is based on the SVM (Swiss-Prot) algorithm. The potential bioactivity of peptides was evaluated using PeptideRanker (http: / / distilldeep.ucd.ie / PeptideRanker / ), with peptides scoring higher than 0.5 considered bioactive. The gastrointestinal stability of the peptides was assessed using the PeptideCutter tool (https: / / web.expasy.org / peptide_cutter / ), which is based on the simulated digestive reactions of pepsin and trypsin. Finally, candidate peptides were screened according to the following criteria: molecular weight less than 1000 Da, non-toxic, high bioactivity (>0.5), and resistance to gastrointestinal digestion. For the first time, previously unreported oligopeptides FVPQ (SEQ ID NO.1), SGW, EQGW (SEQ ID NO.2), and SWGQ (SEQ ID NO.3) were screened from aged rice protein (Table 1).
[0053] Table 1. Bioinformatics-based prediction of the properties of Chencang rice peptides
[0054] peptide sequence Retention time M / Z molecular weight toxicity Potential biological activity Gastrointestinal digestive SWGQ 18.12 477.211 476.2019 Non-toxic 0.76182 Indigestion FVPQ 20.25 490.2679 489.2587 Non-toxic 0.539191 Indigestion EQGW 23.97 519.2213 518.2125 Non-toxic 0.531352 Indigestion SGW 14.23 349.1517 348.1434 Non-toxic 0.964287 Indigestion
[0055] Example 5 Artificial Synthesis of Oligopeptides
[0056] The oligopeptides FVPQ, SGW, EQGW, and SWGQ were prepared using the Fmoc solid-phase synthesis method, as detailed below:
[0057] (1) Resin swelling
[0058] Weigh the required amount of Wang resin coupled with Fmoc-amino acids into a clean, dry reaction tube. Add dichloromethane (DCM) and allow to swell at room temperature for 20 minutes.
[0059] (2) Removal of Fmoc protecting groups
[0060] After swelling, add 3 times the resin volume of 20% piperidine / DMF solution, purge with nitrogen for 30 minutes, and then dry under vacuum to remove Fmoc groups. After the reaction is complete, wash 5 times with 2 times the resin volume of DMF to completely remove residual solvent and prepare for subsequent coupling.
[0061] (3) Amino acid coupling reaction
[0062] According to the molar ratio of amino acid:DIPEA:HBTU:resin = 3:6:1.85:1, take Fmoc-protected amino acid, DIPEA, and condensation reagent HBTU, and dissolve them in an appropriate amount of DMF. After the solution is prepared, add it to the resin and react at room temperature for 30 minutes. After the reaction is completed, wash three times with twice the resin volume of DMF to remove unreacted residues.
[0063] (4) Removal of Fmoc protecting groups after coupling
[0064] Add 3 times the resin volume of 20% piperidine / DMF solution, purge with nitrogen and stir for 30 minutes to remove the coupled Fmoc protecting group; wash 5 times with 2 times the resin volume of DMF after the reaction.
[0065] (5) Repeated coupling and decoupling steps
[0066] Repeat the above steps until the target peptide chain is synthesized and finally the terminal Fmoc group is removed.
[0067] (6) Resin washing and drying
[0068] Wash the resin three times with methanol and then dry it in preparation for the cutting step.
[0069] (7) Peptide chain cleavage and side chain deprotection
[0070] Add 6 times the resin volume of cutting fluid (TFA:H2O = 97.5:2.5, v / v) and shake in a shaker at room temperature for 2 hours. After the cutting reaction is complete, filter to remove the resin, collect the filtrate, and add anhydrous diethyl ether to precipitate the crude peptide. After centrifugation to separate the precipitate, wash three times with anhydrous diethyl ether, dry under vacuum, and then dry in a vacuum desiccator at room temperature for 24 hours to obtain the target crude peptide fragment. After dissolving in pure water, desalt and purify by HPLC, and lyophilize to precipitate crystals.
[0071] (8) Quality testing of artificially synthesized oligopeptides
[0072] A small amount of lyophilized powder sample was dissolved under ultrasonic conditions and then analyzed. The purity of the sample was determined using analytical high-performance liquid chromatography (HPLC). The HPLC analysis conditions were as follows: mobile phase A was 100% acetonitrile containing 0.1% trifluoroacetic acid, mobile phase B was 100% water containing 0.1% trifluoroacetic acid, the flow rate was set to 1.0 mL / min, and the detection wavelength was 214 nm.
[0073] For FVPQ, the chromatographic column is Kromasil 5C18-MS-Ⅱ 4.6 ID*250mm, the injection volume is 20μL, and the gradient program is as follows:
[0074] Table 2 FVPQ Chromatographic Procedure
[0075] Time / min Phase A Phase B 0.01 5% 95% 25.0 50% 50% 30 90% 10%
[0076] For SGW, the chromatographic column was Kromasil 5C18-MS-Ⅱ 4.6 ID*250mm, the injection volume was 20μL, and the gradient program was as follows:
[0077] Table 3 SGW Chromatographic Procedure
[0078] Time / min Phase A Phase B 0.01 5% 95% 25.0 50% 50% 30 90% 10%
[0079] For EQGW, the chromatographic column was Kromasil 5C18-MS-Ⅱ 4.6 ID*250mm, the injection volume was 20μL, and the gradient program was as follows:
[0080] Table 4 EQGW Chromatographic Program
[0081] Time / min Phase A Phase B 0.01 5% 95% 25.0 50% 50% 30 90% 10%
[0082] For SWGQ, the chromatographic column was Kromasil 5C18-MS-Ⅱ 4.6 ID*250mm, the injection volume was 20μL, and the gradient program was as follows:
[0083] Table 5 SWGQ Chromatographic Procedures
[0084] Time / min Phase A Phase B 0.01 5% 95% 25.0 50% 50% 30 90% 10%
[0085] The parameters of the Waters ZQ2000 mass spectrometer are as follows: ion source is an electrospray ionization source (ESI source), nebulizer gas flow rate: 1.5 L / min, CDL: -20.0 V, CDL temperature: 250 °C, heating block temperature: 200 °C, ion source voltage: +4.5 kV, detector voltage: 1.5 kV, mobile phase flow rate: 0.2 mL / min, mobile phase ratio: 50% H2O / 50% ACN.
[0086] Finally, high-performance liquid chromatography and mass spectrometry analysis confirmed that the purity of all four oligopeptides was greater than 95%. Specific chromatographic and mass spectrometry results are shown below. Figures 1A-1D and Figures 2A-2D .
[0087] Example 6: Verification of in vitro lipid-lowering effect
[0088] Human hepatocellular carcinoma line HepG2 was cultured at 37°C under a humidified environment of 5% CO2. Cells were grown in Dulbecco modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The medium was changed every two days until the cell density reached 80–90%. Cells were then digested and collected using a digestion solution containing 0.25% trypsin and 0.02% EDTA. Cell viability was assessed using the MTT assay. HepG2 cells were cultured at 5 × 10⁶ cells / well. 4 Cells were seeded at a density of 100 μL in each well of a 96-well plate. After cell attachment, the original medium was replaced with serum-free DMEM, and different concentrations of the target peptides (SWGQ, FVPQ, SGW, EQGW) were added. The plates were then cultured for another 24 hours. An equal volume of solvent was added to the control group. After 24 hours of culture, the medium was carefully removed, and 200 μL of MTT solution (0.5 mg / mL) was added to each well. The plates were incubated at 37°C for another 4 hours. The supernatant was then carefully discarded, and 150 μL of DMSO was added to each well to dissolve the generated formazan crystals. Finally, the absorbance was measured at 490 nm using a microplate reader.
[0089] The effects of four oligopeptides on intracellular lipid accumulation were assessed using an Oil Red O staining kit. After treatment, cells were washed three times with phosphate-buffered saline (PBRS) and then stained with Oil Red O staining solution according to the kit instructions. The stained cells were observed under an inverted microscope, and the lipid droplet content was quantitatively analyzed using ImageJ software.
[0090] After treatment, cell suspensions were collected from each group. Intracellular total cholesterol (TC) and triglyceride (TG) levels were measured according to the kit instructions (Solarbio Life Sciences, Beijing) to evaluate the regulatory effect of oligopeptides on lipid metabolism.
[0091] In vitro assays showed that FVPQ and SGW had a slight inhibitory effect on cell viability at concentrations above 2.5 mg / mL, while no significant cytotoxicity was observed at concentrations less than or equal to 2.25 mg / mL. EQGW caused a decrease in cell viability only at a concentration of 10 mg / mL, while cell viability remained above 90% at all other concentrations. SWGQ did not show cytotoxicity at any of the tested concentrations. Figure 3A In a palmitic acid (PA)-induced hyperlipidemic HepG2 cell model, the effects of these four peptides on intracellular lipid accumulation and lipid metabolism indicators were evaluated. Figure 3B – Figure 3K Oil Red O staining results showed that, compared with the model group, all four peptides reduced intracellular lipid accumulation. FVPQ and SGW showed the most significant lipid-lowering effects at a concentration of 0.6 mg / mL (p < 0.05), while EQGW and SWGQ showed the most significant effects at a concentration of 2.5 mg / mL (p < 0.05). Figure 3B – Figure 3I Further intracellular lipid biochemical analysis showed that all four peptides significantly reduced total cholesterol (TC) and triglyceride (TG) levels in PA-induced HepG2 cells. Compared with the model group, FVPQ and SGW showed the most significant reductions in TC and TG levels at a concentration of 0.6 mg / mL (p < 0.05), while EQGW and SWGQ showed the largest reductions at a concentration of 2.5 mg / mL (p < 0.05). Figure 3J – Figure 3K This result is consistent with the findings observed using Oil Red O staining. In summary, all four candidate peptides screened exhibited good lipid-lowering activity at the cellular level.
[0092] Example 7: Analysis of the lipid-lowering mechanism of oligopeptides
[0093] Total RNA was extracted from cells using the RNA-easy Isolation Reagent kit (Tiangen Biotech, Beijing, China), and RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Following the manufacturer's instructions, RNA was reverse transcribed into cDNA using PrimeScript™ RT Master Mix (Takara, Japan). Real-time quantitative PCR was then performed using 2× SYBR qPCR Master Mix (Takara, Japan) to detect mRNA expression levels. All primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd., and primer sequences are shown in Table 2.
[0094] Table 6 Primer Sequences
[0095] Gene Primer sequence (5'-3') FABP1 F- GTGTCGGAAATCGTGCAGAAT (SEQ ID NO.4) R- GACTTTCTCCCCTGTCATTGTC (SEQ ID NO.5) FABP2 F- TGGCGTTTGACAGCACTTGG (SEQ ID NO.6) R-AGCTTCAAATTGTCATGAGCTGCA (SEQ ID NO.7) FABP4 F-ACAGGAAAGTCAAGAGCACCATAACC (SEQ ID NO.8) R-TGACGCATTCCACCACCAGTTTATC (SEQ ID NO.9) CD36 F- CAGGACCGCTGAGGACAACACAG (SEQ ID NO.10) R-TGCCACAGCCAGATTGAGAACTG (SEQ ID NO.11) CPT1A F- GAGCGACTGGTGGGAGGAGTAC (SEQ ID NO.12) R- TGCTGCCTGAATGTGAGTTGGAAG (SEQ ID NO.13) HADHA F-GTCTTTGGAAGTTTTCTCGGTC (SEQ ID NO.14) R-GTCTTTGGAAGTTTTCTCGGTC (SEQ ID NO.15) GAPDHF F-CAGGAGGCATTGCTGATGAT (SEQ ID NO.16) R- GAAGGCTGGGGCTCATTT (SEQ ID NO.17) PPARγ F-GGGATCAGCTCCGTGGATCT (SEQ ID NO.18) R-TGCACTTTGGTACTCTTGAAGTT (SEQ ID NO.19)
[0096] The mRNA expression levels of PPARγ and its related genes were detected in palmitic acid (PA)-induced HepG2 cells to assess the regulatory role of peptides. The results showed that all four oligopeptides could regulate the expression of PPARγ and its downstream genes, and at their optimal concentrations, restored the expression levels of related genes to near-control levels. Figure 4A Specifically, FVPQ showed the most significant regulatory effect on FABP1, FABP4, CD36, CPT1A, and HADHA at a concentration of 0.6 mg / mL, while its regulatory effect on FABP2 and PPARγ was strongest at 1.25 mg / mL. Figure 4A SGW significantly regulated the expression of FABPs, CD36, CPT1A, and HADHA at 0.6 mg / mL, while primarily enhancing the regulation of PPARγ at 1.25 mg / mL. Figure 4B In contrast, both EQGW and SWGQ exhibited the strongest regulatory effects on FABPs, CD36, CPT1A, HADHA, and PPARγ at a concentration of 2.5 mg / mL. Figures 4C-4D In summary, these four peptides exert their lipid-lowering effects by regulating the expression of lipid metabolism-related genes: on the one hand, they downregulate genes related to fatty acid binding, transport, and oxidation (FABP1 / 2 / 4, CD36, CPT1A); on the other hand, they upregulate genes regulating fatty acid oxidation and transcription (HADHA, PPARγ). Overall, these four oligopeptides exert their lipid-lowering effects through genes related to the PPARγ pathway.
Claims
1. Oligopeptides derived from aged rice, characterized in that, The amino acid sequence of the oligopeptide is FVPQ, SGW, EQGW, or SWGQ.
2. The use of the oligopeptide according to claim 1 in the preparation of lipid-lowering drugs.
3. The application according to claim 2, wherein the blood lipids are total cholesterol and / or triglycerides.
4. The application according to claim 2 or 3, wherein the drug is an oral dosage form.
5. A lipid-lowering drug, characterized in that, The drug comprises the oligopeptide according to claim 1.
6. The application according to claim 1 in the preparation of health products that help maintain healthy blood lipid levels.
7. The application according to claim 6, wherein the drug is an oral dosage form.
8. The application according to claim 7, wherein the medicament further comprises pharmaceutically acceptable excipients.
9. A health supplement that helps maintain healthy blood lipid levels, characterized in that, The health product includes the oligopeptide according to claim 1.
10. A solid-phase synthesis method for preparing the oligopeptide according to claim 1, characterized in that, The method includes: (1) resin swelling; (2) removal of Fmoc protecting groups; (3) amino acid coupling reaction; (4) removal of Fmoc protecting groups after coupling; (5) repeating the coupling and removal steps; (6) resin washing and drying; (7) peptide chain cleavage and side chain deprotection; (8) quality detection of artificially synthesized oligopeptides.