Trichoderma reesei engineering bacterium for producing Brazilian sweet protein as well as construction method and application of Trichoderma reesei engineering bacterium
By constructing an engineered strain of Trichoderma reesei, linking the brassinoprotein gene with the CBHI gene, and using Agrobacterium-mediated transformation, efficient expression of brassinoprotein was achieved under cellulose as the carbon source conditions. This solves the problems of high production cost and low expression rate in existing technologies and provides a new production method for healthy sweeteners.
Patent Information
- Application Number
- CN202511685181.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-02-13
AI Technical Summary
Existing technologies make it difficult to achieve large-scale production of Brazil protein, especially under low-cost carbon source conditions, and existing expression systems suffer from low protein synthesis rates or high production costs.
An engineered strain of Trichoderma reesei was constructed. By linking the codon-optimized brassinoprotein gene with the CBHI gene of Trichoderma reesei, and using Agrobacterium-mediated transformation, the efficient expression of brassinoprotein was achieved under the condition that cellulose was the sole carbon source.
The study successfully produced brassinolide from Trichoderma reesei using cellulose as a carbon source, achieving an expression level of 0.14 mg/L for the first time. This provides a new approach for the production of healthy sweeteners and has economic and social value.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of bioengineering and synthetic biology, specifically relating to an engineered Trichoderma reesei strain for producing Brazilian sweet protein, its construction method, and its application. Background Technology
[0002] High sugar intake has led to serious health problems such as obesity, tooth decay, and diabetes, resulting in a growing demand for healthy alternative sweeteners. Sweet proteins are a class of zero-calorie sweeteners that are highly sweet but do not produce any glycemic response during digestion, making them highly beneficial to human health (Appl Microbiol Biotechnol, 2000, 53, 145-51). Since the 1970s, sweet proteins have been discovered in Malaysia, Hainan, China, and West Africa. To date, eight plant-based sweet proteins have been identified: Brazzein, Curculin and Neoculin, Thaumatin, Mabinlin, Miraculin, Monellin, and Pentadine (Frontiers in Nutrition, 2021, 8, 691368). Brazil protein, the smallest sweet-tasting plant protein (6473 Da), was first isolated and purified from the fruit of the wild plant Pentadiplandra brazzeana in West Africa. Brazil protein is a single-chain polypeptide composed of 54 amino acid residues, containing 8 cysteine residues forming 4 pairs of intramolecular disulfide bonds (Acta Crystallogr DBiol Crystallogr, 2013, 69, 642-7). An equal weight of Brazil protein is 500 times sweeter than sucrose (each molecule is 9500 times sweeter than sucrose). Compared to other sweet proteins, Brazil protein has the smallest molecular weight, the best water solubility, and retains its sweetness even after heat treatment at 80°C for 4 hours in aqueous solution. It also exhibits good thermal and pH stability.
[0003] The natural sources of sweet proteins are all tropical plants that are difficult to cultivate. Due to regional and seasonal limitations, it is difficult to achieve large-scale production of sweet proteins extracted from natural plants. Since the 1960s, scientists have attempted to use genetic engineering techniques to introduce sweet protein genes into different plants or microorganisms for expression. Currently, Brazilin has been expressed in systems such as Bacillus subtilis, Escherichia coli, Pichia pastoris, and maize. Prokaryotic systems, such as those based on *E. coli*, suffer from low synthesis yields and low sweetness of protein products due to the lack of proper protein modification. Plant systems, such as those based on corn, can correctly modify proteins to obtain expression products with higher sweetness (Plant Biotechnol J, 2005, 3, 103-114), but plants have long growth cycles and demanding culture conditions. Fungal systems, such as *Saccharomyces cerevisiae*, can highly express carbamate in a soluble form, with the expressed carbamate reaching a sweetness 400-1500 times that of sucrose (Metab Eng, 2023, 79, 97-107), but their fermentation medium requires glucose as a carbon source, lacking carbon source flexibility and increasing the production cost of carbamate.
[0004] *Trichoderma reesei* (also known as *Hypocrea Jecorina*) is a multicellular eukaryotic saprophytic fungus belonging to the genus *Trichoderma*. It effectively produces and secretes various cellulases, hemicellulases, and other carbohydrate-active enzymes, making it a recognized and crucial industrial enzyme-producing fungus. It possesses safe and non-toxic properties, the ability to utilize low-cost cellulose as a carbon source, and excellent protein synthesis and secretion capabilities, making it a promising exogenous protein expression system. Currently, it has been applied to the production of heterologous high-value proteins such as human serum albumin (HSA) (ACS Synth. Biol., 2022, 11, 486–496), egg white protein (OVA) (Food Res Int, 2023, 163, 112131), and interferon INFα-2b (Microb Cell Fact, 2016, 15, 104). However, there are currently no reports on the use of *Trichoderma reesei* to produce the sweet protein Brazzein. Summary of the Invention
[0005] Objective of the Invention: To address the problems existing in the prior art, this invention proposes an engineered *Trichoderma reesei* strain for producing brassin, its construction method, and its applications. This engineered *Trichoderma reesei* strain can produce brassin, providing a new method for the production of microbially derived brassin.
[0006] Technical solution: To achieve the above objectives, this invention provides a method for constructing an engineered Trichoderma reesei strain, comprising the following steps:
[0007] (1) The Brazzein gene was extracted from the template of DNA synthesized by Shanghai Sangon Biotech Co., Ltd. by digestion with XbaI enzyme, and the Brazzein gene sequence was detected by agarose gel electrophoresis and recovered by gel excision.
[0008] (2) The pDHt plasmid was digested with XbaI enzyme, and the recovered Brazzein gene was ligated into the linearized pDHt plasmid using T4 ligase to obtain the pDHt-Brazzein recombinant plasmid.
[0009] (3) Transform the recombinant plasmid into Escherichia coli AGL-1 competent cells, grow on a plate for 16 h, and screen transformants to obtain Escherichia coli containing pDHt-Brazzein recombinant plasmid. Extract the plasmid to obtain pDHt-Brazzein plasmid.
[0010] (4) The CBHI gene sequence was obtained by PCR amplification using Trichoderma reesei RUT-C30 genomic DNA as a template.
[0011] (5) Digest the pDHt-Brazzein plasmid obtained in step (3) with XbaI enzyme, and ligate the CBHI gene obtained in step (4) into the linearized pDHt-Brazzein plasmid to construct the recombinant plasmid pDHt-CBHI-Brazzein;
[0012] (6) The recombinant plasmid constructed in step (5) was transferred into Trichoderma reesei RUT-C30 via Agrobacterium-mediated transformation, and after screening and verification, Trichoderma reesei strain CBHI-Brazzein, which is capable of producing brassinoprotein, was obtained.
[0013] Preferably, the primer sequences used in step (1) are as follows:
[0014] CBHI-F:5'-ACCCAATAGTCAATCTAGAATGTATCGGAAGTTGGC-3',
[0015] CBHI-R:5'-GCTGCTGCTGCCGCTTCTAGACAGGCACTGAGAGTAGTAA-3'.
[0016] The preferred Brazzein gene sequence is:
[0017] GACAAGTGCAAGAAGGTCTACGAGAACTACCCCGTCAGCAAGTGCCAGCTCGCCAA CCAGTGCAACTACGACTGCAAACTCGACAAGCACGCCCGCTCCGGCGAGTGCTTCT ACGACGAGAAGCGAAAACCTGCAGTGCATCTGCGATTACTGTGAGTAC.
[0018] Preferably, the CBHI gene described in step (3) is inserted upstream of the Brazzein gene and linked to the Brazzein gene.
[0019] Preferably, the plasmid transformation method in step (4) is Agrobacterium-mediated transformation of Trichoderma reesei.
[0020] Preferably, the Agrobacterium used in the transformation in step (4) is Agrobacterium AGL-1 competent cells.
[0021] Preferably, the screening described in step (4) is performed on a plate containing hygromycin and cefotaxime.
[0022] This invention also provides the application of a constructed Trichoderma reesei in the production of brassin, comprising the following steps:
[0023] The constructed Trichoderma reesei CBHI-Brazzein engineered strain was inoculated into SDB liquid medium for pre-culture at 28±2℃ and 160-220rpm for 2-4 days. Then, it was transferred into fermentation medium with 2% (w / v) cellulose as the carbon source at an inoculation ratio of 1:8-1:10 and cultured at 28±2℃ and 160-220rpm to produce Brazilian sweet protein.
[0024] The SDB culture medium consists of the following components: yeast extract 10 g / L, glucose 40 g / L, and tryptone 10 g / L.
[0025] The fermentation medium is TMM medium, with the following components: ammonium sulfate 4 g / L, potassium dihydrogen phosphate 6.5 g / L, yeast extract 0.25 g / L, maleic acid 11.6 g / L, peptone 0.75 g / L, Tween 80 186 μl / L, MnSO4·H2O 1.6 mg / L, FeSO4·7H2O 5 mg / L, CoCl2·6H2O 2.0 mg / L, ZnSO4·7H2O 1.4 mg / L, urea 1 g / L, CaCl2 0.6 g / L, MgSO4 0.6 g / L, and the pH of the medium is 5.8-6.0.
[0026] Beneficial effects:
[0027] (1) In this study, the CBHI gene of *Trichoderma reesei* was ligated with a codon-optimized Brazzein gene. Antibiotic tags on the plasmid were used for screening, and the plasmid was transformed into *Trichoderma reesei* strains using Agrobacterium-mediated transformation to construct the CBHI-Brazzein strain. Using the CBHI-Brazzein strain, 0.14 mg / L of recombinant CBHI-Brazzein protein was produced in a medium with cellulose as the sole carbon source. This represents the first successful production of brazzein from *Trichoderma reesei* using cellulose as the carbon source.
[0028] (2) This is the first attempt to express brassinolide in Trichoderma reesei strain, which provides a new idea for the production of natural and healthy sweeteners. It is beneficial to improve health problems such as obesity, tooth decay and diabetes caused by high sugar intake, and has certain economic and social value. Attached Figure Description
[0029] Figure 1 This is an electrophoresis diagram verifying the PCR products of the CBHI gene in the Trichoderma reesei genome. Lane M1 is a 5000bp DNA marker, lane M2 is a 2000bp DNA marker, and lanes 1, 2, and 3 are the amplified products of the CBHI gene in three groups.
[0030] Figure 2 The electrophoresis diagram for PCR verification of E. coli transformants shows lane M1 as a 2000bp DNA marker, lane M2 as a 5000bp DNA marker, and lanes 1-6 as single E. coli transformed colonies 1-6.
[0031] Figure 3 A schematic diagram of the constructed plasmid pDHt-CBHI-Brazzein.
[0032] Figure 4 The electrophoresis diagram for PCR verification of the genome of the transformant strain Trichoderma reesei CBHI-Brazzein is shown. Lane M1 contains a 2000bp DNA marker, lane M2 contains a 5000bp DNA marker, and lanes 1-4 contain the genomic DNA of Trichoderma reesei RUT-C30 and transformants CBHI-Brazzein-10, 11, and 14, respectively.
[0033] Figure 5 Cellulase activity and protein content of fermentation supernatant of engineered Trichoderma reesei strains CBHI-Brazzein-10, 11 and 14 after 168 h;
[0034] Figure 6This is a Western blot image of the purified product from the fermentation broth of the engineered Trichoderma reesei strain CBHI-Brazzein. Lane 1 is the protein concentrate after column chromatography on a RUT-C30 column, lanes 2 and 3 are the protein concentrates purified from the 168-hour fermentation supernatant of the two selected engineered Trichoderma reesei strains CBHI-Brazzein-11 and 14 using a Ni-NTA column, and lane M is a trichrome pre-stained protein marker. Figure (a) shows the bands on the PVDF membrane under bright field, and Figure (b) shows the bands on the PVDF membrane after exposure.
[0035] Figure 7 The protein content in the purified product of the fermentation broth of the engineered Trichoderma reesei strain CBHI-Brazzein-14. Detailed Implementation
[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited thereto.
[0037] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer. All amplification primers used in the examples were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0038] The strain involved in the following examples is Trichoderma reesei strain Rut-C30, purchased from the American Type Culture Collection (ATCC), strain accession number 56765.
[0039] The Brazzein gene, containing an HIS tag and codon optimized according to Trichoderma reesei preferences, was synthesized by Shanghai Sangon Biotech Co., Ltd.
[0040] Example 1: Construction of the engineered Trichoderma reesei strain CBHI-Brazzein
[0041] 1. Construction of pDHt-Brazzein recombinant vector plasmid
[0042] 1) The Brazzein gene was extracted from the template of the synthesized DNA by digestion with XbaI enzyme. The Brazzein gene was synthesized by Shanghai Sangon Biotech Co., Ltd.
[0043] 2) The extracted Brazzein gene was detected by agarose gel electrophoresis and recovered using an agarose gel DNA recovery kit (UNIQ-10 Column MicroDNA Gel Extraction Kit, Sangon Biotech).
[0044] 3) Digest the pDHt plasmid with XbaI enzyme.
[0045] 4) The recovered Brazzein gene was ligated into the linearized pDHt plasmid using T4 ligase to obtain the pDHt-Brazzein recombinant plasmid.
[0046] 5) Transform the recombinant plasmid into competent E. coli cells, grow them on plates for 16 hours, and then screen for transformants to obtain E. coli containing the pDHt-Brazzein recombinant plasmid.
[0047] 6) E. coli containing the pDHt-Brazzein recombinant plasmid were inoculated into LB liquid medium containing kanamycin and cultured for 12-16 h. The plasmid was then extracted using a plasmid extraction kit (EZNA Plasmid mini Kit I, OMEGA) to obtain the pDHt-Brazzein plasmid.
[0048] 2. Construction of pDHt-CBHI-Brazzein recombinant vector plasmid
[0049] 1) Genomic DNA was extracted from Trichoderma reesei RUT-C30, and primers Sweet-CBHI-F / R were designed to amplify the CBHI gene fragment from the Trichoderma reesei genomic DNA. The Sweet-CBHI-F / R primer sequences used are as follows:
[0050] CBHI-F:5'-ACCCAATAGTCAATCTAGAATGTATCGGAAGTTGGC-3',
[0051] CBHI-R:5'-GCTGCTGCTGCCGCTTCTAGACAGGCACTGAGAGTAGTAA-3'.
[0052] The method for extracting genomic DNA from Trichoderma reesei RUT-C30 was based on the fungal DNA extraction kit (EZNA). TM Follow the instructions in the Fungal DNA Mini Kit (OMEGA).
[0053] The above PCR amplification system is as follows: 0.8 μL of 100 μM upstream primer, 0.8 μL of 100 μM downstream primer, 2 ng of genomic DNA, 10 μL of 2×Phanta Max Master Mix enzyme (Vazyme), and ddH2O to a final volume of 20 μL.
[0054] The PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 1 min, 34 cycles; final extension at 72℃ for 5 min. The results of 1% agarose gel electrophoresis after PCR are shown below. Figure 1 As shown, the amplification products in lanes 1, 2, and 3 all have corresponding bands at around 1700 bp. All three products contain the CBHI gene fragment (1746 bp in length). The DNA fragment of this band was recovered using an agarose gel DNA recovery kit (UNIQ-10 Column MicroDNA Gel Extraction Kit, Sangon Biotech).
[0055] 2) Linearize the pDHt-Brazzein plasmid with XbaI enzyme, and then... The IIOne Step Cloning Kit ligated the CBHI gene recovered in step 1) into the linearized pDHt-Brazzein plasmid. The ligation product was transformed into *E. coli* DH5α (Vazyme). Positive transformants were picked and verified using primers CBHI-Brazzein-YZ-F / R. Figure 2 The single colonies corresponding to lanes 1, 2, 3, 5, and 6 showed a band at approximately 1900 bp (the length of the CBHI-Bra gene), confirming successful transformation. Single colonies 1, 2, 3, and 5 were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Based on the sequencing results, single colony 5 was selected for subsequent experiments. The primer sequence CBHI-Bra-YZ-F / R is as follows:
[0056] CBHI-Brazzein-YZ-F:5'-GGCGTGAGCAAGTATCC-3',
[0057] CBHI-Brazzein-YZ-R:5'-GGTTTCGCTTCTCGTCGT-3'.
[0058] 3) The plasmid of E. coli transformant 5 was extracted using the EZNA Plasmid mini Kit I to obtain the pDHt-CBHI-Brazzein recombinant plasmid, as shown below. Figure 3 As shown.
[0059] 3. Agrobacterium tumefaciens-mediated transformation of Trichoderma reesei
[0060] 1) Plasmid pDHt-CBHI-Brazzein was introduced into Agrobacterium tumefaciens AGL-1.
[0061] 100 μl of *Agrobacterium tumefaciens* competent cells AGL-1 were mixed with 10 μl of pDHt-CBHI-Brazzein plasmid. The mixture was then placed on ice for 30 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min. 700 μl of LB liquid medium was added to the mixture, and the mixture was incubated at 28°C and 260 rpm for 3 h. The culture was then spread onto LB agar plates containing 20 μg / ml rifampin and 50 μg / ml kanamycin, and incubated upside down at 28°C for 72 h to obtain *Agrobacterium tumefaciens* A-CBHI-Brazzein containing plasmid pDHt-CBHI-Brazzein.
[0062] 2) Agrobacterium tumefaciens A-CBHI-Brazzein-mediated transformation of Trichoderma reesei
[0063] A single colony of *Agrobacterium tumefaciens* A-CBHI-Brazzein was picked from the transformation plate in step 1) and inoculated into 5 ml of LB liquid medium containing 20 μg / ml rifampicin and 50 μg / ml kanamycin. Spores were washed from a PDA plate confluent with *Trichoderma reesei* strain RUT-C30 on day 7 with fresh 0.02% Tween 80 aqueous solution and set aside. 5 ml of LB liquid medium (containing 20 μg / ml rifampicin and 50 μg / ml kanamycin) was placed in a shaker at 28°C and incubated at 260 rpm for one day. The *Agrobacterium* culture after 24 h was transferred to IM liquid medium containing 200 μmol / L acetylsyleugenol and incubated in a shaker at 28°C and 260 rpm for 6 h. Agrobacterium bacterial suspension was mixed with fresh Trichoderma reesei spores and spread onto IM solid plates (containing 200 μmol / L acetylsylcholine). The plates were then incubated at 24°C in the dark for 3 days. Afterward, the mixture was transferred to PDA plates (containing 0.1% Triton X-100 and 200 μmol / L cefotaxime) and incubated at 28°C for 7 days to obtain positive transformants of the recombinant Trichoderma reesei strain CBHI-Brazzein.
[0064] The IM plate culture medium consists of: 15 g / L agar, 0.9 g / L glucose, 5 ml / L glycerol, 560 ml / L ddH2O. After autoclaving at 121℃ for 25 ± 5 min, add 40 ml / L MES solution with a final concentration of 40 mmol / L and 400 ml / L 2.5 × MM salts.
[0065] IM medium (liquid): glucose 0.9 g / L, glycerol 5 ml / L, ddH2O 560 ml / L, autoclaved at 121℃ for 25 ± 5 min, then add MES solution with a final concentration of 40 ml / L and 2.5 × MM salts with a concentration of 40 mmol / L and 400 ml / L.
[0066] The 2.5×MM Salts solution consists of: dipotassium hydrogen phosphate trihydrate 4.9 g / L, sodium chloride 0.375 g / L, potassium dihydrogen phosphate 5.125 g / L, ammonium sulfate 1.25 g / L, CaCl2 0.142 g / L, and MgSO4 1.075 g / L.
[0067] 3) Extract genomic DNA from positive transformants and verify using primers CBHI-Brazzein-YZ-F / R, such as... Figure 4 Lanes 2, 3, and 4 showed target bands at around 1900 bp, proving the successful construction of the engineered Trichoderma reesei strains CBHI-Brazzein-10, 11, and 14.
[0068] Example 2: Engineered Trichoderma reesei strain CBHI-Brazzein degrades cellulose to produce brassinolide.
[0069] The engineered Trichoderma reesei strains CBHI-Brazzein-10, 11, and 14 constructed in Example 1 were inoculated into 5 ml of SDB liquid (containing 100 μg / L hygromycin and 200 μmol / L cefotaxime) and cultured at 28°C and 180 rpm for three days. Trichoderma reesei culture was then inoculated at a 1:10 ratio into 1 L of TMM medium containing 2% cellulose and cultured at 28°C and 180 rpm for 168 h. Samples were taken to determine the total cellulase activity and total protein content of the fermentation supernatant. Figure 5 ).
[0070] The SDB culture medium consists of the following components: yeast extract 10 g / L, glucose 40 g / L, and tryptone 10 g / L.
[0071] The TMM medium composition is as follows: ammonium sulfate 4 g / L, potassium dihydrogen phosphate 6.5 g / L, yeast extract 0.25 g / L, maleic acid 11.6 g / L, peptone 0.75 g / L, Tween 80 186 μl / L, MnSO4·H2O 1.6 mg / L, FeSO4·7H2O 5 mg / L, CoCl2·6H2O 2.0 mg / L, ZnSO4·7H2O 1.4 mg / L, urea 1 g / L, CaCl2 0.6 g / L, MgSO4 0.6 g / L, and the pH of the medium is 5.8-6.0.
[0072] Example 3: Isolation, purification and identification of brassinoprotein in fermentation products of Trichoderma reesei engineered strain CBHI-Brazzein
[0073] 1. The isolated and purified protein was tested using Western blotting, such as... Figure 6 The band of approximately 63 kDa in lane 3 is the CBHI-Brazzein protein band, verifying that the constructed Trichoderma reesei engineered strain can produce brassin. The protein band length is slightly larger than the theoretical size of the recombinant protein, 60.5 kDa, possibly due to methylation modification.
[0074] 2. The brassin in the 168h fermentation supernatant of the *Trichoderma reesei* engineered strain CBHI-Brazzein-14 from Example 2 was isolated and purified using a Ni-NTA 6FF His-tagged protein purification kit (Sangon Biotech). The yield of brassin was determined by measuring the protein content of the purified product using the BCA method. Figure 7 The concentration was approximately 0.14 mg / L.
Claims
1. An engineered Trichoderma reesei strain for producing Brazilian sweet protein, characterized in that, The engineered strain was obtained by introducing the brassinolide encoding gene into Trichoderma reesei, which is Trichoderma reesei that produces brassinolide.
2. The engineered Trichoderma reesei strain according to claim 1, characterized in that, The Brazilian sweet protein gene was linked with the Trichoderma reesei CBHI gene and introduced together into the Trichoderma reesei RUT-C30 strain.
3. The method for constructing engineered Trichoderma reesei strains according to claim 1, characterized in that, The gene sequence encoding the Brazilian sweet protein is as follows: GACAAGTGCAAGAAGGTCTACGAGAACTACCCCGTCAGCAAGTGCCAGCTCGCCAACCAGTGCAACTACGACTGCAAACTCGACAAGCACGCCCGCTCCGGCGAGTGCTTTCTACGACGAGAAGCGAAAACCTGCAGTGCATCTGCGATTACTGTGAGTAC.
4. The method for constructing engineered Trichoderma reesei strains according to claim 1, characterized in that, Includes the following steps: (1) The Brazzein gene was extracted from the template of DNA synthesized by Shanghai Sangon Biotech Co., Ltd. by digestion with XbaI enzyme, and the Brazzein gene sequence was detected by agarose gel electrophoresis and recovered by gel excision. (2) Using the pDHt plasmid linearized with XbaI enzyme as the starting plasmid, the Brazzein gene obtained in step (1) was ligated into the pDHt plasmid using T4 ligase to obtain the recombinant pDHt-Brazzein plasmid. (3) The pDHt-Brazzein plasmid obtained in step (2) was transformed into competent Escherichia coli culture, transformants were screened and plasmids were extracted to obtain pDHt-Brazzein plasmid; (4) The CBHI gene sequence was obtained by PCR amplification using Trichoderma reesei RUT-C30 genomic DNA as a template; (5) The pDHt-Brazzein plasmid obtained by XbaI digestion step (3) is used to connect the CBHI gene obtained in step (4) into the linearized pDHt-Brazzein plasmid to construct the recombinant plasmid pDHt-CBHI-Brazzein; (6) The pDHt-CBHI-Brazzein plasmid obtained in step (5) was transformed into competent Escherichia coli culture, transformants were screened and plasmids were extracted to obtain pDHt-CBHI-Brazzein plasmid; (7) The recombinant plasmid constructed in step (6) was transformed into Trichoderma reesei RUT-C30 via Agrobacterium-mediated transformation, and after screening and verification, Trichoderma reesei strain CBHI-Brazzein, which can produce brassinoprotein, was obtained.
5. The method for constructing engineered Trichoderma reesei strains according to claim 4, characterized in that, The primer sequences used in step (1) are as follows: Sweet-CBHI-F:5'-ACCCAATAGTCAATCTAGAATGTATCGGAAGTTGGC-3', Sweet-CBHI-R:5'-GCTGCTGCTGCCGCTTCTAGACAGGCACTGAGAGTAGTAA-3'. The method for constructing Trichoderma reesei engineered bacteria according to claim 4 is characterized in that the CBHI gene in step (3) is inserted upstream of the Brazzein gene and linked to the Brazzein gene.
6. The method for constructing engineered Trichoderma reesei strains according to claim 4, characterized in that, The plasmid transformation method described in step (4) is Agrobacterium-mediated transformation of Trichoderma reesei; Preferably, the Agrobacterium used in the transformation in step (4) is AGL-1 competent cells.
7. The method for constructing engineered Trichoderma reesei strains according to claim 4, characterized in that, The screening described in step (4) was performed on plates containing hygromycin and cefotaxime.
8. The use of the engineered Trichoderma reesei strain as described in claim 1 in the production of Brazilian sweet protein.
9. The application according to claim 9, characterized in that, The application steps are as follows: The constructed Trichoderma reesei CBHI-Brazzein engineered strain was inoculated into SDB liquid medium for pre-culture at 28±2℃ and 160-220 rpm for 2-4 days. Then, it was transferred into fermentation medium with 2% (w / v) cellulose as the carbon source at an inoculation ratio of 1:8-1:10 and cultured at 28±2℃ and 160-220 rpm to produce Brazzein.
10. The application according to claim 10, characterized in that, The fermentation medium was TMM medium, with the following components: ammonium sulfate 4 g / L, potassium dihydrogen phosphate 6.5 g / L, yeast extract 0.25 g / L, maleic acid 11.6 g / L, peptone 0.75 g / L, Tween 80 186 μl / L, MnSO4·H2O 1.6 mg / L, FeSO4·7H2O 5 mg / L, CoCl2·6H2O 2.0 mg / L, ZnSO4·7H2O 1.4 mg / L, urea 1 g / L, CaCl2 0.6 g / L, MgSO4 0.6 g / L, and the pH of the medium was 5.8-6.0.