Recombinant schizochytrium limacinum for producing DHA (docosahexaenoic acid) lipid by utilizing carbon dioxide as well as construction method and application thereof

By introducing FDH, FK, FPR, and Ti encoding genes into Schizochytrium, recombinant Schizochytrium was constructed, which utilizes carbon dioxide to produce DHA lipids, solving the high cost problem and achieving the goal of efficient and economical DHA production and carbon neutrality.

CN121518282APending Publication Date: 2026-02-13NANJING NORMAL UNIVERSITY
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202610059892.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

In existing technologies, the cost of producing DHA oil from Schizochytrium is high, mainly because the cost of carbon sources accounts for 60% of the total fermentation cost. Traditional carbon sources such as hemp hydrolysate and crude glycerol have problems such as complicated pretreatment, unstable sources, low concentration, and difficult analysis, making it difficult to completely replace glucose. Moreover, carbon dioxide emissions contribute to climate change.

Method used

A recombinant Schizochytrium was constructed, and optimized FDH, FK, FPR, and Ti encoding genes were introduced into the Schizochytrium. DHA lipids were produced using carbon dioxide as a carbon source. The gene homologous recombination technology was used to insert the gene into the pBS-Zeo plasmid, and an overexpression vector was constructed and electroporated into the Schizochytrium to achieve efficient CO2 utilization for DHA lipid production.

Benefits of technology

It reduces the production cost of DHA lipids, improves economic efficiency, achieves "carbon neutrality", increases DHA lipid production capacity, saves time costs, and reduces dependence on traditional carbon sources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518282A_ABST
    Figure CN121518282A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of bioengineering, and discloses recombinant schizochytrium limacinum for producing DHA (docosahexaenoic acid) lipid by using carbon dioxide as well as a construction method and application of the recombinant schizochytrium limacinum, and the recombinant schizochytrium limacinum is obtained by introducing optimized encoding genes FDH, FK, FPR and Ti related to CO2 into schizochytrium limacinum; wherein the gene sequence of the gene FDH is SEQ ID No. 17, the gene sequence of the gene FK is SEQ ID No. 18, the gene sequence of the gene FPR is SEQ ID No. 19, and the gene sequence of the gene Ti is SEQ ID No. 20. The schizochytrium limacinum engineering bacterium capable of efficiently and rapidly utilizing the CO2 is constructed through a metabolic engineering means, and the schizochytrium limacinum engineering bacterium can utilize the CO2 as a carbon source to produce the DHA lipid, so that the production cost of the DHA lipid can be reduced, and the production economy of the DHA lipid can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of bioengineering, and particularly relates to a recombinant Schizochytrium sp. for producing DHA lipid from carbon dioxide, a construction method and application thereof. BACKGROUND

[0002] Long-chain polyunsaturated fatty acids, such as docosahexaenoic acid (DHA), arachidonic acid (ARA), and eicosapentaenoic acid (EPA), are commonly found in deep-sea fish, seal oil, and certain plants. They are a class of indispensable unsaturated fatty acids that play an important role in human health. In recent years, deep-sea fish have become the main source for humans to obtain oil containing long-chain polyunsaturated fatty acids. However, fish oil production and quality are easily affected by environmental seasons, and it has fishy smell, is easily oxidized and contaminated, and has high processing cost. Chemical synthesis method has the problems of complicated synthesis steps, low yield, and serious environmental pollution. Therefore, it is of great significance to further develop strategies for rapid and stable production of long-chain polyunsaturated fatty acid oil.

[0003] Schizochytrium sp. is a heterotrophic and lipid-rich marine organism with great potential for producing lipid compounds. Schizochytrium sp. can accumulate oil accounting for nearly 70% of its biomass, and is considered to be the most suitable microorganism for industrial production of DHA oil. Therefore, strategies for regulating long-chain polyunsaturated fatty acid oil production through Schizochytrium sp. fermentation have been widely applied in the industrial fermentation process of functional oil.

[0004] Currently, there are many reports on Schizochytrium sp. producing DHA oil. For example, Chinese patent publication CN101979623A can promote Schizochytrium sp. to synthesize DHA by adding one or more combinations of exogenous regulators such as acetic acid, citric acid, and simvastatin, so that the final yield of DHA in Schizochytrium sp. is increased from 35.51% to 45%. Chinese patent publication CN117946875A obtains Schizochytrium sp. TKD-2212 strain through screening, mutagenesis, and breeding from natural environment, and produces algal oil with DHA content of 40-65% through batch feeding fermentation, wherein the proportion of DHA at sn-2 position is only 35-50%. Chinese patent publication CN114703238A solves the problem of low production efficiency of Schizochytrium sp. in co-utilizing glucose and glycerol by controlling the addition time of carbon source glycerol, and the DHA content in oil reaches 46.28%. Chinese patent publication CN117844646A provides a Schizochytrium sp. HSc-01 with high DHA yield, which is fermented in a fermenter, and the measured DHA proportion in the fermentation broth is as high as 60.2%, but the oil yield is only 42 g / L.

[0005] However, it cannot be ignored that the cost of large-scale industrial fermentation production of DHA oil is still high, mainly due to the cost of carbon source, which accounts for about 80% of the substrate cost and 60% of the total fermentation cost. At present, many studies are devoted to the development of cost-effective fermentation carbon sources, including hemp hydrolysate, crude glycerol, lignocellulose hydrolysate, coconut water, waste acid oil and dioscorea zingiberensis saponin hydrolysate, etc. (Bao, Z., Zhu, Y., Zhang, K., Feng, Y., Chen, X., Lei, M., Yu, L., 2021. High-value utilization of the waste hydrolysate of Dioscorea zingiberensis for docosahexaenoic acid production in Schizochytrium sp. Bioresour. Technol. 2021, 336, 125305; Gupta, A., Abraham, R.E., Barrow, C.J., Puri, M., 2015. Omega-3 fatty acid production from enzyme saccharified hemp hydrolysate using a novel marine thraustochytrid strain. Biore source. Technol. 2015, 184, 373-378; Gupta, A., Barrow, C.J., Puri, M., 2021. Multiproduct biorefinery from marine thraustochytrids towards a circular bioeconomy. Trends Biotechnol. 2021, 40(4), 448-462; 221-226; Qi, F., Zhang, M., Chen, Y., Jiang, X., Lin, J., Cao, X., Huang, J., 2017. A lignocellulosic hydrolysate-tolerant Aurantiochytrium sp. mutant strain for docosahexaenoic acid production. Bioresour. Technol. 2017, 227, 221-226; Ye, H., He, Y., Xie, Y., Sen, B., Wang, G., 2020. Fed-batch fermentation of mixed carbon source significantly enhances theproduction of docosahexaenoic acid in Thraustochytriidae sp. PKU#Mn16 bydifferentially regulating fatty acids biosynthetic pathways. Bioresour.Technol. 2020, 297, 122402). Although these strategies successfully reduced the fermentation cost of S. limacinum and contributed to the development of circular economy, these carbon sources cannot completely replace glucose for microbial fermentation due to the limitations of complex pretreatment, unstable source, low concentration, and difficult analysis.

[0006] In the past 40,000 years, the concentration of carbon dioxide (CO2) in the atmosphere has been stable at 200-280 µL / L. However, with the rapid increase in the use of petrochemical fuels, the concentration of CO2 has increased to 414 µL / L in the past 50 years, which will lead to about 24% of plant and animal extinction in the future. Therefore, in addition to controlling CO2 emissions, it is also necessary to remove CO2 from the atmosphere to mitigate the devastating effects of climate change.

[0007] Therefore, constructing a Schizochytrium sp. that can efficiently and rapidly utilize CO2 to produce DHA lipids not only reduces the production cost of DHA lipids and improves the economic efficiency of DHA lipid production, but also consumes CO2, making a contribution to the ecological environment and achieving the goal of "carbon neutrality". SUMMARY

[0008] The present application aims to overcome the shortcomings of the prior art and provide a recombinant Schizochytrium sp. that can efficiently and rapidly utilize CO2 to produce DHA lipids, a construction method thereof, and applications thereof.

[0009] The technical solution adopted by the present application to solve its technical problems is: A recombinant Schizochytrium sp. for producing DHA lipids by utilizing CO2, wherein the recombinant Schizochytrium sp. is obtained by introducing optimized CO2 utilization-related coding genes FDH, FK, FPR, and Ti into the Schizochytrium sp. The gene sequence of gene FDH is SEQ ID No. 17, the gene sequence of gene FK is SEQ ID No. 18, the gene sequence of gene FPR is SEQ ID No. 19, and the gene sequence of gene Ti is SEQ ID No. 20.

[0010] Further, the Schizochytrium selected is Schizochytrium limacinum HX-308.

[0011] The method for constructing the recombinant Schizochytrium as described above comprises the following steps: The FDH gene derived from Candida, the FK gene derived from Candidatus Methanomassiliicoccales archaeon LGM-DZ1, the FPR gene derived from Homo sapiens chromosome 5 clone CTC-491N17, and the Ti gene derived from Drosophila albomicans are cloned, and the genes are inserted into the pBS-Zeo plasmid by gene homologous recombination technology to construct the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti; the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti is electroporated into Schizochytrium sp. HX-308 to obtain the recombinant Schizochytrium.

[0012] Further, the specific steps are as follows: (1) Cloning of the FDH, FK, FPR, and Ti gene fragments; (2) Amplification of the homologous arms of the FDH, FK, FPR, and Ti genes to obtain the FDH, FK, FPR, and Ti gene fragments with homologous arms; (3) Ligation reaction The pBS-Zeo vector fragment after enzyme digestion and the FDH, FK, FPR, and Ti gene fragments with homologous arms obtained in step (2) are ligated to obtain the ligation product, i.e., the recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti; (4) Transformation of the ligation product into E. coli DH5α competent cells to obtain the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti (5) The overexpression vector pBS-Zeo-FDH-FK-FPR-Ti is transformed into Schizochytrium to construct the Schizochytrium CD engineering strain to obtain the recombinant Schizochytrium.

[0013] The recombinant Schizochytrium as described above is used in the production of DHA lipids by utilizing CO2.

[0014] The method for producing DHA lipid by using the recombinant Schizochytrium as described above, the recombinant Schizochytrium is inoculated into a seed culture medium to obtain a first-stage seed; the first-stage seed is inoculated into the seed culture medium to obtain a second-stage seed; the second-stage seed is inoculated into the seed culture medium to obtain a third-stage seed as a fermentation seed, and the fermentation seed is inoculated into a fermentation culture medium to produce DHA lipid through fermentation.

[0015] Further, the method comprises the following steps: (1) After 72 h of incubation in a 28°C incubator, a single colony is selected from a Schizochytrium culture plate medium; (2) The single colony is inoculated into a seed culture medium without adjusting pH, and incubated at 28°C and 230 rpm for 48 h to obtain a first-stage seed; (3) The first-stage seed is inoculated into a seed culture medium at an inoculation amount of 1%, and incubated at 28°C and 170 rpm for 24 h without adjusting pH to obtain a second-stage seed; the OD 600 >3 of the second-stage seed is measured at 24 h, and no contaminant is observed under a microscope, and the second-stage seed can infect the next generation; (4) The second-stage seed is inoculated into a seed culture medium at an inoculation amount of 1%, and incubated at 28°C and 170 rpm for 24 h without adjusting pH to obtain a third-stage seed; the OD 600 >5 of the third-stage seed is measured at 24 h, and no contaminant is observed under a microscope, and the third-stage seed can infect the next generation; (5) The third-stage seed is inoculated into a seed tank at an inoculation amount of 2%, and the seed tank is filled with a seed culture medium, and the seed tank is incubated at 28°C, 150 rpm, and 20 L / min for 24 h to obtain a tank 1 generation seed; the OD 600 >8 of the tank 1 generation seed is measured at 20 h, and no contaminant is observed under a microscope, and the tank 1 generation seed can infect the next generation; (6) The tank 1 generation seed is inoculated into a fermentation tank at an inoculation amount of 2%, and the fermentation tank is filled with a fermentation culture medium, and the fermentation tank is fermented at 28°C, 100 rpm, and 15 L / min, and the rotation speed is gradually increased to 300 rpm, and the fermentation is performed for 48 h-120 h. 3

[0016] Further, the fermentation culture time is 48 h, 60 h, 72 h, 84 h, 96 h, or 120 h. ​Alternatively, the pH value of the flat plate medium is 6.0-6.5, and includes: agar 15-20 g / L, glucose 30-60 g / L, yeast extract powder 8-15 g / L, sodium sulfate 10-15 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 6-12 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, sodium glutamate 8-12 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, iron sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B64-10 mg / L, vitamin B 12 0.1-1.5 mg / L.

[0017] Further, the pH value of the seed medium is 6.0-6.5, and includes: glucose 40-60 g / L, yeast extract powder 4-6 g / L, sodium sulfate 5-8 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, sodium glutamate 8-12 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, iron sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L; The pH value of the fermentation medium is 5.0-6.5, and includes: glucose 60-100 g / L, yeast extract powder 5-15 g / L, sodium sulfate 5-12 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, sodium glutamate 15-20 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, iron sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B64-10 mg / L, vitamin B 12 0.1-0.5 mg / L.

[0018] Further, the method for collecting the bacterial body to extract the lipid comprises: 1) after the fermentation culture is finished, NaOH solution is added to the fermentation liquor to adjust PH to 10-13, then 0.01-0.5% of a mass final concentration of a cell wall breaking enzyme is added, and oscillation is carried out at 40-60 DEG C and 100-200 r / min for 5-15 h; 2) cooling to room temperature, adding anhydrous ethanol to inactivate the cell wall breaking enzyme; 3) adding n-hexane to extract, and collecting the upper organic phase; 4) repeating step 3) for several times, combining the organic phases, and evaporating the solvent to obtain the lipid.

[0019] The application has the following advantages and positive effects: 1) the Schizochytrium sp. engineering strain can utilize CO2 as a carbon source to produce DHA lipid, which can reduce the production cost of DHA lipid and improve the economic efficiency of DHA lipid production.

[0020] 2) the Schizochytrium sp. engineering strain can convert CO2 into lipid, which can contribute to the ecological environment and achieve the goal of "carbon neutralization".

[0021] 3) the strain can utilize CO2 to produce DHA lipid, and the recombinant Schizochytrium sp. strain for producing DHA lipid by utilizing CO2 is constructed by genetic engineering, which provides an effective idea for the microbial fermentation production strategy to realize the harmonious coexistence of man and nature.

[0022] 4) the price of 1 ton of glucose on the market is about 4000 yuan, the cost of carbon source for producing 1 ton of DHA lipid by utilizing the Schizochytrium sp. HX-308 strain is about 21300 yuan, and the cost of carbon source for producing 1 ton of DHA lipid by utilizing the Schizochytrium sp. CD strain is only about 14000 yuan, so the cost of carbon source for producing DHA lipid by utilizing the Schizochytrium sp. CD strain is reduced by 65.8%, and the economic efficiency is greatly improved.

[0023] 5) the lipid production capacity of the Schizochytrium sp. CD strain is 62.5 g / L, which is increased by 29.7% compared with the HX-308 strain, so the time cost for producing DHA lipid by utilizing the Schizochytrium sp. CD strain is greatly saved. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 it is a path diagram for converting CO2 into acetyl coenzyme A by the Schizochytrium sp. in the application; Figure 2 it is a structure diagram of the overexpression plasmid pBS-Zeo-FDH-FK-FPR-Ti in the application; Figure 3 A comparison chart of lipid production of Schizochytrium HX-308 and Schizochytrium CD strains in the present application; Figure 4 A comparison of lipid production of Schizochytrium HX-308 and Schizochytrium CD strains in the present application. DETAILED DESCRIPTION

[0025] The present application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the present application.

[0026] The various experimental operations involved in the specific embodiments are all conventional techniques in the art, and the parts not specifically noted in the text can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the filing date of the present application.

[0027] A recombinant Schizochytrium for producing DHA lipid by using carbon dioxide, wherein the recombinant Schizochytrium is obtained by introducing optimized CO2-related coding genes FDH, FK, FPR and Ti coding genes into the Schizochytrium body. The gene sequence of the gene FDH is SEQ ID No. 17, the gene sequence of the gene FK is SEQ ID No. 18, the gene sequence of the gene FPR is SEQ ID No. 19, and the gene sequence of the gene Ti is SEQ ID No. 20.

[0028] Further, the Schizochytrium is selected from the oil-producing Schizochytrium HX-308.

[0029] The construction method of the recombinant Schizochytrium as described above comprises the following steps: The formic acid dehydrogenase (FDH) gene derived from Candida, the formic acid kinase (FK) gene derived from Candidatus Methanomassiliicoccales archaeon LGM-DZ1, the formyl phosphate reductase (FPR) gene derived from Homo sapiens chromosome 5 clone CTC-491N17, and the thiolytic enzyme (Ti) gene derived from Drosophila albomicans are cloned, and the genes are inserted into the pBS-Zeo plasmid by gene homologous recombination technology to construct the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti. The overexpression vector pBS-Zeo-FDH-FK-FPR-Ti is electroporated into Schizochytrium sp. HX-308 to obtain the recombinant Schizochytrium.

[0030] Further, the specific steps are as follows: (1) Cloning FDH, FK, FPR, and Ti gene fragments; (2) Amplify the homologous arms of FDH, FK, FPR and Ti genes to obtain FDH, FK, FPR and Ti gene fragments with homologous arms; (3) Connection reaction The digested vector pBS-Zeo fragment and the gene fragment with homologous arms FDH, FK, FPR and Ti obtained in step (2) are ligated to obtain the ligation product, which is the recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti; (4) The ligation product was transformed into E. coli DH5α competent cells to obtain the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti (5) The overexpression vector pBS-Zeo-FDH-FK-FPR-Ti was transferred into Schizochytrium to construct the Schizochytrium CD engineered strain and obtain recombinant Schizochytrium.

[0031] The application of recombinant Schizochytrium as described above in the production of DHA lipids using CO2.

[0032] The method for producing DHA lipids using the recombinant Schizochytrium bacteria described above involves inoculating the recombinant Schizochytrium bacteria into a seed culture medium to obtain primary seeds; inoculating the primary seeds into a seed culture medium to obtain secondary seeds; inoculating the secondary seeds into a seed culture medium to obtain tertiary seeds, which are used as fermentation strains. After the fermentation strains are inoculated into a fermentation culture medium, DHA lipids are produced through fermentation.

[0033] Furthermore, it includes the following steps: (1) After culturing the cultured Schizochytrium from the cryopreserved tubes on a plate medium at 28°C for 72 hours, pick a single colony; (2) Single colonies were inoculated into seed culture medium, and cultured at 28°C and 230 rpm for 48 h without adjusting the pH to obtain primary seeds; (3) Primary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain secondary seeds; OD at 24h 600 >3. Furthermore, microscopic examination revealed no bacterial contamination, indicating the ability to transmit the virus to the next generation; (4) Secondary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain tertiary seeds. The OD at 24h was... 600 >5. And microscopic examination shows no bacteria, which can be transmitted to the next generation; (5) The third-generation seeds were inoculated into seed tanks at an inoculation rate of 2%. The seed tanks were filled with seed culture medium and cultured at 28℃, 150 rpm, and 20 L / min for 24 h to obtain the first generation seeds. The OD of the seed tanks was measured at 20 h.600 >8and no bacteria are found in the microscope, which can infect the next generation; (6) The jar 1 generation seed is inoculated in the fermentation tank at an inoculation amount of 2%, and the fermentation tank is filled with fermentation medium, 28°C, 100 rpm, 15m 3 / h starts fermentation, and gradually increases the speed to 300 rpm, and the fermentation culture is 48h-120h.

[0034] Further, the fermentation culture time is 48h, 60h, 72h, 84h, 96h, or 120h; Alternatively, the pH value of the plate culture medium is 6.0-6.5, and includes: agar 15-20g / L, glucose 30-60g / L, yeast extract powder 8-15g / L, sodium sulfate 10~15g / L, magnesium sulfate 2~4 g / L, ammonium sulfate 6~12 g / L, potassium chloride 1~2 g / L, calcium chloride 0.1~0.2 g / L, potassium sulfate 0.5~1 g / L, potassium dihydrogen phosphate 0.5~2 g / L, sodium glutamate 8~12g / L, zinc sulfate heptahydrate 1~5 mg / L, cobalt chloride hexahydrate 0.01~0.1mg / L, copper sulfate pentahydrate 2~6mg / L, nickel sulfate hexahydrate 1~2 mg / L, iron sulfate heptahydrate 8~15mg / L, calcium pantothenate 2~4 mg / L, manganese chloride tetrahydrate 3~5 mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B64-10 mg / L, vitamin B 12 0.1-1.5 mg / L.

[0035] Further, the pH value of the seed culture medium is 6.0-6.5, and includes: glucose 40-60g / L, yeast extract powder 4~6g / L, sodium sulfate 5~8g / L, magnesium sulfate 2~4 g / L, ammonium sulfate 4~8 g / L, potassium chloride 1~2 g / L, calcium chloride 0.1~0.2 g / L, potassium sulfate 0.5~1 g / L, potassium dihydrogen phosphate 0.5~2 g / L, sodium glutamate 8~12g / L, zinc sulfate heptahydrate 1~5mg / L, cobalt chloride hexahydrate 0.01~0.1mg / L, copper sulfate pentahydrate 2~6mg / L, nickel sulfate hexahydrate 1~2 mg / L, iron sulfate heptahydrate 8~15mg / L, calcium pantothenate 2~4 mg / L, manganese chloride tetrahydrate 3~5 mg / L, sodium molybdate dihydrate 0.04mg / L; The fermentation medium has a pH value of 5.0-6.5 and comprises: glucose 60-100 g / L, yeast extract powder 5-15 g / L, sodium sulfate 5-12 g / L, magnesium sulfate 2-4 g / L, ammonium sulfate 4-8 g / L, potassium chloride 1-2 g / L, calcium chloride 0.1-0.2 g / L, potassium sulfate 0.5-1 g / L, potassium dihydrogen phosphate 0.5-2 g / L, sodium glutamate 15-20 g / L, zinc sulfate heptahydrate 1-5 mg / L, cobalt chloride hexahydrate 0.01-0.1 mg / L, copper sulfate pentahydrate 2-6 mg / L, nickel sulfate hexahydrate 1-2 mg / L, ferric sulfate heptahydrate 8-15 mg / L, calcium pantothenate 2-4 mg / L, manganese chloride tetrahydrate 3-5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B64-10 mg / L, vitamin B6 0.1-0.5 mg / L, and vitamin B12 0.1-0.5 mg / L. 12 0.1-0.5 mg / L.

[0036] Further, the method for collecting the bacterial body to extract the lipid comprises: 1) after the fermentation culture is finished, NaOH solution is added to the fermentation liquid to adjust the pH value to 10-13, then 0.01-0.5% of a cell wall breaking enzyme is added, and the mixture is oscillated at 40-60 DEG C and 100-200 r / min for 5-15 h; 2) the mixture is cooled to room temperature, and anhydrous ethanol is added to the fermentation liquid to inactivate the cell wall breaking enzyme; 3) n-hexane is added for extraction, and the upper organic phase is collected; 4) step 3) is repeated for several times, the organic phases are combined, and the solvent is volatilized to obtain the lipid.

[0037] Specifically, the preparation and detection are as follows: The present application adopts Schizochytrium sp. HX-308 as the original strain, and obtains the Schizochytrium CD engineering strain through rational design of the Schizochytrium, and the DHA oil is obtained by fermenting the Schizochytrium CD engineering strain in a 5000L fermenter, which lays a theoretical foundation for the industrialization of the product.

[0038] Unless otherwise specified, the equipment, reagents, processes, parameters, etc. involved in the present application are all conventional equipment, reagents, processes, parameters, etc. and will not be described in the examples.

[0039] All the ranges listed in the present application include all the point values in the range.

[0040] In the present application, unless otherwise specified or unless otherwise specified, % is the mass percentage, and the ratio is the mass ratio. The unit of mass is, for example, gram, kilogram or ton.

[0041] In the present application, the "room temperature" is the conventional environmental temperature, which can be 10-30 DEG C.

[0042] The culture media used in the following examples are as follows: The plate culture medium has a pH of 6.6 and includes: agar 15-20 g / L, glucose 40 g / L, yeast extract 10 g / L, sodium sulfate 10 g / L, magnesium sulfate 2 g / L, ammonium sulfate 6 g / L, potassium chloride 1 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.6 g / L, potassium dihydrogen phosphate 1 g / L, monosodium glutamate 10 g / L, 0.1% trace minerals (i.e., zinc sulfate heptahydrate 3 g / L, cobalt chloride hexahydrate 0.05 g / L, copper sulfate pentahydrate 5 g / L, nickel sulfate hexahydrate 1 g / L, ferric sulfate heptahydrate 10 g / L, calcium pantothenate 4 g / L, manganese chloride tetrahydrate 5 g / L, sodium molybdate dihydrate 0.04 g / L), vitamin B6 5 mg / L, and vitamin B1. 12 0.5 mg / L.

[0043] The seed culture medium had a pH of 6.6 and included: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L monosodium glutamate, 0.1% trace minerals (i.e., 3 g / L zinc sulfate heptahydrate, 0.05 g / L cobalt chloride hexahydrate, 5 g / L copper sulfate pentahydrate, 1 g / L nickel sulfate hexahydrate, 10 g / L ferric sulfate heptahydrate, 4 g / L calcium pantothenate, 5 g / L manganese chloride tetrahydrate, 0.04 g / L sodium molybdate dihydrate), 5 mg / L vitamin B6, and vitamin B1. 12 0.5 mg / L.

[0044] The fermentation medium has a pH of 6.0–7.5 and includes: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L monosodium glutamate, 0.1% trace minerals (i.e., 3 g / L zinc sulfate heptahydrate, 0.05 g / L cobalt chloride hexahydrate, 5 g / L copper sulfate pentahydrate, 1 g / L nickel sulfate hexahydrate, 10 g / L ferric sulfate heptahydrate, 4 g / L calcium pantothenate, 5 g / L manganese chloride tetrahydrate, 0.04 g / L sodium molybdate dihydrate), 5 mg / L vitamin B6, and vitamin B1. 12 0.5 mg / L.

[0045] Example 1. Construction of Schizochytrium sp. engineering strain CD overexpressing formate dehydrogenase (FDH) gene from Candida, formate kinase (FK) gene from Candidatus Methanomassiliicoccales archaeon LGM-DZ1, formyl phosphate reductase (FPR) gene from Homo sapiens chromosome 5 clone CTC-491N17, thiolase (Ti) gene from Drosophila albomicans. Pathway schematic diagram is shown as follows. Figure 1

[0046] 1. Cloning of FDH, FK, FPR, Ti gene fragments According to the sequence information of FDH, FK, FPR and Ti genes, primers P1 and P2 shown as SEQ ID No. 1 and SEQ ID No. 2, primers P3 and P4 shown as SEQ ID No. 3 and SEQ ID No. 4, primers P5 and P6 shown as SEQ ID No. 5 and SEQ ID No. 6, primers P7 and P8 shown as SEQ ID No. 7 and SEQ ID No. 8 were designed, and the related genome was used as a template, and the primer P1 / P2 or P3 / P4 or P5 / P6 or P7 / P8, PrimerStar high-fidelity polymerase were used to amplify the FDH, FK, FPR and Ti gene fragments by PCR, and the FDH, FK, FPR and Ti gene fragments were obtained. The PCR program was: 94℃ 30s, 55℃ 30s, 70℃ 20s, 32 cycles, and the PCR product was purified.

[0047] SEQ ID No. 1 P1 (sense): ATGAAGATTGTCTTAGTTCTTT SEQ ID No. 2 P2 (antisense): CTATTTCTTATCGTGTTTACC SEQ ID No. 3 P3 (sense): ATGGGCCCCCGCTTTGATGGCA SEQ ID No. 4 P4 (antisense): CTAATGGTAGAGATCATCAGG SEQ ID No. 5 P5 (sense): ATGAACTCTATGATAGTGTTT SEQ ID No. 6 P6 (antisense): CTAATGACCGTAAATTTAGGG ​SEQ ID No. 7 P7 (sense): ATGCAAGCGCAGGAAAAGGGT SEQ ID No. 8 P8 (antisense): CTAGTTTGCGGTGTGCATGCA 2. Amplification of FDH, FK, FPR, Ti gene homologous arms Homologous arm sequences (SEQ ID No. 9 P9, SEQ ID No. 10 P10, SEQ ID No. 11 P11, SEQ ID No. 12 P12, SEQ ID No. 13 P13, SEQ ID No. 14 P14, SEQ ID No. 15 P15, SEQ ID No. 16 P16) were designed at both ends of the pBS-Zeo enzyme cutting site for the FDH, FK, FPR, Ti genes. The homologous arms were added to both ends of the FDH, FK, FPR, Ti genes by PCR and recovered by gel.

[0048] Table 1 PCR method

[0049] Table 2 PCR mixture formula

[0050] The primer sequences are as follows: SEQ ID No. 9 P9 (sense): TGCAGCACTCGCTCGCGCATAAATGAAGATTGTCTTAGTTCTTT SEQ ID No. 10 P10 (antisense): GACTGGATCTTGAGATACATAACTATTTCTTATCGTGTTTACC SEQ ID No. 11 P11 (sense): TTATGTATCTCAAGATCCAGTCATGGGCCCCCGCTTTGATGGCA SEQ ID No. 12 P12 (antisense): TTTTTGTGGAGATGGGGTTTTCTAATGGTAGAGATCATCAGG SEQ ID No. 13 P13 (sense): AAAACCCCATCTCCACAAAAAATGAACTCTATGATAGTGTTT SEQ ID No. 14 P14 (antisense): GCGGAGGGGTGGCGGTCCTCCTAATGACCGTAAATTTAGGG SEQ ID No. 15 P15 (sense): GAGGACCGCCACCCCTCCGCATGCAAGCGCAGGAAAAGGGT SEQ ID No. 16 P16 (antisense): CGCCGAGTTTGAGCG GCTAGC CTAGTTTGCGGTGTGCATGCA 3. Ligation reaction The enzyme-digested vector pBS-Zeo fragment and the FDH, FK, FPR, Ti gene fragments were ligated by Gibson assembly to obtain the recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti. The ligation system (25 μL) was 2 μL of the target gene fragment, 1 μL of the enzyme-digested vector fragment, 2.5 μL of the ligase buffer, and 19.5 μL of ddH2O, and the ligation was performed at 50°C for 2 h.

[0051] 4. Transformation of E. coli DH5a competent cells with the ligation product, and the transformation method was as follows: (1) Under sterile conditions, 100 μL of competent cells were taken, the ligation product was added and mixed, and then placed on ice for 30 min.

[0052] (2) Heat shock at 42°C for 90 s, and then quickly place on ice for 2 min.

[0053] (3) Add 900 μL of LB medium, and incubate at 37°C and 180 r / min for 1 h.

[0054] (4) Take 200 μL and spread on a 100 μg / mL Zeo-resistant LB plate. Invert and culture at 37°C overnight. Select positive transformants, extract plasmids, and sequencing verification shows that the ligation is successful, and the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti is obtained.

[0055] 5. Transformation of the overexpression vector into Schizochytrium to construct a Schizochytrium CD engineering strain.

[0056] 5.1 Preparation of Schizochytrium competent cells (1) Take a single colony of Schizochytrium sp. HX-308 Schizochytrium that has been activated on the plate to 50 mL of seed culture medium, and culture at 28°C and 170 r / min for 24 h.

[0057] (2) Transfer 10 mL of the culture into 50 mL of seed medium at 5% inoculation, 28°C, 170 r / min for 24 h.

[0058] (3) Repeat step (2).

[0059] (4) Take 25 mL of the bacterial solution, centrifuge at 4000 rpm for 2 min at room temperature, and discard the supernatant.

[0060] (5) Resuspend the bacterial cells with 25 mL of pretreatment agent (20 mM DTT and 0.1 M CaCl2 in pH 6.5 Tris-HCl buffer), and gently shake to loosen the cell wall.

[0061] (6) After centrifugation, wash the bacterial cells twice with 25 mL of pre-cooled sterile water, and centrifuge at 4000 rpm for 2 min at 4°C.

[0062] (7) Wash the bacterial cells twice with 1 M sterile pre-cooled sorbitol solution (containing 0.1 M CaCl2), and centrifuge at 4000 rpm for 2 min at 4°C.

[0063] (8) Resuspend the bacterial cells with 200 μL of 1 M sterile pre-cooled sorbitol solution (containing 0.1 M CaCl2), and aliquot 100 μL per 1.5 mL sterile centrifuge tube, and store on ice.

[0064] 5.2 Schizochytrium sp. electroporation (1) Add 10 μL of linearized recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti to 100 μL of Schizochytrium sp. competent cells, mix well, and transfer to a pre-cooled electroporation cup, and stand on ice for 30 min.

[0065] (2) Electroporation, 2 KV, one pulse.

[0066] (3) Immediately add 1 mL of pre-cooled seed medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to seed medium containing 1 M sorbitol.

[0067] (4) Culture at 28°C, 180 rpm for 2-3 h.

[0068] (5) Take an appropriate amount of bacterial solution and plate, and culture at 28°C for 2-4 days.

[0069] 5.3 Screening and identification of Schizochytrium sp. genetically engineered strain of recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti gene (1) Pick the plate colonies and inoculate into seed medium containing 50 mg / L blasticidin, and culture at 28°C, 180 rpm for 24 h. ​

[0070] (2) To ensure the stable inheritance of the overexpression vector, the strain was passaged 5 times, and step (1) was repeated in each generation.

[0071] (3) The stable inheritance strain was the phenotype of the CD engineered strain overexpressing pBS-Zeo-FDH-FK-FPR-Ti, which was stored in a -80°C refrigerator.

[0072] The schematic diagram of the overexpression plasmid is shown in Figure 2 .

[0073] Example 2. Schizochytrium sp. Fermentor Scale-up Test 1. The specific fermentation steps of Schizochytrium sp. HX-308 and the engineered strain CD are as follows: (1) The Schizochytrium sp. culture plate was inoculated from the frozen tube, and after 72 h of incubation in a 28°C incubator, it was ready for use, and a single colony was selected; (2) The single colony was inoculated into a test tube (test tube 1 generation) (5 mL of seed culture solution, without pH adjustment), and incubated at 28°C and 230 rpm for 48 h; (3) The 1% inoculum was inoculated into a 250 mL baffle shake flask (50 mL of seed culture solution, without pH adjustment), and incubated at 28°C and 170 rpm for 24 h (shake flask 2 generation). At 24 h, the OD600 was > 3 and no contamination was observed under a microscope, and the next generation could be inoculated; (4) The 1% inoculum was inoculated into a 1000 mL baffle shake flask (200 mL of seed culture solution, without pH adjustment), and incubated at 28°C and 170 rpm for 24 h (shake flask 3 generation). At 24 h, the OD600 was > 5 and no contamination was observed under a microscope, and the next generation could be inoculated; (5) The 2% inoculum was inoculated into a 50 L seed tank (total of 40 L of seed culture solution), and incubated at 28°C, 150 rpm, and 20 L / min for 24 h (tank 1 generation). At 20 h, the OD600 was > 8 and no contamination was observed under a microscope, and the next generation could be inoculated; (6) The 2% inoculum was inoculated into a 5000 L fermenter (total of 2000 L of fermentation culture solution), and fermentation was started at 28°C, 100 rpm, and 15 m 3 / h, and the rotation speed was controlled, with a maximum rotation speed of 300 rpm and a constant aeration of 15 m 3 / h.

[0074] (7) Glucose and sodium glutamate detection: every 12 hours, 1 mL of fermentation broth was taken, centrifuged at 12000 rpm, and the supernatant was gradient diluted to 100 times. The diluted solution was centrifuged, and detected by a biological sensor SBA-40ES. Glucose and sodium glutamate were detected by different enzyme membranes, and the standard solution was calibrated in advance.

[0075] 2. The lipid was extracted from the collected bacterial cells, including the following steps: (1) After the fermentation broth after the end of the fermentation culture, add NaOH solution to adjust pH 10-13, add 0.01-0.2% commercial commercial Schizochytrium break wall enzyme, 40~60℃, 100~200r / min oscillation 5~15h; (2) Cool to room temperature, add anhydrous ethanol to inactivate the fermentation broth; (3) Add n-hexane to extract lipids: After extraction, the organic phase was allowed to stand for 5h, and after the upper and lower layers were clearly separated, the upper organic phase was collected. The upper organic phase was taken out and placed in a rotary evaporation flask, which was rotated at 45℃ water bath and 120 r / min. After the organic phase was no longer evaporated, the rotary evaporation flask was removed and dried in a 60℃ oven until the weight no longer changed. The lipid was weighed.

[0076] (4) Gas phase detection analysis of fatty acids, the specific procedure is as follows: Take 20 μL oil, i.e. lipid, and add it to an EP tube containing 1 ml 1M potassium hydroxide-methanol solution, and oscillate at 20℃ and 1000 r / min for 6h. Add 50 μL concentrated sulfuric acid to terminate the reaction, and add 1 ml n-hexane to extract the lipids at 20℃ and 1000 r / min for 0.5h. The extracted phase is loaded into a liquid phase vial for gas phase detection. GC-2010 (Shimadzu, Japan) gas phase system is used for analysis, equipped with DB-23 capillary column (60 m 0.22 mm) and flame ionization detector (FID). Nitrogen is used as the carrier gas. The injection volume is 1 μL, and the injection temperature is 250℃. The column temperature is raised from 100℃ to 200℃ at a rate of 25℃ / min, and then raised to 230℃ at a rate of 4℃ / min, and maintained for 9 min, and the FID detector temperature is 280℃. Different fatty acid compositions are identified by comparison with sigma standard (related external standard, Sigma, USA). Non-endogenous fatty acid (C19:0) is used as an internal standard, and the content of individual fatty acid is calculated from the peak area on the chromatogram.

[0077] The results of the lipid Figure 3 As shown in the table, after fermentation, the Schizochytrium HX-308 strain obtained 48.2g / L of lipid, while the Schizochytrium CD strain obtained 62.5g / L of lipid, which was 29.7% higher than the Schizochytrium HX-308 strain. The results of the lipid production are shown in the table Figure 4As shown, the lipid yield of Schizochytrium sp. HX-308 strain is 0.188 g / g glucose, while the lipid yield of Schizochytrium sp. CD strain is 0.285 g / g glucose, which is increased by 51.6% compared with Schizochytrium sp. HX-308 strain. This is because Schizochytrium sp. HX-308 strain can only rely on glucose as a carbon source to produce lipids, and only 18.8% of the carbon flow is directed to lipid synthesis, and 81.2% of the carbon flow is used for the synthesis of other biomass and respiration to generate CO2 loss. While Schizochytrium sp. CD strain can convert CO2 into acetyl-CoA, which is then used for lipid synthesis. Therefore, up to 28.5% of the carbon flow of Schizochytrium sp. CD strain is directed to lipid synthesis, and only 71.5% of the carbon flow is used for the synthesis of other biomass and respiration to generate CO2 loss. Table 3 shows that the DHA content in the lipids produced by Schizochytrium sp. HX-308 strain is 47.8%, while the DHA content in the lipids produced by Schizochytrium sp. CD strain is 51.4%. Not only that, the C14:0 and C16:0 content in the lipids produced by Schizochytrium sp. HX-308 strain is 10.8% and 18.7%, while the C14:0 and C16:0 content in the lipids produced by Schizochytrium sp. CD strain is 8.6% and 18.1%, indicating that the lipids produced by Schizochytrium sp. CD strain have lower saturated fatty acid content and higher quality. In addition, the EPA and DPA content in the lipids produced by Schizochytrium sp. HX-308 strain is 1.1% and 16.3%, while the EPA and DPA content in the lipids produced by Schizochytrium sp. CD strain is 1.5% and 16.7%, indicating that the lipids produced by Schizochytrium sp. CD strain have higher polyunsaturated fatty acid content and higher quality.

[0078] Table 3 Comparison of fatty acid profiles of Schizochytrium sp. HX-308 strain and CD strain

[0079] In fact, the current market price of 1 ton of glucose is about 4000 yuan, and the normal carbon source cost of producing 1 ton of DHA lipid by Schizochytrium sp. HX-308 strain is about 21300 yuan, while the carbon source cost of producing 1 ton of DHA lipid by Schizochytrium sp. CD strain is only about 14000 yuan, which is decreased by 65.8% compared with Schizochytrium sp. HX-308 strain. Not only that, the lipid productivity of Schizochytrium sp. CD strain is 62.5 g / L, which is increased by 29.7% compared with Schizochytrium sp. HX-308 strain. The use of Schizochytrium sp. CD strain to produce DHA lipid can greatly save time cost. Most importantly, the use of Schizochytrium sp. CD strain to produce DHA lipid can use CO2 as a carbon source, which can contribute to the ecological environment and achieve the goal of "carbon neutralization".

[0080] Chinese patent publication CN101979623A can promote the synthesis of DHA in Schizochytrium by adding one or more combinations of exogenous regulatory factors such as acetic acid, citric acid and simvastatin, so that the final yield of DHA in Schizochytrium is increased from the initial 35.51% to 45%. Chinese patent publication CN114703238A solves the problem of low production efficiency of Schizochytrium by controlling the addition time of carbon source glycerol, and the DHA content in oil reaches 46.28%. Chinese patent publication CN117844646A provides a Schizochytrium HSc-01 with high DHA yield, which is fermented in a fermenter, and the DHA proportion in the fermentation broth is as high as 60.2%, but the oil yield is only 42 g / L. However, it cannot be ignored that the cost of large-scale industrial fermentation of DHA oil is still high, mainly due to the cost of carbon source, which accounts for about 80% of the substrate cost and 60% of the total fermentation cost. At present, many studies are devoted to the development of cost-effective fermentation carbon sources, including hemp hydrolysate, crude glycerol, lignocellulose hydrolysate, coconut water, waste acid oil and dioscorea zingiberensis saponin hydrolysate (Bao, Z., Zhu, Y., Zhang, K., Feng, Y., Chen, X., Lei, M., Yu, L., 2021. High-value utilization of the waste hydrolysate of Dioscorea zingiberensis for docosahexaenoic acid production in Schizochytrium sp. Bioresour. Technol. 2021, 336, 125305; Gupta, A., Abraham, R.E., Barrow, C.J., Puri, M., 2015. Omega-3 fatty acid production from enzymes accharified hemp hydrolysate using a novel marine thraustochytrid strain. Biore source. Technol. 2015, 184, 373-378; Gupta, A., Barrow, C.J., Puri, M., 2021. Multiproduct biorefinery from marine thraustochytrids towards a circular bioeconomy. Trends Biotechnol.2021, 40(4), 448-462; 221-226; Qi, F., Zhang, M., Chen, Y., Jiang, X., Lin, J., Cao, X., Huang, J., 2017. Alignocellulosic hydrolysate-tolerant Aurantiochytrium sp. mutant strain for docosahexaenoic acid production. Bioresour. Technol. 2017, 227, 221-226; Ye, H., He, Y., Xie, Y., Sen, B., Wang, G., 2020. Fed-batch fermentation of mixed carbon source significantly enhances the production of docosahexaenoic acid in Thraustochytriidae sp. PKU#Mn16 by differentially regulating fatty acids biosynthetic pathways. Bioresour. Technol. 2020, 297, 122402). Although these strategies successfully reduced the fermentation cost of S. limacinum and contributed to the development of circular economy, these carbon sources could not completely replace glucose for microbial fermentation due to the limitations of complex pretreatment, unstable source, low concentration, and difficult analysis.

[0081] Therefore, the Schizochytrium constructed by the present application can not only reduce the production cost of DHA lipid and improve the economic efficiency of DHA lipid production, but also consume CO2 to contribute to the ecological environment and achieve the goal of "carbon neutralization".

[0082] The relevant sequences are as follows: Formic dehydrogenase (FDH) gene (SEQ ID No. 17): Formate kinase (FK) gene (SEQ ID No. 18): ATGGGCCCCCGCTTTGATGGCAGTGTCATAGAGGCTGTCGATCTCCGGGTTGGAGACCTTGTCGGAGAACATCTTCTTGTACTGCCAGGACTCGCCGAGGAGATTGCCCACCTCGTCGATGTCGCCGTGCCTGAGCGCGGAGCGCATCCTTATGGCGATGTCCTTGGCCTTGTCAGAGGCCGCGTCGTTCTTGCCCTCTTTGTACGATTTGATCTGGGTATCGATGACTGCGGCGGAATCGTGGGTCATGCCGGTGAAGCACATGACCGAACGGCACTGGAGCTCGTAGATTATGTCCTGCGGGATCTTGGCGGGGAGGACCGCCACCCCTCCGCTGTCGAACCTCAGGGAGTTGAAGCCGCCGAAGACTGCCGCGTACTGGTCCTGCTTGCCCCCTTTGAGGCCTATGACCTCTCTCTCCAGGTGGTATGCCAGGGCCGCCATCTCGAGCTTGGACATGTCGACGTCCCGCCAGTTGGCGATGGCCCCGATCATCGAGACAATCATGGTCGACGACCCTCCAAGACCGGACCCGGCGGGGACGTCGGAACGGATGCTCATGTCGAACCCTTCGGTCACGCCGAAATGGTTGGTCACGGCCTTGATAAGGTCCATGTTCCCGTCCAGAGGGAGCGGTCCGTCGCCGAGGGGGGCCTTGTAGCGGCCGTAGTACTCGGAGTTGACCGTCATGGTGTTGTCCTTCCTCGGCTTCAGCGTGCTGTACGCATACTTGTTGATGGTGGTGTTGAAGACGTAGCCTCCCTTCTCCGAGGCATAGGGCTCAACATCGGTCCCGCCTCCAGCCAGGCCTATCCTGAGGGGCGCCCTGGACCTGATGATCTCTACCATTAG Formate phosphoribosyltransferase (FPR) gene (SEQ ID No. 19): Thiolase (Ti) gene (SEQ ID No. 20): ATGCAAGCGCAGGAAAAGGGTTACTTTACGGATCTGGTGCCATTCAAGGTGCAGGGCGTCGATAAAGTGGTGGACAAGGACAACGGCATTCGTGTCTCTACGCCTGAAAGCTTAGCAAAGCTCAAGCCTGCTTTTGTCAAACCCTATGGCACAATTACAGCAGCCAACGCCTCATTTCTGTCTGACGGCGCATCCGCCTGTCTGGTCATGACCGAGCAGAAGGCGAAGGAACTGGGGCTGAAACCCAAGGCATTCTTACGTGATTTTCTTTATGTATCTCAAGATCCAGTCAACCAACTGCTTTTGGGTCCAGCCTATGGAATTCCAAAATTGTTGAAAAAAGTTGGACTCGGTCTAAAGGACATTGACACTTGGGAGATTCATGAAGCTTTTGCCGGTCAAATTGTTGCAAATTTGAAAGCTTTAGACTCGGAGTGGTTCTGCAAAACATATTTGGGCTTAAACGAAAAATTCGGCTCGCCGGATCTATCCAAGTGGAACAATTGGGGCGGTTCGCTGTCTATTGGTCATCCATTTGCTGCCACTGGCGTGCGTCTTTGCATGCACACCGCAAACTAG Although the embodiments of the present application have been disclosed for illustrative purposes, those skilled in the art can understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present application and the appended claims, and therefore the scope of the present application is not limited to the disclosed contents of the embodiments.

Claims

1. A recombinant Schizochytrium strain that utilizes carbon dioxide to produce DHA lipids, characterized in that: The recombinant Schizochytrium was obtained by introducing optimized CO2-related coding genes FDH, FK, FPR, and Ti into Schizochytrium. The gene sequence of FDH is SEQ ID No. 17, the gene sequence of FK is SEQ ID No. 18, the gene sequence of FPR is SEQ ID No. 19, and the gene sequence of Ti is SEQ ID No.

20.

2. The recombinant Schizochytrium according to claim 1, characterized in that: The selected schistocytic fungus is the oil-producing schistocytic fungus HX-308.

3. The method for constructing recombinant Schizochytrium as described in claim 1 or 2, characterized in that: Includes the following steps: The formate dehydrogenase (FDH) gene from Candida, the formate kinase (FK) gene from Candidatus Methanomassiliicoccales archaeon LGM-DZ1, the formate phosphate reductase (FPR) gene from Homo sapienschromosome 5 clone CTC-491N17, and the thiolase (Ti) gene from Drosophila albomicans were cloned and inserted into the pBS-Zeo plasmid using homologous recombination technology to construct the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti. The overexpression vector pBS-Zeo-FDH-FK-FPR-Ti was then electroporated into Schizochytrium sp. HX-308 to obtain recombinant Schizochytrium.

4. The construction method according to claim 3, characterized in that: The specific steps are as follows: (1) Cloning FDH, FK, FPR, and Ti gene fragments; (2) Amplify the homologous arms of FDH, FK, FPR and Ti genes to obtain FDH, FK, FPR and Ti gene fragments with homologous arms; (3) Connection reaction The digested vector pBS-Zeo fragment and the gene fragment with homologous arms FDH, FK, FPR and Ti obtained in step (2) are ligated to obtain the ligation product, which is the recombinant overexpression vector pBS-Zeo-FDH-FK-FPR-Ti; (4) The ligation product was transformed into Escherichia coli DH5α competent cells to obtain the overexpression vector pBS-Zeo-FDH-FK-FPR-Ti; (5) The overexpression vector pBS-Zeo-FDH-FK-FPR-Ti was transferred into Schizochytrium to construct the Schizochytrium CD engineered strain and obtain recombinant Schizochytrium.

5. The application of the recombinant Schizochytrium as described in claim 1 or 2 in the production of DHA lipids using CO2.

6. A method for producing DHA lipids using recombinant Schizochytrium as described in claim 1 or 2, characterized in that: Recombinant Schizochytrium was inoculated into a seed culture medium to obtain primary seeds; the primary seeds were inoculated into a seed culture medium to obtain secondary seeds; the secondary seeds were inoculated into a seed culture medium to obtain tertiary seeds, which were used as fermentation strains. After the fermentation strains were inoculated into a fermentation culture medium, DHA lipids were produced through fermentation.

7. The method according to claim 6, characterized in that: Includes the following steps: (1) After culturing the cultured Schizochytrium from the cryopreserved tubes on a plate medium at 28°C for 72 hours, pick a single colony; (2) Single colonies were inoculated into seed culture medium, and cultured at 28°C and 230 rpm for 48 h without adjusting the pH to obtain primary seeds; (3) Primary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain secondary seeds; OD at 24h 600 >3. Furthermore, microscopic examination revealed no bacterial contamination, indicating the ability to transmit the virus to the next generation; (4) Secondary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain tertiary seeds. The OD at 24h was... 600 >5. And microscopic examination shows no bacteria, which can be transmitted to the next generation; (5) The third-generation seeds were inoculated into seed tanks at an inoculation rate of 2%. The seed tanks were filled with seed culture medium and cultured at 28℃, 150 rpm, and 20 L / min for 24 h to obtain the first generation seeds. The OD of the seed tanks was measured at 20 h. 600 >8. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation; (6) The first generation seed was inoculated into the fermenter at an inoculum rate of 2%. The fermenter was filled with fermentation medium and incubated at 28°C, 100 rpm, and 15 minutes. 3 Fermentation begins at 100 rpm and the rotation speed is gradually increased to 300 rpm. Fermentation is carried out for 48-120 hours.

8. The method according to claim 7, characterized in that: Fermentation time is 48h, 60h, 72h, 84h, 96h, or 120h; Alternatively, the plate culture medium has a pH of 6.0–6.5 and comprises: agar 15–20 g / L, glucose 30–60 g / L, yeast extract 8–15 g / L, sodium sulfate 10–15 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 6–12 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, and manganese chloride tetrahydrate 3–5 mg / L. Sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4-10 mg / L, vitamin B 12 0.1-1.5 mg / L.

9. The method according to claim 7, characterized in that: The seed culture medium has a pH of 6.0–6.5 and includes: glucose 40–60 g / L, yeast extract 4–6 g / L, sodium sulfate 5–8 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, and sodium molybdate dihydrate 0.04 mg / L. The fermentation medium has a pH of 5.0–6.5 and includes: glucose 60–100 g / L, yeast extract 5–15 g / L, sodium sulfate 5–12 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 15–20 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and vitamin B12. 12 0.1-0.5 mg / L.

Citation Information

Patent Citations

  • Method for promoting microbes to synthesize docosahexaenoic acid (DHA) by exogenous additive factor

    CN101979623A

  • Fermentation method for high-yield production of docosahexaenoic acid by using schizochytrium limacinum and application of fermentation method

    CN114703238A

  • Schizochytrium limacinum with high DHA yield and application thereof

    CN117844646A

  • Schizochytrium limacinum and application thereof in fermentation production of algae oil rich in Sn-2 DHA (docosahexaenoic acid)

    CN117946875A

  • Method for producing docosahexenoic acid by fermenting schizochytrium

    CN101519676A