Citrus branch thorn identity determinant TI3 gene and application thereof

By knocking out the TI3 gene in citrus using CRISPR/Cas9 gene editing technology, the challenges posed by thorns to orchard management and fruit quality have been solved. This has enabled the breeding of thornless or low-thorn citrus varieties and the improvement of tree shape, ensuring that the normal growth of the plants and agronomic traits are not affected, and has broad potential for industrial application.

CN121518487APending Publication Date: 2026-02-13HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511644823.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively reduce the number of thorns without affecting other agronomic traits of citrus plants, and thorns pose challenges to orchard management and fruit quality.

Method used

By knocking out or inhibiting the TI3 gene in citrus using CRISPR/Cas9 gene editing technology, and taking advantage of the gene's high specific expression in thorns, thorns can be transformed into dormant buds or branches, thereby cultivating thornless or less thorny citrus varieties and improving the shape of citrus trees.

Benefits of technology

It has enabled the breeding of thornless or low-thorn citrus varieties, improved orchard management and fruit quality, ensured the normal growth of plants and that agronomic traits were not affected, and has broad prospects for industrialization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518487A_ABST
    Figure CN121518487A_ABST
Patent Text Reader

Abstract

The invention discloses a citrus branch thorn identity determinant TI3 gene and application thereof, and belongs to the field of plant biotechnology and fruit tree genetic breeding. The nucleotide sequence of the citrus TI3 gene is shown as SEQ ID NO: 1, branch thorns can be effectively converted into normal branches or dormant buds by knocking out or inhibiting the function of the TI3 gene, and therefore citrus plants without thorns or with few thorns are created; and the function of knocking out or inhibiting the TI3 gene has no adverse effect on vegetative growth, reproductive growth and other important agronomic traits of the citrus. The invention provides an application of a citrus TI3 gene. The application comprises an application in reducing the number of citrus branch thorns, an application in cultivating citrus varieties without branch thorns or with few branch thorns and an application in improving citrus tree forms. The method disclosed by the invention has extremely high application value and wide industrialization prospect in citrus breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant biotechnology and fruit tree genetic breeding, and particularly relates to a citrus thorn identity determinant TI3 gene and application thereof in breeding thornless / less thorny citrus varieties and citrus tree shape improvement. BACKGROUND

[0002] Thorn is a common organ in citrus and its close relatives, and the presence of thorn plays an important role in resisting the feeding of slightly large insects or animals. However, under the modern intensive cultivation mode of orchard, thorn brings many adverse effects. The presence of thorn poses a significant challenge to the cultivation management, fruit quality and postharvest processing of citrus. Therefore, creating thornless or less thorny citrus varieties has become an important breeding goal to reduce production costs, improve fruit quality and promote industrial upgrading. The key to achieving this goal lies in excavating thorn fate determining genes with tissue specificity and making precise genetic improvement accordingly to achieve the breeding goal of eliminating thorn only without affecting other important agronomic traits of citrus plants. SUMMARY

[0003] The application aims to provide a citrus thorn identity determinant TI3 gene and application thereof in citrus genetic improvement.

[0004] The citrus gene TI3 provided by the application has a nucleotide sequence as shown in SEQ ID NO: 1, a variable spliced transcript nucleotide sequence SEQ ID NO: 2, or a nucleotide sequence with more than 90% homology to the two sequences provided and retaining the function of regulating thorn development. The TI3 gene encodes a SHI / STY family transcription factor, and the expression thereof has high thorn tissue specificity.

[0005] SEQ ID NO: 1:

[0006] ATGATGATGAATATTAGACAACTAGGAGCTGAATTAGGCGTCACAAGATGTCAAGACTGTGGGAACCAAGCCAAAAAGAACTGTGCGTACATGAGGTGTAGGACTTGTTGTAAAAGAAGAGGATATGAATGTGAAACTCATATTAAAAGCACTTGGATTCCAGCCTACAGAAGGCACCAGAGGTATCATCATCAACACCTTGTTCCTGTTCACGAACAGCATCTTCAGCTTCAGGGACACAGCCCAAAAAGGCTTAGAGAGAATCCTTCGTCACCAGGGTTACAAATAGGAAATTTTCCAGCAGAAATAACATCTGAGGCAACATTTAGATGTGTTAAAGTGAGTTCCATTGATGATGCAATTGATCGAACAACACTTGCATACAAAACTTCTATAAGTGTTGGAGGGCATATTTTCAAAGGAATTCTCTATTATCAAGGCTGTGAAAGTAACTCCAATAACAATGTGGGAGAGAGCTCCTCCAGTGAGCCTCCGCCGCCACCTCAGCATCAGCAGCAACCTTATTATCCCTTCACTGTTGCTGCCCTAACCACCACCACTGCTGCTACTACCACTACTACTACTGCTTTAGCTGCAGCTGATGAAACTCCATATTCTTCTTCATTTACATACCCATTCGGCTCTTACGTGTCCGCGGGTACGCAATTTTTCCCAAAATATCCAAACTCTTAG.

[0007] Seq ID NO: 2:

[0008] ATGATGATGAATATTAGACAACTAGGAGCTGAATTAGGCGTCACAAGATGTCAAGACTGTGGGAACCAAGCCAAAAAGAACTGTGCGTACATGAGGTGTAGGACTTGTTGTAAAAGAAGAGGATATGAATGTGAAACTCATATTAAAAGCACTTGGATTCCAGCCTACAGAAGGCACCAGAGGTATCATCATCAACACCTTGTTCCTGTTCACGAACAGCATCTTCAGCTTCAGGGACACAGCCCAAAAAGGCTTAGAGAGAATCCTTCGTCACCAGGGTTACAAATAGGAAATTTTCCAGCAGAAATAACATCTGAGGCAACATTTAGATGTGTTAAAGTGAGTTCCATTGATGATGCAATTGATCGAACAACACTTGCATACAAAACTTCTATAAGTGTTGGAGGGCATATTTTCAAAGGAATTCTCTATTATCAAGGCTGTGAAAGTAACTCCAATAACAATGTGGGAGAGAGCTCCTCCAGTGAGCCTCCGCCGCCACCTCAGCATCAGCAGCAACCTTATTATCCCTTCACTGTTGCTGCCCTAACCACCACCACTGCTGCTACTACCACTACTACTACTGCTTTAGCTGCAGCTGATGAAACTCCATATTCTTCTTCATTTACATACCCATTCGGCTCTTACGTGTCCGCGGCAGCAGCAGCCAGAAGCACTCCAAAGGAGGAGAATGTTGTTCTTTATATAAGTGCTTTTAAATAG.

[0009] The core discovery of the present application is that the citrus TI3 gene is specifically expressed at a high level in thorns, and is a key upstream factor for regulating the identity determination genes TI1 and TI2. By knocking out or inhibiting the function of the TI3 gene through modern biotechnology (such as CRISPR / Cas9 gene editing), the thorns can be effectively converted into normal branches or dormant buds, thereby creating citrus plants without thorns or with fewer thorns. Importantly, this operation only specifically affects the development of thorns and has no adverse effects on the vegetative growth, reproductive growth and other important agronomic traits of the transgenic plants.

[0010] Based on the above discovery, the present application provides applications of the citrus TI3 gene in the following aspects:

[0011] Application in reducing the number of thorns of citrus, the TI3 gene as a key target gene is transformed into dormant buds or branches by modern biotechnology (such as CRISPR / Cas9 gene editing), thereby reducing the number of thorns;

[0012] Application in breeding thornless / less thorny citrus varieties, the thornless / less thorny citrus varieties are citrus varieties with reduced or inactivated TI3 gene activity;

[0013] Application in citrus tree shape improvement, by reducing or inactivating the TI3 gene, the thorns are transformed into branches or buds, etc., so that the citrus grows more lateral branches, resulting in an open heart-shaped citrus tree shape with weakened apical dominance, which is convenient for mechanized management and harvesting.

[0014] The application is achieved by knocking out or inhibiting the TI3 gene to destroy its gene function.

[0015] The application also provides a method for reducing the number of thorns of citrus, a method for breeding thornless / less thorny citrus varieties, or a method for improving the shape of citrus, which is knocking out or inhibiting the TI3 gene to destroy its gene function by using gene editing technology, which can include the following steps:

[0016] (1) designing specific target sequences targeting the TI3 gene of citrus;

[0017] (2) constructing a gene editing vector targeting the TI3 gene of citrus;

[0018] (3) transforming the gene editing vector targeting the TI3 gene of citrus into citrus, and selecting to obtain a plant with the TI3 gene of citrus knocked out, i.e. a thornless / less thorny or improved tree shape citrus variety.

[0019] Further, in step (1), the target of the TI3 gene of citrus is target 1 (gRNA1) with a nucleotide sequence of SEQ ID NO: 3 and target 2 (gRNA2) with a nucleotide sequence of SEQ ID NO: 4. The primers of gRNA1 targeting target 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NO: 5 and 6, respectively, and the primers of gRNA2 targeting target 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NO: 7 and 8, respectively.

[0020] Further, step (2) includes annealing the two target primers in step (1) to form a double-stranded sequence, and then connecting with a linearized gene editing vector to obtain a double-target gene editing vector targeting the TI3 gene of citrus. The gene editing vector is preferably pCAMBIA1300-pYAO-cas9.

[0021] Further, step (3) comprises: transforming the double-target gene editing vector targeting the citrus TI3 gene obtained in step (2) into Agrobacterium EHA105, preparing Agrobacterium infection solution containing the gene editing vector, and infecting the epicotyl of the citrus seedling. After co-culture and screening culture, wait for the regeneration of the explant. The positive plants with fluorescence signals are screened by a handheld fluorescence detector, and the TI3 gene knockout mutant plant ti3 is further screened by Hi-Tom detection, that is, the gene editing plant with abnormal thorn development is obtained.

[0022] The application also provides an application of Rutaceae TI3 gene in Rutaceae plants. The TI3 gene is conserved in the thorn development of Rutaceae, and the corresponding TI3 gene also has the same application as the citrus in the Rutaceae plants. The Rutaceae plants include finger limes, wine pie canes, and spice fruits.

[0023] The application has the following advantages and beneficial effects: the TI3 gene has strict thorn expression specificity, making it an ideal target for genetic manipulation. Targeted knockout of the TI3 gene only specifically blocks the development program of the thorn, without negative effects on the normal growth and development of the tree body, ensuring the safety and effectiveness of the breeding process. The TI3 gene as an important gene for cultivating thornless / less citrus varieties has a high application value and broad industrialization prospect in citrus breeding. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Fig. 1 is a temporal and spatial expression pattern of the citrus TI3 gene; A: the relative expression amount of the citrus TI3 gene in each tissue of the citrus; B-E: in situ hybridization cross-sections of the citrus TI3 gene in the shoot tips of the citrus at different development stages (scale = 50 μm); F-G: in situ hybridization longitudinal sections of the citrus TI3 gene in the early (F) and elongation (G) stages of the citrus thorn (scale = 50 μm).

[0025] Figure 2 Fig. 2 is a phenotype of the ti3 plant after complete editing of the citrus TI3 gene; A: the overall morphology of the wild type control (WT) and the ti3 plant, and the thorn phenotypes of the two mutant plants are consistent (scale = 5 cm); B-C: the enlarged view of the internodes of the wild type control (WT) and ti3#1 plant; D: TI3 gene structure diagram and the position of the target sequence (gRNA1 and gRNA2); E: gene editing of the ti3 mutant plant.

[0026] Figure 3Figure 1 is a diagram of details of ti3#1 plant after complete editing of citrus TI3 gene; A-B: stem tip electron microscope observation of wild type control (WT, A) and ti3#1 mutant (B), S1-7 represents the 1st-7th stage, representing the 1st-7th node (scale = 100 μm); C-E: enlarged view of the 8th stage leaf axil of wild type (WT, C) and ti3#1 mutant (D and E) (scale = 100 μm); F-H: details of thorn development of wild type control (WT, F) and ti3#1 plant (G and H) (scale = 2 mm).

[0027] Figure 4 Figure 2 is a diagram of expression pattern analysis of TI3 gene in Rutaceae representative species thorn; A-C: Citrus australis plant phenotype; D: in situ hybridization of TI3 gene in stem tip of Citrus australis (scale = 50 μm); E-G: Acacia farnesiana plant phenotype; H: in situ hybridization of TI3 gene in stem tip of Acacia farnesiana (scale = 50 μm); I-K: Vitex rotundifolia plant phenotype; L: in situ hybridization of TI3 gene in stem tip of Vitex rotundifolia (scale = 50 μm). DETAILED DESCRIPTION

[0028] The following examples are intended to further illustrate the present application and are not intended to limit the present application. Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art.

[0029] Example 1: Expression pattern analysis of citrus TI3 gene

[0030] (1) In order to determine the temporal and spatial expression pattern of citrus TI3 gene, first, the real-time fluorescent quantitative PCR primers qTI3-F (SEQ ID NO: 9) and qTI3-R (SEQ ID NO: 10) were designed based on the conserved CDS coding region of citrus TI3 gene. The real-time fluorescent quantitative reaction conditions were as follows: 95℃ for 3 min; 95℃ for 10 s, 58℃ for 20 s, 72℃ for 20 s, 40 cycles; 72℃ for 10 min. The relative expression amount of TI3 gene in 7 different tissues of trifoliate orange thorn, lateral bud, stem, stem tip, leaf, root and flower was calculated by 2 -△Ct CsACTIN as the internal reference.

[0031] Primer qTI3-F: TGTGCGTACATGAGGTGTAGG (SEQ ID NO: 9);

[0032] Primer qTI3-R: TCCCTGAAGCTGAAGATGCTG (SEQ ID NO: 10).

[0033] By analyzing the relative expression level of TI3 gene in different tissues of citrus, it was found that the expression amount of citrus TI3 gene in young thorn of citrus was significantly higher than that in other tissues (Figure 1 A).

[0034] (2) According to the full-length CDS of the citrus TI3 gene (Cs8g_pb007680, Citrus sinensis v2.0, http: / / citrus.hzau.edu.cn / ), the RNA in situ hybridization probe primers TI3-ISH-F (SEQ ID NO: 11) and TI3-ISH-R (SEQ ID NO: 12) were designed and prepared, and the RNA probe targeting the citrus TI3 gene was prepared. The RNA in situ hybridization experiment was performed on the transverse and longitudinal cut young stem tips of trifoliate orange, and the spatiotemporal expression pattern of TI3 was verified. Primer TI3-ISH-F: ATGATGATGAATATTAGACAACTAGGAGC (SEQ ID NO: 11); Primer TI3-ISH-R: TGTAATACGACTCACTATAGGGCGACTAAGAGTTTGGATATTTTGGGAAAAATTG (SEQ ID NO: 12).

[0035] The probe preparation steps are as follows: first, the TI3 gene CDS is amplified using high-fidelity enzyme Phanta Max Master Mix, and the amplification system is as follows:

[0036] Reagents Volume (μL) 2 x Phanta Max buffer 25 Phanta Max high fidelity enzyme 1 dNTP mix (10 mM) 1 TI3-ISH-F (10 μM) 2 TI3-ISH-R (10 μM) 2 Template plasmid for TI3 gene 1 ddH2O 18

[0037] The DNA is recovered by agarose gel, supplemented with water to 600 μL, added with an equal volume of chloroform, inverted and mixed uniformly in a fume hood for 5 min, centrifuged at 12000 rpm for 10 min, and 500 μL of the upper aqueous phase was aspirated. 50 μL of 3M NaAc, 1 mL of anhydrous ethanol was added to precipitate the DNA, and the DNA was dissolved in 20 μL of DEPC H2O and stored at -20°C.

[0038] RNA in situ hybridization probe in vitro transcription. In an RNase-free PCR tube, the reaction system was prepared as follows:

[0039] Reagents Volume (μL) Template DNA 3 10 x transcription buffer 2 T7 RNA polymerase 2 NTP mix (35% DIG) 2 RNase inhibitor 1 DEPC H2O Up to 20 μL

[0040] Incubate at 37℃ for at least 2 hours using a PCR instrument. Add 2 μL of DNase and continue incubation at 37℃ for 15 minutes. Run 1 μL of RNA onto a gel to detect RNA bands. Add water to bring the remaining RNA to 100 μL, and add 1.6 μL of 0.5 M EDTA to terminate the transcription reaction. Then, purify the probe using the Jian Shi Bio RNA Purification and Concentration Kit. Add 2 volumes of RNA binding buffer, mix well, add an equal volume of anhydrous ethanol, mix thoroughly, and transfer to a column. Centrifuge at 12000 rpm for 1 minute and remove the filtrate. Wash the column sequentially with RNA pre-wash buffer and RNA washing buffer, then elute the RNA with DEPC H2O.

[0041] Probe hydrolysis. In an RNase-free PCR tube, add 50 μL of probe RNA and 50 μL (equal volume) of 2× hydrolysis solution (0.2 M NaHCO3, pH 10.2), and hydrolyze at 60°C for 1 h. Immediately add 10 μL of 5% acetic acid to terminate the hydrolysis. Continue hydrolysis and probe purification using the JianShi Bio RNA Purification and Concentration Kit following the steps above. Elute the RNA with 50 μL of DEPC H2O, add an equal volume of deionized formamide, and store the prepared probe at -20°C.

[0042] The results of RNA in situ hybridization are as follows: Figure 1 As shown in BG, the TI3 gene in citrus is specifically expressed in thorns and bracts. Its expression begins in the fourth stage of thorn development and continues until the later stage of thorn development. TI3 expression can be detected throughout the entire development process of thorns (from the unerupted thorn primordium to the formation of the thorn tip).

[0043] Example 2: Obtaining ti3 gene-edited citrus plants

[0044] (1) Construction of gene editing vector targeting the TI3 gene in citrus: The target sequence of the TI3 gene (Cs8g_pb007680, Citrus sinensisv2.0, http: / / citrus.hzau.edu.cn / ) was designed using the CRISPR-P 2.0 website of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / ). A total of two targets were selected for gene editing. The nucleotide sequence of target 1 is: ACTGTGCGTACATGAGGTGT (SEQ ID NO: 3), and the nucleotide sequence of target 2 is: CTTGGATTCCAGCCTACAGA (SEQ ID NO: 4).

[0045] The method for constructing a gene-editing vector targeting the TI3 gene in citrus is as follows:

[0046] The primer design of target point 1 is gRNA1-F and gRNA1-R. The gRNA1-F nucleotide sequence is: ATTGACTGTGCGTACATGAGGTGT (SEQ ID NO: 5), and the gRNA1-R nucleotide sequence is: AAACACACCTCATGTACGCACAGT (SEQ ID NO: 6).

[0047] The primer design of target point 2 is gRNA2-F and gRNA2-R. The gRNA2-F nucleotide sequence is: ATTGCTTGGATTCCAGCCTACAGA (SEQ ID NO: 7), and the gRNA2-R nucleotide sequence is: AAACTCTGTAGGCTGGAATCCAAG (SEQ ID NO: 8).

[0048] The target point primer is dissolved in water to form a 10 μM stock solution, 5 μL of which is added to 40 μL of ddH2O, and heated to 98℃ for 5 min in a PCR instrument. The PCR tube is immediately removed and naturally cooled to room temperature to anneal the primers to form double-stranded. After the two target point primers are annealed to form double-stranded, the annealing product is connected with the Bsa I linearized pBlue vector overnight using T4 DNA ligase, and the E. coli competent cells are transformed. Positive single clones are selected, and after sequencing verification, the pBlue-gRNA1 and pBlue-gRNA2 plasmids are extracted.

[0049] After the successful construction of the pBlue-gRNA1 plasmid, Nhe I and Spe I double enzyme digestion is used, and the linearized product is subjected to agarose gel electrophoresis. The DNA fragment with a size of about 650 bp is recovered from the gel, and the recovered product is cloned into the Spe I linearized pCAMBIA1300-pYAO:Cas9 vector using T4 ligase. The ligation product is transformed into E. coli competent cells, and the single clone with correct sequencing is selected to extract the plasmid, i.e., the pCAMBIA1300-pYAO:Cas9-gRNA1 vector. Similarly, the pBlue-gRNA2 vector is linearized using Nhe I and Spe I, and the agarose gel electrophoresis is used to recover a DNA fragment with a size of about 650 bp. The DNA fragment is cloned into the Spe I enzyme digestion site of the pCAMBIA1300-pYAO:Cas9-gRNA1 vector using T4 ligase. The ligation product is transformed into E. coli, and the plasmid is extracted from the positive clone to finally obtain the pCAMBIA1300-pYAO:Cas9-gRNA1-gRNA2 double-target gene editing vector.

[0050] (2) Citrus epicotyl genetic transformation: The obtained pCAMBIA1300-pYAO: Cas9-gRNA1-gRNA2 gene editing vector was transformed into Agrobacterium EHA105, 2-3 single colonies were selected into 5 mL LB (containing 50 mg / L Kanamycin and 25 mg / L Rifampicin) and shaken overnight to activate, and 1 mL of the overnight activated bacterial solution was added into 30 mL of LB medium (containing 50 mg / L Kanamycin, 25 mg / L Rifampicin and 100 μM acetosyringone) the next day to continue shaking for 6 h. Then, the bacterial cells were collected by centrifugation, the bacterial solution was resuspended with MS suspension medium, 100 mM acetosyringone was added to a final concentration of 100 μM, and the bacterial solution concentration was adjusted to OD 600 = 0.6-0.8, and incubated at 28°C for 1-2 h. When infected, the epicotyls of sterile trifoliate orange seedlings were cut into 1 cm long stem segments, which were placed into the Agrobacterium suspension and shaken vigorously for 15 min. The bacterial solution was discarded, and the stem segments were placed in co-culture medium (containing 100 μM acetosyringone) and cultured in the dark at 25°C for 3 d. After co-culture, the stem segments were transferred to selection medium (containing 50 mg / L kanamycin) and cultured in the dark at 28°C until buds grew, and then transferred to light. Positive plants with GFP fluorescence were selected according to fluorescence screening, and then the positive buds were cut and transferred to rooting medium for rooting. After about 15 d, the rooted positive seedlings were transferred to MS medium for root elongation. Part of the leaves of the positive seedlings were taken to extract DNA for Hi-Tom detection of gene editing of the target site. The results showed that the plants with 100% complete mutation in the TI3 coding region were ti3 mutant plants.

[0051] Example 3: Phenotype evaluation of ti3 plants after citrus TI3 gene editing

[0052] A total of 7 positive plants were obtained, of which 2 TI3 genes were completely edited. As shown in Figure 2 , the citrus thorns of the plants with completely knocked-out TI3 genes developed abnormally, showing the phenotype of thorns developing into branches, not growing thorns or blunt thorns, and the leaf blades, internode distance and plant height of the mutant plants had no significant difference with those of the wild type.

[0053] To further observe the details of the ti3 mutant plant phenotype, the stem tips of the wild type and the mutant were taken for electron microscopy observation. The actively growing stem tips were removed with a sharp forceps to expose the stem tip meristem, and were placed in 2.5% glutaraldehyde solution for overnight fixation at 4°C. After a series of gradient dehydration, critical point drying, gold spraying and scanning electron microscopy observation, the samples were observed. As shown in Figure 3 A-B, the wild type 7th stage thorn tip was raised, while the ti3 mutant 7th stage thorn developed into a branch.Figure 3 C-D shows that the 8th stage thorns in wild type form sharp thorns, while in the mutant the thorns transform into branches; Figure 3 F-H shows the details of the different developmental fates of thorns in wild type and ti3 mutant.

[0054] Example 4: Study on the expression conservation of TI3 gene in Rutaceae among different species

[0055] In this example, three classic Rutaceae representative species, A. auriculatum, A. roxburghii and A. odoratissimum were selected. The three species have different thorn or bract development characteristics in leaf axils, especially A. odoratissimum has two thorns in leaf axils. The young stem tips of the three species were taken for in situ hybridization of TI3 gene, and the results (Fig. 4) showed that TI3 gene could be detected in the thorn primordia of the three species, indicating that TI3 gene was very conservative in the development of thorns in Rutaceae, and it was an important determining gene for the development of thorns in Rutaceae. Figure 4

[0056] In summary, TI3 gene plays an important role in the development of thorns in Rutaceae, and it is specifically highly expressed in the thorn primordia. After knocking out TI3 gene by CRISPR-Cas9 technology, the ti3 mutant plants have the phenotype of no thorn, blunt thorn or thorn developing into branch, while the growth and development of other parts of the plants are the same as those of the wild type. The conservation of the gene in three representative species of Rutaceae indicates that TI3 gene has wide application potential in the whole citrus crop. Therefore, using modern biotechnology to manipulate the gene and alternative splicing forms can create new citrus germplasm with no or few thorns, and the present application provides important gene resources for the innovation and genetic improvement of citrus, and promotes the development of citrus system industry.

[0057] The above examples are only used to help illustrate the present application, and the embodiments of the present application are not limited by the above examples. Any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods and shall be included in the protection scope of the present application.​

Claims

1. A TI3 gene, a citrus thorn identity determinant, characterized in that: Its nucleotide sequence is shown in SEQ ID NO: 1, or its alternative spliced ​​transcript nucleotide sequence is shown in SEQ ID NO: 2, or its nucleotide sequence is a nucleotide sequence that has more than 90% homology with the sequence shown in SEQ ID NO: 1 or 2 and retains the function of regulating branch and thorn development.

2. The application of the TI3 gene, a citrus thorn identity determinant, as described in claim 1, is characterized in that: The application includes one or more of the following: Application of the TI3 gene in reducing the number of thorns on citrus branches; Application of the TI3 gene in the breeding of thornless / few-thorned citrus varieties; Application of the TI3 gene in citrus tree shape improvement.

3. The application according to claim 2, characterized in that: This is achieved by disrupting the function of the TI3 gene in citrus.

4. The application according to claim 3, characterized in that: The functions of disrupting the citrus TI3 gene include knocking out or inhibiting the TI3 gene.

5. A method for reducing the number of citrus thorns, cultivating thornless / few-thorn citrus varieties, or improving the shape of citrus trees, characterized in that: The method described involves disrupting the function of the TI3 gene in citrus.

6. The method according to claim 5, characterized in that: The functions of disrupting the citrus TI3 gene include knocking out or inhibiting the TI3 gene.

7. The method according to claim 5, characterized in that: Includes the following steps: (1) Design specific target sequences targeting the TI3 gene in citrus; (2) Construct a gene editing vector targeting the TI3 gene in citrus; (3) Transform citrus with gene editing vector targeting the TI3 gene of citrus, and screen to obtain citrus plants in which the TI3 gene of citrus is knocked out, that is, citrus varieties with no branches / few branches or improved tree shape.

8. The method according to claim 7, characterized in that: In step (1), the target sites for the citrus TI3 gene are target site 1 with nucleotide sequence SEQ ID NO: 3 and target site 2 with nucleotide sequence SEQ ID NO: 4; the primers for gRNA1 targeting target site 1 are gRNA1-F and gRNA1-R with nucleotide sequences as shown in SEQ ID NO: 5 and 6, respectively, and the primers for gRNA2 targeting target site 2 are gRNA2-F and gRNA2-R with nucleotide sequences as shown in SEQ ID NO: 7 and 8, respectively.

9. The application of the TI3 gene of Rutaceae plants in Rutaceae plants, characterized by: The application includes one or more of the following: Application of the TI3 gene in reducing the number of thorns on branches of Rutaceae plants; Application of the TI3 gene in the breeding of Rutaceae plant varieties with few or no thorns; Application of the TI3 gene in the improvement of tree shape in Rutaceae plants.

10. The application according to claim 9, characterized in that: The Rutaceae plants mentioned include Australian lemon, saffron, and saffron.