Primer probe combination for detecting minimal residual focus of colorectal cancer, product and application of primer probe combination

By combining primers and probes and using the J-STAR-3M multicolor amplification melting curve method, the problem of simultaneously detecting gene methylation, gene mutation, and microRNA in colorectal cancer microresidual lesions in existing technologies has been solved. This method achieves high sensitivity and high specificity in multi-omics detection, which is suitable for early screening and risk assessment of colorectal cancer.

CN121518652APending Publication Date: 2026-02-13SHANGHAI JUNOVA BIOTECH CO LTD
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202511812529.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Existing technologies are difficult to simultaneously and efficiently detect gene methylation, gene mutation, and microRNA when detecting minimal residual disease in colorectal cancer. They are also costly and complex, failing to meet the requirements for high sensitivity and high specificity.

Method used

A primer-probe combination is provided, including primer pairs and probes for detecting gene mutation sites, methylation sites and microRNA. Gene mutations, methylation and microRNA can be detected simultaneously under single-tube conditions using the J-STAR-3M multicolor amplification melting curve method. Blocking modified fluorescent probes and short-sequence MGB probes are used to improve detection specificity and sensitivity.

Benefits of technology

It enables the simultaneous detection of gene mutations, methylation, and microRNA under single-tube conditions, improving the sensitivity and specificity of detection, reducing the false positive rate, and providing a richer, simpler, and more efficient multi-omics detection solution. The detection sensitivity is 93.1%, the specificity is 98.84%, and the overall concordance rate is 97.39%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518652A_ABST
    Figure CN121518652A_ABST
Patent Text Reader

Abstract

The invention relates to the field of gene detection, in particular to a primer probe combination for detecting minimal residual focus of colorectal cancer, a product and application of the primer probe combination. The invention provides a primer probe combination for detecting small residual focus of colorectal cancer, which is characterized in that on the basis of patents CN202110367693.8, CN20211073442. X, CN202410769300. X and CN118600008B, seamless combination of a multicolor melting curve and a multicolor blocking modification probe method, namely a J-STAR-3M multicolor amplification melting curve method, is realized through further iterative upgrading of a method system, and under the condition of a single tube, the detection of the small residual focus of colorectal cancer is realized. Multi-tissue biomarkers such as gene mutation, gene methylation and microRNA can be detected at the same time. Therefore, richer, simpler and more efficient multi-omics detection schemes can be provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection, and in particular to a primer-probe combination, product, and application for detecting minimal residual disease in colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is a common malignant tumor of the digestive tract in my country. Among diagnosed patients, the TNM stages are 18.6%, 42.5%, 30.7%, and 8.2% for I, II, III, and IV, respectively. More than 80% of patients are in the middle or late stages, and 44% of patients experience synchronous or metachronous distant metastases to sites such as the liver and lungs, severely impacting survival. 90% of colorectal cancer lesions can be surgically removed, but the overall recurrence rate after radical resection remains around 30%. The five-year survival rates for colorectal cancer in the Chinese population are 90.1%, 72.6%, 53.8%, and 10.4% for stages I, II, III, and IV, respectively. Minimal residual disease (MRD) is the main cause of recurrence after radical resection of the tumor.

[0003] MRD detection is primarily achieved through circulating tumor DNA (ctDNA) and microRNA. ctDNA is a DNA fragment released into the peripheral blood during tumor cell metabolism, apoptosis, or necrosis. ctDNA carries the specific genetic characteristics of the tumor cells from which it originates. In recent years, this technology has become an important tool in the diagnosis and treatment of colorectal cancer, providing effective evidence for early prognosis assessment, recurrence monitoring, efficacy evaluation, and medication guidance, and its value in precision oncology is increasingly prominent. Both the US NCCN Colorectal Cancer Guidelines and the Chinese CSCO Colorectal Cancer Diagnosis and Treatment Guidelines indicate that ctDNA testing can provide prognostic and predictive information for assessing the risk of postoperative recurrence and selecting adjuvant chemotherapy for colorectal cancer, assisting in adjuvant treatment decisions for stage II or III colorectal cancer patients.

[0004] Among various methods for detecting ctDNA, aside from specific mutation detection, methylation abnormalities in ctDNA are quite common in CRC, including classic tumor suppressor gene inactivation. CRC contains abundant regions of abnormal methylation, which show great potential in improving the sensitivity of MRD detection.

[0005] MicroRNAs can serve as biomarkers for predicting CRC recurrence. The levels of miR-1229, miR-1224-5p, miR-223, let-7a, miR-150, and miR-21 in the serum of colorectal cancer patients are significantly elevated, while their levels are significantly reduced after resection.

[0006] Solid tumor MRD detection technologies can be broadly categorized into PCR-based and NGS-based methods. Existing research primarily focuses on high-throughput sequencing (NGS), which is complex, time-consuming, and costly, with limited applicability and low adoption rate among cancer patients. PCR-based detection technologies for blood ctDNA and microRNA can be used for predicting recurrence in colorectal cancer, offering sensitivity, timeliness, and cost-effectiveness. However, they also have limitations, such as the inability to simultaneously detect gene methylation, gene mutations, and microRNA. Therefore, this invention aims to develop a method capable of simultaneously detecting gene methylation, gene mutations, and microRNA. Summary of the Invention

[0007] The purpose of this invention is to provide a primer-probe combination, product, and application for detecting minimal residual disease in colorectal cancer, in order to solve the problems existing in the prior art.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a primer-probe combination for detecting minimal residual disease in colorectal cancer, including primer pairs and probes for detecting gene mutation sites, methylation sites, and microRNA;

[0010] The gene mutation sites include the KRAS G12 mutation site and the KRAS G13 mutation site; the methylation sites include the SDC2 gene methylation site; the microRNA includes hsa-miR-21-5p;

[0011] The primer pairs for detecting the KRAS G12 mutation site and the KRAS G13 mutation site are shown in SEQ ID NO. 3-4, and the nucleotide sequence of the probe is shown in SEQ ID NO. 5;

[0012] The primer pairs for detecting the methylation sites of the SDC2 gene are shown in SEQ ID NO. 9-10, and the nucleotide sequence of the probe is shown in SEQ ID NO. 11;

[0013] The primer pair for detecting hsa-miR-21-5p is shown in SEQ ID NO.15-16, and the nucleotide sequence of the probe is shown in SEQ ID NO.17.

[0014] Preferably, the probes for detecting the KRAS G12 mutation site, the KRAS G13 mutation site, the SDC2 gene methylation site, and the hsa-miR-21-5p are all labeled with a fluorescent group at their 5' end and a quencher group at their 3' end.

[0015] Preferably, the fluorescent group is one of FAM, VIC, HEX, ROX and CY5; and the quenching group is one of MGB, Super Quencher 1, BHQ1, BHQ2 and BHQ3.

[0016] This invention provides the application of the above-described primer-probe combination in the preparation of products for detecting minimal residual disease in colorectal cancer.

[0017] Preferably, the product includes reagents, reagent kits, and chips.

[0018] This invention provides a product for detecting minimal residual disease in colorectal cancer, comprising the primer-probe combination described above.

[0019] More preferably, the product includes reagents, reagent kits, and chips.

[0020] This invention provides the application of the above-described primer-probe combination in the preparation of products for early screening of colorectal cancer.

[0021] More preferably, the product includes reagents, reagent kits, and chips.

[0022] This invention provides a product for early screening of colorectal cancer, characterized in that it comprises the above-described primer-probe combination.

[0023] More preferably, the product includes reagents, reagent kits, and chips.

[0024] This invention provides the application of the above-mentioned primer-probe combination in constructing a colorectal cancer risk assessment model.

[0025] This invention provides a colorectal cancer risk assessment model, which uses the above-mentioned primer and probe combination to perform fluorescence amplification detection on the test sample to obtain the melting Rm of KRAS G12 mutation site and KRAS G13 mutation site, the Ct value of SDC2 methylation site and the Ct value of hsa-miR-21-5p site;

[0026] Using the melting Rm values ​​of the KRAS G12 and KRAS G13 mutation sites, the Ct value of the SDC2 methylation site, and the Ct value of hsa-miR-21-5p as input variables, a colorectal cancer risk assessment model is constructed; the colorectal cancer risk assessment model calculates the risk value R according to the following equation:

[0027] R = 0.413 * Rm value of KRAS G12 mutation site and KRAS G13 mutation site - 0.172 * Ct value of SDC2 methylation site - 0.108 * Ct value of hsa-miR-21-5p + 9.418;

[0028] When P ≥ 0.061, the sample test result is positive; when P < 0.061, the sample test result is negative.

[0029] The present invention discloses the following technical effects:

[0030] This invention provides a primer-probe combination for detecting minimal residual disease (MRD) in colorectal cancer. Based on patents CN202110367693.8, CN202110734426.X, CN202410769300.X, and CN118600008B, it achieves a seamless integration of multicolor melting curves and multicolor blocking modified probes—the J-STAR-3M multicolor amplification melting curve method—through further iterative upgrades to the method system. This allows for the simultaneous detection of multiple tissue biomarkers, including gene mutations, gene methylation, and microRNA, under single-tube conditions. Therefore, it provides a richer, simpler, and more efficient multi-omics detection solution.

[0031] For colorectal cancer target gene mutation sites, the blocking modified fluorescent probe in the primer and probe mixture designed in this invention exhibits stronger binding stability to the DNA template than the nucleotide probe and DNA template in the absence of mismatch; however, in the presence of mismatch, the binding stability of the blocking modified fluorescent probe to the DNA template is weaker than that of the nucleotide probe and DNA template. Therefore, for single base mismatches, the blocking modified fluorescent probe has a larger melting temperature difference than the nucleotide probe, which is more conducive to distinguishing heterozygous mutants. For colorectal cancer target gene methylation sites, the primer and probe mixture designed in this invention contains a short-sequence MGB probe, which has high affinity and high specificity for the target sequence, effectively enhancing amplification sensitivity and specificity. In addition, the short-sequence MGB probe has weak repression performance, which can effectively reduce interference with the melting curve signal and achieve compatibility between the amplification curve and the melting curve. For colorectal cancer microRNA, an extended cDNA target fragment is obtained by stem-loop reverse transcription. A short MGB probe is designed in the binding region between the sequence introduced by the stem-loop reverse transcription primer and the microRNA transcription sequence. The short MGB probe sequence is in the same direction as the stem-loop reverse transcription primer and has the characteristics of high affinity and high specificity with the target sequence, thus achieving efficient and highly specific detection of microRNA.

[0032] The blocking modified fluorescent probes designed with primer-probe combinations provided by this invention are all single-end stem-loop structure probes. By introducing random bases and hairpin structures, the detection discrimination between wild-type and mutant types is enhanced, further improving the detection specificity of the kit. Furthermore, for gene mutation sites, the primer components in the primer-probe mixture provided by this invention employ an asymmetric combination scheme, which further reduces the possibility of probe degradation while meeting sensitivity requirements. For gene methylation sites and microRNA sites, the primer components in the primer-probe mixture employ a symmetric combination scheme, further reducing the repression effect of the amplification curve and achieving compatibility between the amplification and melting curves.

[0033] This invention also provides a product for detecting minimal residual disease (MRD) in colorectal cancer and for early screening of colorectal cancer. The product includes reagents, a kit, and a chip. The kit integrates DNA enzymatic conversion, rapid purification and recovery, microRNA reverse transcription, and amplification to achieve accurate and efficient detection of trace amounts of DNA methylation, DNA mutations, and microRNA transcripts in blood. The kit components of this invention include an enzymatic conversion component, a rapid magnetic bead purification component, a microRNA reverse transcription component, and an amplification detection component. The enzymatic conversion component mainly includes TET enzyme, an enzyme reaction buffer, a termination buffer, and a conversion buffer. The rapid magnetic bead purification component mainly consists of a magnetic bead mixture. The microRNA reverse transcription component mainly contains reverse transcriptase and a reverse transcription buffer containing specific stem-loop primers. The amplification detection component mainly includes an amplification enzyme mixture and an amplification buffer. The amplification enzyme mixture contains a combination of Taq DNA polymerase and UNG-dUTP. The unique stem-loop design at the 5' end of the blocking-modified fluorescent probe effectively inhibits the 5'~3' exonuclease activity of Taq DNA polymerase, thus preventing the blocking-modified fluorescent probe from being cleaved and releasing a fluorescent amplification signal. The short-sequence MGB probe can be efficiently cleaved by Taq DNA polymerase, thereby releasing a fluorescent amplification signal. UNG-dUTP provides stronger anti-contamination capability and effectively reduces false positives. Results from specific embodiments of this invention show that the kit provided by this invention has a sensitivity of 93.1%, a specificity of 98.84%, and an overall concordance rate of 97.39% for the detection of colorectal cancer MRD. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 The results are for the amplification of positive control samples. A: KRAS G12 / G13 gene mutation site and ACTB melting curve peaks; 1: KRAS G12 / 13 site peaks of the amplified positive control sample; 2: ACTB internal reference gene peaks of the amplified positive control sample. B: SDC2 gene methylation site, hsa-miR-21-5p microRNA and its internal reference multiplex amplification curves; a: hsa-miR-21-5p target amplification curve of the amplified positive control sample; b: GAPDH internal reference gene amplification curve of the amplified positive control sample; c: U6 internal reference gene amplification curve of the amplified positive control sample; d: SDC2 target amplification curve of the amplified positive control sample.

[0036] Figure 2 Receiver operating curve for predicting risk R-value for colorectal cancer MRD;

[0037] Figure 3 The peak diagrams are for gradient detection of KRAS G12 / G13 site standards; where 1: peak diagram of amplified KRAS G12D at 5% MT; 2: peak diagram of amplified KRAS G12D at 2.5% MT; 3: peak diagram of amplified KRAS G12D at 1% MT; 4: peak diagram of amplified KRAS G12D at 0.5% MT; 5: internal control peak diagram of amplified KRAS G12D.

[0038] Figure 4 Amplification curves for gradient standards amplifying SDC2 gene methylation sites; where 1: amplification curve for SDC2 gene methylation ratio of 10%; 2: amplification curve for SDC2 gene methylation ratio of 5%; 3: amplification curve for SDC2 gene methylation ratio of 1%; 4: amplification curve for SDC2 gene methylation ratio of 0.25%; a / b / c / d: amplification curves for internal reference gene GAPDH;

[0039] Figure 5 Amplification curves for the hsa-miR-21-5p target gradient standard; where 1: amplification hsa-miR-21-5p target concentration 1×10 4 1: Amplification curve of copies / μL; 2: Amplification of hsa-miR-21-5p target concentration 1×10 3 Amplification curve of copies / μL; 3: Amplification of hsa-miR-21-5p target concentration 5×10 2 Amplification curves for copies / μL; 4: Amplification of hsa-miR-21-5p target concentration 2.5×10 2 Amplification curves for copies / μL; a / b / c / d: amplification curves for internal control target U6;

[0040] Figure 6 The graph shows the results of liver cancer sample testing (risk R value is -3.035, less than 0.061); where A: KRAS G12 / G13 gene mutation site and internal reference ACTB melting curve peak, 1: KRAS G12 / 13 site peak of amplified liver cancer sample, which is a negative peak, 2: ACTB internal reference gene peak of amplified liver cancer sample; B: SDC2 gene methylation site, hsa-miR-21-5p microRNA and its internal reference multiplex amplification curve, a: hsa-miR-21-5p target amplification curve of amplified liver cancer sample, which is a positive signal (Ct=27.71), b: GAPDH internal reference gene amplification curve of amplified liver cancer sample, c: U6 internal reference gene amplification curve of amplified liver cancer sample;

[0041] Figure 7 The results of gastric cancer sample testing are shown in the figure (R value is -5.982, less than 0.061); where A: KRAS G12 / G13 gene mutation site and internal reference ACTB melting curve peak, 1: KRAS G12 / 13 site peak of amplified gastric cancer sample, which is a negative peak, 2: ACTB internal reference gene peak of amplified gastric cancer sample; B: SDC2 gene methylation site, hsa-miR-21-5pmicroRNA and its internal reference multiplex amplification curve, a: GAPDH internal reference gene amplification curve of amplified gastric cancer sample, b: U6 internal reference gene amplification curve of amplified gastric cancer sample.

[0042] Figure 8 The results of lung cancer sample testing are shown in the figure (R value is -1.464, less than 0.061). Among them, A: KRAS G12 / G13 gene mutation site and internal reference ACTB melting curve peak, 1: KRAS G12 / 13 site peak of amplified lung cancer sample, which is a positive peak, Rm value is 10.94, 2: ACTB internal reference gene peak of amplified lung cancer sample; B: SDC2 gene methylation site, hsa-miR-21-5p microRNA and its internal reference multiplex amplification curve, a: GAPDH internal reference gene amplification curve of amplified lung cancer sample, b: U6 internal reference gene amplification curve of amplified lung cancer sample. Detailed Implementation

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0045] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0046] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0047] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0048] Example 1: Selection of gene mutation sites, methylation sites, and microRNAs

[0049] The gene mutation site selected in this embodiment is the KRAS G12 / G13 gene mutation site, which is relatively common in colorectal cancer, with a mutation rate of approximately 40%-50%. KRAS gene subtype information is shown in Table 1. KRAS mutations can lead to the sustained activation of downstream signaling pathways such as MAPK and PI3K, promoting tumor cell proliferation, migration, and drug resistance, thus affecting patient prognosis. Some KRAS-mutant patients may convert to wild-type (neo-RAS wild-type) after treatment, indicating improved prognosis. MRD testing can detect acquired drug resistance mechanisms, such as the conversion of KRAS mutation status or activation of downstream signaling pathways, providing direction for subsequent treatment.

[0050] Table 1 KRAS subtype information

[0051]

[0052] Note: COSMIC is the abbreviation for Catalogue of Somatic Mutations in Cancer.

[0053] In this embodiment, the methylation sites selected were specific methylation sites of the SDC2 gene. This embodiment involved bisulfite sequencing analysis of the SDC2 promoter region in blood samples from 82 preoperative colorectal cancer patients, 64 postoperative colorectal cancer patients, and 73 healthy individuals. Fourteen methylation sites with high differential methylation were initially screened, and the cg18719750 methylation site was further selected as the optimal candidate.

[0054] Table 2. Information on preferred methylation sites in the SDC2 gene.

[0055]

[0056] Note: "+" indicates the sense strand; "-" indicates the antisense strand; CpG: abbreviation for Cytosine-phosphate-Guanine, that is: cytosine (C)-phosphate (p)-guanine (G). In the genome, the pattern in which cytosine (C) and guanine (G) are linked by a phosphodiester bond (p) is called CpG dinucleotide.

[0057] In this embodiment, 15 microRNAs selected in an independent study were amplified by real-time PCR and analyzed in the serum of 115 participants with preoperative colorectal cancer and 55 randomly selected control groups. The preferred microRNA site was hsa-miR-21-5p.

[0058] Table 3. Site information for prospective microRNA studies

[0059]

[0060] Example 2: Development of the reagent kit and detection method

[0061] The kit provided in this embodiment contains enzymatic conversion components, amplification inhibitors, microRNA reverse transcription components, amplification detection components, and primer-probe combinations.

[0062] The main components of the enzymatic conversion method are TET enzyme, enzyme reaction buffer, termination buffer, and conversion buffer. The TET enzyme components and their preferred concentration ranges are shown in Table 4, and the further preferred concentrations of the TET enzyme components are shown in Table 5. The enzyme reaction buffer components and their preferred concentration ranges are shown in Table 6, and the further preferred concentrations of the enzyme reaction buffer components are shown in Table 7. The termination buffer components and their preferred concentration ranges are shown in Table 8, and the further preferred concentrations of the termination buffer components are shown in Table 9. The conversion buffer components and their preferred concentration ranges are shown in Table 10, and the further preferred concentrations of the conversion buffer components are shown in Table 11.

[0063] Table 4. Components and preferred concentration ranges of TET enzyme

[0064]

[0065] Table 5. Components and further optimized concentrations of TET enzyme

[0066]

[0067] Table 6. Enzyme Reaction Buffer Components and Preferred Concentration Ranges

[0068]

[0069] Table 7. Enzyme Reaction Buffer Components and Further Optimal Concentrations

[0070]

[0071] Table 8. Termination Buffer Components and Preferred Concentration Ranges

[0072]

[0073] Table 9 Termination Buffer Components and Further Optimized Concentrations

[0074]

[0075] Table 10. Components and preferred concentration ranges of conversion buffer

[0076]

[0077] Table 11 Components of the conversion buffer and further optimized concentrations

[0078]

[0079] The enzymatic transformation component in the kit provided by this invention can convert 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) into 5-carboxycytosine (5caC) using TET enzyme, and then convert 5-carboxycytosine into uracil using 2-methylpyridine-borane, thereby achieving fluorescent PCR detection. The methylation transformation kit in this invention has advantages such as less destructiveness, higher efficiency, and preservation of more original sample information. The transformation steps are as follows:

[0080] Using the components listed in Table 12, an oxidation reaction system was constructed, and then reacted in a PCR instrument at 40℃ for 1 h to convert 5-methylcytosine and 5-hydroxymethylcytosine into 5-carboxycytosine.

[0081] Add 2 μL of termination buffer to the oxidation reaction system after the reaction is complete, and place it in a PCR instrument to react at 55℃ for 10 min.

[0082] Add 13 μL of conversion buffer to the system after the above reaction is completed, and then react in a PCR instrument at 37°C for 10 h to convert 5-carboxycytosine to uracil.

[0083] Table 12 Establishment of the oxidation reaction system

[0084]

[0085] To remove amplification inhibitors from the enzymatically converted components, the kit provided by this invention is designed with a rapid purification and recovery component after enzymatic conversion, the main component of which is a mixture of sorting magnetic beads.

[0086] The steps for removing amplification inhibitors from the enzymatic conversion components (purification and recovery steps) are as follows: Take 150 μL of the well-mixed magnetic bead mixture, equilibrate at room temperature for 30 min, and vortex it with the enzyme conversion product. After reacting at room temperature for 10 min, briefly centrifuge, and then place it on a magnetic rack to separate the magnetic beads and supernatant. Take 300 μL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat the rinsing once. Open the cap and air-dry the magnetic beads until they just begin to crack. Finally, take 20 μL of DNA nuclease-free water and mix it with the magnetic beads, incubate at room temperature for 5 min, and then use a magnetic rack to separate and elute.

[0087] The microRNA reverse transcription component of the kit provided by this invention mainly comprises reverse transcriptase and a reverse transcription buffer containing specific stem-loop primers. The reverse transcriptase components and their preferred concentration ranges are shown in Table 13, and further preferred concentrations of each reverse transcriptase component are shown in Table 14. The reverse transcription buffer components and their preferred concentration ranges are shown in Table 15, and further preferred concentrations of each reverse transcription buffer component are shown in Table 16.

[0088] In this invention's kit, the microRNA reverse transcription buffer contains target microRNA-specific stem-loop reverse transcription primers and internal reference gene-specific reverse transcription primers. Preferred reverse transcription primer sequences are shown in Table 17, and these primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0089] Table 13 Reverse transcriptase components and preferred concentration ranges

[0090]

[0091] Table 14 Reverse transcriptase components and further optimized concentrations

[0092]

[0093] Table 15 Components and Optimal Concentration Range of 5× Reverse Transcription Buffer

[0094]

[0095] Table 16 Components of 5× Reverse Transcription Buffer and Further Optimized Concentrations

[0096]

[0097] Table 17 Reverse transcription primer sequence information

[0098]

[0099] This invention constructs a microRNA reverse transcription reaction system by increasing the amounts of the components listed in Table 18, and then reacts it in a PCR instrument at 50°C for 10 min. The serum / plasma microRNA extraction and purification kit involved in this invention is miRNeasySerum / Plasma Advanced Kit–microRNA Isolation (Qiagen, 217204).

[0100] Table 18 Construction of the reverse transcription reaction system

[0101]

[0102] The amplification detection components in the kit of this invention mainly include an amplification enzyme mixture and an amplification buffer. The components and preferred concentration ranges of the amplification enzyme mixture are shown in Table 19, and further preferred concentrations of each component are shown in Table 20. The components and preferred concentration ranges of the amplification buffer are shown in Table 21, and further preferred concentrations of each component are shown in Table 22.

[0103] Table 19 Components and Preferred Concentration Range of Amplification Enzyme Mixture

[0104]

[0105] Table 20 Components of the amplification enzyme mixture and further optimized concentrations

[0106]

[0107] Table 21 2× Amplification Buffer Components and Optimal Concentration Range

[0108]

[0109] Table 22 2× Amplification Buffer Components and Further Optimized Concentrations

[0110]

[0111] The J-STAR-3M multicolor amplification melting curve method provided by this invention uses blocking modified fluorescent probes, i.e., random mismatched sequences are introduced into the original oligonucleotide fluorescent probes, and they are modified by any one or more of the following methods: thio-modification, deoxyuridine modification, deoxyhypoxanthine modification, 2-methoxy modification, and phosphorylation modification. The J-STAR-3M multicolor amplification method in this invention uses MGB-modified Taqman probes for amplification. The blocking modified fluorescent probes in this invention are labeled with a fluorescent group at the 5′ end and a quenching group at the 3′ end. The fluorescent group is one of FAM, VIC, HEX, ROX, CY5, or other fluorescent groups with luminescent properties, and the quenching group is one of MGB, SuperQuencher 1, BHQ1, BHQ2, BHQ3, or other chemical groups with fluorescence quenching function. The amplification probe involved in the kit of this invention is labeled with a fluorescent group at its 5′ end, which is one of FAM, VIC, HEX, ROX, CY5, or other fluorescent groups with luminescent properties, and the quenching group is MGB. The preferred oligonucleotide upstream primer, oligonucleotide downstream primer, blocking modified fluorescent probe sequence, and amplification primer are shown in Table 23. The preferred oligonucleotide upstream primer, oligonucleotide downstream primer, blocking modified fluorescent probe sequence, and amplification probe are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0112] Table 23 Information on amplification primers and probe sequences

[0113]

[0114] Note: N represents A, T, C or G.

[0115] Construct the amplification reaction system by adding the components in Table 24, and then set the amplification program in the PCR instrument according to the parameters in Table 25.

[0116] Table 24 Amplification System Configuration

[0117]

[0118] Note: *The amount of enzyme-converted cfDNA and unconverted cfDNA added to the kit provided by this invention ranges from 15 to 100 ng / reaction; the recommended optimal amount of enzyme-converted cfDNA and unconverted cfDNA is 20 ng / reaction; all miRNA reverse transcription product cDNA is added to the amplification system.

[0119] Table 25 Amplification Program Settings*

[0120]

[0121] Note: *The reagent kit of this invention is compatible with the following instruments: SLAN®-96P / SLAN®-96S, temperature control mode selection module.

[0122] Example 3: Establishment and Validation of Risk Analysis and Judgment Methods

[0123] Clinical sample collection:

[0124] This embodiment strictly adheres to the Declaration of Helsinki of the World Medical Association. The urine clinical samples required for this clinical trial were obtained from hospitals in Shanghai Pudong, Hangzhou, Zhejiang and Tai'an, Shandong, and were approved by the ethics committees of the aforementioned institutions.

[0125] This clinical trial collected serum / plasma samples from hospitalized patients in hospitals in Shanghai Pudong, Hangzhou (Zhejiang), and Tai'an (Shandong) between July 2024 and August 2025. In the case group, there were 153 colorectal cancer patients (13 stage I, 52 stage II, 63 stage III, and 25 stage IV). 115 patients with stage II and III colorectal cancer were recruited. In addition to preoperative sampling, blood samples were collected within one week postoperatively to initially assess the surgical effect on tumor removal. Sampling was then conducted every three months until the 12th month, unless the patient tested positive for MRD or died. A total of 501 samples were collected. In the control group, there were 78 healthy individuals.

[0126] The patients who provided the above samples agreed to participate in the questionnaires related to this study and to donate blood, and agreed to complete the "Informed Consent Form". The subjects were not related to each other by blood.

[0127] Sample extraction:

[0128] Centrifuge 10 mL of whole blood at room temperature to obtain plasma samples. Take 4 mL of plasma and extract cfDNA using the QIAamp Circulating Nucleic Acid Kit (50) (Cat. No. 55114). Refer to the kit instructions for specific procedures. After extraction, elute with 40 μL of enzyme-free water. Quantify the sample using the Qubit™ dsDNA quantification kit. Take 200 μL of plasma and extract microRNA using the miRNeasy Serum / Plasma Advanced Kit–microRNAIsolation (Qiagen, 217204). Elute with 15 μL of enzyme-free water. Quantify the microRNA using the Qubit™ microRNA quantification kit.

[0129] Enzyme conversion and purification recovery:

[0130] Take 20-50 ng of the extracted cell-free DNA from the above sample, add the components in Table 12 (the TET enzyme mixture in Table 12 is prepared according to Table 7), construct an oxidation reaction system, and then react in a PCR instrument at 40℃ for 1 h to convert 5-methylcytosine and 5-hydroxymethylcytosine into 5-carboxycytosine. Then add 2 μL of termination buffer (Table 9) to the oxidation reaction system after the reaction is completed, and place it in a PCR instrument at 55℃ for 10 min. Finally, add 13 μL of conversion buffer (Table 11) to the system after the reaction is completed, and then react in a PCR instrument at 37℃ for 10 h to convert 5-carboxycytosine into uracil.

[0131] Take 150 μL of the well-mixed magnetic bead sorting solution, equilibrate at room temperature for 30 min, and vortex it with the enzyme conversion product. React at room temperature for 10 min, then briefly centrifuge. Place the mixture on a magnetic rack to separate the beads and supernatant. Rinse the beads with 300 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat the rinsing once. Air-dry the beads until they just begin to crack. Finally, mix 20 μL of DNA nuclease-free water with the beads, incubate at room temperature for 5 min, and then elute using a magnetic rack. Purify and recover the transformed DNA, and quantify the sample using the Qubit™ dsDNA quantification kit.

[0132] microRNA reverse transcription:

[0133] Take 7 μL of enzyme-free water to elute total microRNA, construct the reverse transcription reaction system according to Table 18 (the reverse transcriptase component in Table 18 is prepared according to Table 14, and the 5× reverse transcription buffer component is prepared according to Table 16), and then react in a PCR instrument at 50℃ for 10 min for later use.

[0134] Amplification Analysis

[0135] Following the amplification system setup in Table 24, prepare the amplification reaction solution and perform fluorescence amplification analysis according to the amplification reaction procedure in Table 25. After the reaction, manually adjust the baseline to the exponential phase of the amplification curve to determine a suitable threshold line, thereby obtaining the Ct and Rm values ​​for different channels. Data quality control is shown in Table 26 below.

[0136] Table 26 Amplified Data Quality Control*

[0137]

[0138] *Note: All of the above conditions must be met in the same experiment; otherwise, the results of this experiment will be invalid.

[0139] The above experiments examined 153 colorectal cancer samples and 78 healthy individuals. The proportions of the gene mutation site KRASG12 / G13, gene methylation site SDC2, and microRNA site hsa-miR-21-5p in colorectal cancer and healthy individuals are shown in Table 27. The sensitivity and specificity of the gene mutation sites, methylation sites, and microRNA sites involved in this invention are shown in Table 28.

[0140] For the test results of the above 231 clinical blood samples, logistic regression was performed with the melting Rm value of KRAS G12 / G13 gene mutations, the Ct value of SDC2 methylation sites, and the Ct value of microRNA sites, and the clinical pathological diagnosis results to construct the positive predictive risk value (R value) for colorectal cancer MRD of gene mutations, gene methylation, and microRNA sites. R = 0.413 * KRAS (KRAS G12 mutation site and KRAS G13 mutation site) Rm value - 0.172 * SDC2 (SDC2 methylation site) Ct value - 0.108 * microRNA (hsa-miR-21-5p) Ct value + 9.418. If there is no positive peak in KRAS G12 / G13, the Rm value is determined to be 0; if the amplification Ct of SDC2 and microRNA is >55, the Ct value is determined to be 55.

[0141] The above sample test results were converted into risk values. Using MedCalc software, the melting Rm of KRAS G12 / G13 gene mutations, the Ct values ​​of SDC2 methylation sites, and the Ct values ​​of microRNA sites were analyzed. Combined with clinicopathological results, ROC curves were constructed and the optimal cut-off risk value was determined. The receiver operating curve is shown below. Figure 2 As shown, the AUC was 0.912. When the R value was ≥0.061, the sample test result was positive for colorectal cancer MRD, and when the R value was <0.061, the sample test result was negative for colorectal cancer MRD.

[0142] A total of 501 clinical samples were collected from 115 out of 153 patients who underwent surgery for one year. The clinical diagnostic results were used as the gold standard to validate the R-value for the risk of colorectal cancer recurrence. The results showed that the kit provided by this invention had a sensitivity of 93.1%, a specificity of 98.84%, and an overall concordance rate of 97.39% for the detection of MRD in colorectal cancer (Tables 29-31).

[0143] Figure 1 This is a standard graph showing the positive control results of the kit. Its purpose is to demonstrate the positive signal at the detection site of the sample. In this embodiment, when testing clinical samples, both positive and negative controls are tested simultaneously. The positive control consists of two tubes: Positive control tube 1 is prepared by mixing SW1990 gDNA from the KRAS G12D mutant positive cell line and SW620 gDNA from the colorectal cancer cell line in equal proportions; Positive control tube 2 is composed of a mixture of artificially synthesized hsa-miR-21-5p and U6 RNA fragment in equal proportions. The nucleotide sequence of hsa-miR-21-5p is UAGCUUAUCAGACUGAUGUUGA, SEQ ID NO. 21; the nucleotide sequence of U6 is GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTTT, SEQ ID NO. 21.

[0144] Table 27 Results of Preoperative Sample Collection Used for Risk Value Establishment

[0145]

[0146] Table 28 Positive cutoff values ​​for preoperative detection of relevant gene mutations, methylation, and microRNA sites in colorectal cancer

[0147]

[0148] Table 29. Detection results of 115 postoperative cases of colorectal cancer.

[0149]

[0150] Table 30. Four-fold table judgment of 115 postoperative colorectal cancer patients.

[0151]

[0152] Table 31 Sensitivity and Specificity of Risk Analysis R-determination

[0153]

[0154] Example 4 Detection Limit

[0155] gDNA extraction from cell lines:

[0156] Genomic DNA was extracted from the following cell lines using a blood / cell / tissue genomic DNA extraction kit (Tiangen Biotech, DP304): KRAS G12D mutation-positive cell line SW 1990 (manufacturer: Fubai Ao (Suzhou) Biomedical Technology Co., Ltd., catalog number: FNC0138), KRAS G12D mutation-negative cell line HFF-1 (manufacturer: Fubai Ao (Suzhou) Biomedical Technology Co., Ltd., catalog number: FNC0145), and colorectal cancer cell line SW620 (manufacturer: Fubai Ao (Suzhou) Biomedical Technology Co., Ltd., catalog number: FNC0118). Samples were quantified using the Qubit™ dsDNA quantification kit. The KRAS G12D mutation frequency in the gDNA of the KRAS G12D mutation-positive cell line SW 1990 was confirmed using digital PCR.

[0157] Sulfite conversion:

[0158] 1000 ng of extracted KRAS G12D mutation-negative cell line HFF-1 and colorectal cancer cell line SW620 gDNA were taken and sulfite-converted using the EZ DNA Methylation Kit (ZYMO). After purification and recovery, the samples were quantified using the Qubit™ dsDNA quantification kit.

[0159] microRNA reverse transcription:

[0160] Take the artificially synthesized microRNA and dilute it to 10⁻¹⁰ using TE buffer. 5 copies / μL, 10 4 copies / μL, 10 3copies / μL. Prepare the reverse transcription system according to Table 18 (the reverse transcriptase components in Table 18 are prepared according to Table 14, and the 5× reverse transcription buffer components are prepared according to Table 16). Then, incubate at 50℃ for 10 min in a PCR instrument. Quantitatively confirm the reverse transcription products using digital PCR.

[0161] Reference sample configuration for detection limit:

[0162] Take gDNA from the KRAS G12D mutation-positive cell line SW1990 and the KRAS G12D mutation-negative cell line HFF-1, respectively, and dilute it to 10 ng / μL using TE buffer. Then, use 10 ng / μL of KRAS G12D mutation-negative cell line HFF-1 gDNA and KRAS G12D mutation-positive cell line SW1990 gDNA to dilute to 10 ng / μL 5% MT, 10 ng / μL 2.5% MT, 10 ng / μL 1% MT and 10 ng / μL 0.5% MT for later use.

[0163] Take sulfite-transformed KRAS G12D mutation-negative cell line HFF-1 and colorectal cancer cell line SW620 gDNA, and dilute them to 10 ng / μL using TE buffer. Then, using 10 ng / μL of sulfite-transformed HFF-1 gDNA, dilute 100% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA to a concentration of 10 ng / μL for use. Also dilute 10% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA to a concentration of 10 ng / μL for use. Other concentrations include 10 ng / μL of 10% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA, 10 ng / μL of 5% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA, 10 ng / μL of 1% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA, and 10 ng / μL of 0.25% methylated sulfite-transformed colorectal cancer cell line SW620 gDNA.

[0164] Take the microRNA reverse transcription product cDNA and dilute it to 1×10 using TE buffer. 4 copies / μL, 1×10 3 copies / μL, 5×10 2 copies / μL and 2.5×10 2 Copies / μL are available for later use.

[0165] Amplification analysis:

[0166] Referring to the amplification system setup in Table 24, prepare the amplification reaction solution, and refer to the amplification reaction procedure in Table 25 to perform fluorescence amplification analysis. The amplification results are as follows: Figures 3-5 As shown. The results show:

[0167] Under the condition of 20 ng / reaction increment, the kit of the present invention was repeated 20 times. It can detect 100% of KRAS G12D site gDNA at 1% MT and 80% of KRAS G12D site gDNA at 0.5% MT. Therefore, the KRAS G12D site detection sensitivity of the kit of the present invention is 1% mutation frequency at 20 ng / reaction.

[0168] Under the condition of 20 ng / reaction dosage, the kit of the present invention was repeated 20 times. When detecting SW620 gDNA with a methylation ratio of 1%, the SDC2 gene site could be detected normally. When detecting SW620 gDNA with a methylation ratio of 0.25%, the SDC2 gene methylation site could be detected at 75%. Therefore, the sensitivity of the SDC2 methylation site is the methylation frequency of 1% under the condition of 20 ng.

[0169] Using the kit, respectively 1×10 4 copies / μL, 1×10 3 copies / μL, 5×10 2 copies / μL and 2.5×10 2 cDNA copies / μL were analyzed 20 times in 5×10⁻⁶ assays. 2 Under the condition of increasing the dosage to copies / μL, 100% detection can be achieved at 2.5×10⁻⁶. 2 Under the condition of increased copies / μL dosage, its detection rate is only 65%. Therefore, the limit of detection for the hsa-miR-21-5p site is 5 × 10⁻⁶. 2 copies / μL (5×10) 2 The extracted microRNA concentration corresponding to cDNA copies / μL was 2.12 × 10⁻⁶. 3 (copies / μL).

[0170] Example 5 Specificity

[0171] Plasma samples were collected from 7 liver cancer patients, 9 stomach cancer patients, and 13 lung cancer patients from hospitals in Pudong, Shanghai; Hangzhou, Zhejiang; and Tai'an, Shandong.

[0172] Sample extraction:

[0173] Centrifuge 10 mL of whole blood at room temperature to obtain plasma samples. Take 4 mL of plasma and extract cfDNA using the QIAamp Circulating Nucleic Acid Kit (50) (Cat. No. 55114). Refer to the kit instructions for specific procedures. After extraction, elute with 40 μL of enzyme-free water. Quantify the sample using the Qubit™ dsDNA quantification kit. Take 200 μL of plasma and extract microRNA using the miRNeasy Serum / Plasma Advanced Kit–microRNAIsolation (Qiagen, 217204). Elute with 15 μL of enzyme-free water. Quantify the microRNA using the Qubit™ microRNA quantification kit.

[0174] Enzyme conversion and purification recovery:

[0175] Take 20-50 ng of the extracted cell-free DNA from the above sample, and add the components in Table 12 (the TET enzyme mixture in Table 12 is prepared according to Table 7) to construct an oxidation reaction system. Then, in a PCR instrument, react at 40℃ for 1 h to convert 5-methylcytosine and 5-hydroxymethylcytosine into 5-carboxycytosine. Then, add 2 μL of termination buffer to the oxidation reaction system after the reaction is completed, and place it in a PCR instrument to react at 55℃ for 10 min. Finally, add 13 μL of conversion buffer to the system after the reaction is completed, and then in a PCR instrument, react at 37℃ for 10 h to convert 5-carboxycytosine into uracil.

[0176] Take 150 μL of the well-mixed magnetic bead sorting solution, equilibrate at room temperature for 30 min, and vortex it with the enzyme conversion product. React at room temperature for 10 min, then briefly centrifuge. Place the mixture on a magnetic rack to separate the beads and supernatant. Rinse the beads with 300 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat the rinsing once. Air-dry the beads until they just begin to crack. Finally, mix 20 μL of DNA nuclease-free water with the beads, incubate at room temperature for 5 min, and then elute using a magnetic rack. Purify and recover the transformed DNA, and quantify the sample using the Qubit™ dsDNA Quantification Kit.

[0177] microRNA reverse transcription:

[0178] Take 7 μL of enzyme-free water to elute total microRNA, construct a reverse transcription reaction system according to Table 18, and then react in a PCR instrument at 50℃ for 10 min for later use.

[0179] Amplification Analysis

[0180] Referring to the amplification system setup in Table 24, prepare the amplification reaction solution and perform fluorescence amplification analysis according to the amplification reaction procedure in Table 25. After the reaction, manually adjust the baseline to the exponential phase of the amplification curve to determine a suitable threshold line, thereby obtaining the Ct and Rm values ​​for different channels. Data quality control is shown in Table 26.

[0181] The statistically obtained Ct and Rm values ​​of the samples were converted using the colorectal cancer MRD positive prediction risk formula: R = 0.413 * KRAS Rm value - 0.172 * SDC2 Ct value - 0.108 * microRNA Ct value + 9.418. The results showed that the R values ​​of 7 liver cancer patients, 9 gastric cancer patients, and 13 lung cancer patients were all less than 0.061, consistent with expectations. This indicates that the kit of the present invention has good analytical specificity in liver cancer, gastric cancer, and lung cancer samples.

[0182] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer probe combination for detecting a colorectal cancer minimal residual disease, characterized in that, The primer pair and probe for detecting the genetic mutation site, methylation site and MicroRNA include; The genetic mutation site includes KRAS G12 mutation site and KRAS G13 mutation site; the methylation site includes SDC2 gene methylation site; and the MicroRNA includes hsa-miR-21-5p; The primer pair for detecting the KRAS G12 mutation site and the KRAS G13 mutation site is shown as SEQ ID NO. 3-4, and the nucleotide sequence of the probe is shown as SEQ ID NO. 5; The primer pair for detecting the SDC2 gene methylation site is shown as SEQ ID NO. 9-10, and the nucleotide sequence of the probe is shown as SEQ ID NO. 11; The primer pair for detecting the hsa-miR-21-5p is shown as SEQ ID NO. 15-16, and the nucleotide sequence of the probe is shown as SEQ ID NO.

17.

2. The primer probe combination according to claim 1, characterized in that, The probes for detecting the KRAS G12 mutation site, the KRAS G13 mutation site, the SDC2 gene methylation site and the hsa-miR-21-5p are all labeled with a fluorescent group at the 5' end and a quencher group at the 3' end.

3. The primer probe combination of claim 2, wherein, The fluorescent group is one of FAM, VIC, HEX, ROX and CY5; and the quencher group is one of MGB, Super Quencher 1, BHQ1, BHQ2 and BHQ3.

4. Use of the primer-probe combination of any one of claims 1-3 in the preparation of a product for detecting micro residual lesions of colorectal cancer.

5. Use according to claim 4, characterized in that, The product includes reagents, kits and chips.

6. A product for detecting a microresidual lesion of colorectal cancer, characterized by, The primer-probe combination of any one of claims 1-3 is included.

7. Use of the primer-probe combination of any one of claims 1-3 in the preparation of a product for early screening of colorectal cancer.

8. A product for early screening of colorectal cancer, characterized by, The primer-probe combination of any one of claims 1-3 is included.

9. Use of the primer-probe combination of any one of claims 1-3 in the construction of a colorectal cancer risk assessment model.

10. A model for assessing risk of colorectal cancer, characterized in that, The primer-probe combination of any one of claims 1-3 is used for fluorescence amplification detection of a detection sample, to obtain the melting curve Rm of the KRAS G12 mutation site and the KRAS G13 mutation site, the Ct value of the SDC2 methylation site and the Ct value of the hsa-miR-21-5p site; The melting curve Rm of the KRAS G12 mutation site and the KRAS G13 mutation site, the Ct value of the SDC2 methylation site and the Ct value of the hsa-miR-21-5p are used as input variables to construct a colorectal cancer risk assessment model; and the colorectal cancer risk assessment model calculates a risk value R according to the following equation: R = 0.413 * KRAS G12 mutation site and KRAS G13 mutation site Rm value - 0.172 * SDC2 methylation site Ct value - 0.108 * hsa-miR-21-5p Ct value + 9.418; When the P is greater than or equal to 0.061, the detection result of the sample is positive. The sample test result is negative when the P is less than 0.

061. The sample test result is negative when the P is less than 0.061.

Citation Information

Patent Citations

  • Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof

    CN113005228A

  • Detection kit for synchronously detecting multiple blood circulation system pathogens and detection method thereof

    CN113234866A

  • A primer-probe combination, kit and application for detecting the benign and malignant nature of pulmonary nodules

    CN118600008B

  • Prognosis detection primer probe and kit thereof for colorectal cancer

    CN106350596A

  • Kit for colorectal cancer diagnosis by miRNA joint detection

    CN109295233A