Molecular marker for detecting anti-ALS inhibitor herbicide brome, specific primer pair and application
By developing molecular markers and specific primer pairs targeting the ALS inhibitor herbicide brome, and combining PCR amplification and enzyme digestion electrophoresis, the problem of low identification accuracy was solved, enabling rapid, simple and efficient detection of resistant brome.
Patent Information
- Application Number
- CN202511721757.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-21
- Publication Date
- 2026-02-13
AI Technical Summary
Existing technologies have low accuracy in identifying brome, a herbicide that inhibits ALS, and traditional methods are complex, costly, and difficult to effectively detect new mutation types.
A novel molecular marker and specific primer pair was developed to target the Ala-205-Met mutation of the ALS inhibitor herbicide brome. Rapid and simple identification was achieved by PCR amplification and restriction endonuclease digestion combined with agarose gel electrophoresis.
It achieves highly accurate detection of the ALS inhibitor herbicide brome, shortens identification time, reduces costs, and can effectively detect new mutation types, thus improving detection efficiency.
Smart Images

Figure CN121518686A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular biology, in particular, relates to a kind of detection anti-ALS inhibitor herbicide brome molecular marker, specific primer pair and application. BACKGROUND
[0002] Wheat is an important food crop in China, and its yield level is directly related to national food security and livelihood protection. Weed damage is one of the key factors affecting wheat yield. In recent years, affected by global climate change, optimization of agricultural planting structure, popularization of mechanized production and introduction of cross-regional varieties, the weed population structure in wheat field has changed significantly. Among them, brome has gradually become one of the malignant weeds in wheat field. In brome-occurring areas, it can usually cause 15%-30% reduction in wheat yield, and in severe cases, it can even cause yield loss of up to about 70% in the field. Currently, the production of brome is mainly dependent on chemical herbicides such as flazasulfuron, metazachlor and mesosulfuron.
[0003] Flazasulfuron, metazachlor and mesosulfuron all belong to ALS inhibitors, which are often used as stem-leaf treatment agents. Their mechanism of action is to inhibit the activity of ALS in weeds, block the synthesis of leucine (Leu), isoleucine (Ile) and valine (Val), and thus cause the death of weeds due to nutrient deficiency. However, due to the continuous use of this type of agent for many years, serious brome populations resistant to flazasulfuron, metazachlor and mesosulfuron have appeared in Hebei, Henan, Tianjin and Shandong provinces.
[0004] In the current lack of scientific resistance control technology and popularization of knowledge, the dosage of the drug is often increased to pursue the control effect, which not only increases the cost of weed control, but also increases the risk of wheat phytotoxicity, and further aggravates the development of resistant weeds. Therefore, it is particularly urgent to develop an efficient, rapid and simple method for detecting resistant weeds.
[0005] Currently, developing efficient molecular marker technology is an important way to detect resistant brome. However, the widely used CAPS / dCAPS molecular marker can only detect some known ALS gene mutations, including Ala-122-Thr / Tyr / Val, Pro-197-Ala / Arg / Asn / Cys / Glu / Gly / Met / Tyr / Leu / Ser / Thr / His, Ala-205-Val, Asp-376-Glu, Arg-377-His, Trp-574-Arg / Gly / Met / Leu, Ser-653-Asn / Thr / Ile and Gly-654-Glu / Asp locus mutations caused by ALS inhibitor herbicide-resistant brome. SUMMARY
[0006] This invention proposes a molecular marker, specific primer pair, and application for detecting the ALS inhibitor herbicide brome, which solves the problem of low accuracy in the identification of the ALS inhibitor herbicide brome in related technologies.
[0007] The technical solution of the present invention is as follows: This invention proposes a molecular marker for detecting the anti-ALS inhibitor herbicide *Brassica napus*. The amino acid sequence of the molecular marker is shown in SEQ ID NO.1. The amino acid sequence of the mutant protein of the anti-ALS inhibitor herbicide *Brassica napus* corresponds to the mutation of Ala to Met at position 205 of the amino acid sequence of wild-type *Brassica napus*.
[0008] The present invention also proposes a specific primer pair for detecting the anti-ALS inhibitor herbicide brome, the specific primer pair being used to amplify molecular markers, and the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0009] This invention creatively develops a specific primer pair for detecting ALS-resistant ALS-inhibiting herbicides, specifically defined in this invention, based on the Ala-205-Met mutation in the target gene ALS, which is related to the occurrence and development of resistance in bromelain. This primer pair can be directly used for the identification of ALS-resistant ALS-inhibiting herbicides. Compared with traditional homologous cloning and mutation site detection methods based on PCR product sequencing, this method is simpler to operate, significantly reduces costs, and has good repeatability and higher result accuracy, with an accuracy of up to 100%.
[0010] As a further technical solution, the ALS inhibitor herbicides mainly include one or more of the following: sulfonylureas, imidazolinones, pyrimidine thiobenzoates, triazolopyrimidines, and xanthamide carbonyl triazolones.
[0011] The present invention also proposes the application of the specific primer pair described above in the preparation of products for detecting the anti-ALS inhibitor herbicide brome.
[0012] As a further technical solution, the product is a reagent kit.
[0013] This invention also proposes a method for detecting the ALS inhibitor herbicide brome, comprising the following steps: S1. DNA extraction: Extract genomic DNA from the test sample, *Brassica rapa*. S2. PCR amplification: Using the genomic DNA of the test substance, Broccoli, as a template, a PCR reaction system is constructed, and PCR amplification is performed using the specific primer pair described above to obtain the PCR amplification product. S3. Enzyme digestion: Construct an enzyme digestion system and use restriction endonucleases to digest the PCR amplification products to obtain the digested products; S4. Electrophoresis: The enzyme digestion products are detected by gel electrophoresis, and the results are used for identification. When the enzyme digestion product is positive, that is, an enzyme digestion product with a band length of 595bp is obtained, the brome is an anti-ALS inhibitor herbicide brome. Conversely, when the enzyme digestion product is negative, an enzyme digestion product with two bands of 209bp and 386bp or three bands of 595bp, 209bp and 386bp is obtained, the brome is a wild-type brome.
[0014] The method for identifying the ALS inhibitor herbicide brome using special primers provided by this invention can significantly shorten the time required for identifying resistant populations, obtaining accurate results in just 2 hours, thus significantly improving detection efficiency. It has both important theoretical reference value and practical application value for formulating scientific and effective brome control strategies.
[0015] As a further technical solution, the gel electrophoresis is 2% agarose gel electrophoresis, and the electrophoresis detection conditions are: 140V electrophoresis for 40 minutes.
[0016] As a further technical solution, the PCR reaction system is as follows: 5µL of 2×Es Taq MasterMix, 1µL of forward primer, 1µL of reverse primer, 1µL of DNA template, and ddH2O added to make up to 25µL.
[0017] As a further technical solution, the concentrations of both the forward primer and the reaction primer are 10 µM.
[0018] As a further technical solution, in step S2, the reaction conditions for PCR amplification are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 20 s, 63℃ annealing for 20 s, 72℃ extension for 15 s, 34 cycles; and finally 72℃ extension for 10 min.
[0019] As a further technical solution, in step S3, the enzyme digestion system is: 0.5µL restriction endonuclease, 5µL PCR amplification product, 2µL rCutSmart buffer, and ddH2O added to make up to 20µL.
[0020] As a further technical solution, in step S3, the restriction endonuclease includes MluI.
[0021] As a further technical solution, the enzyme digestion temperature is 37°C and the enzyme digestion time is 40 min.
[0022] The working principle and beneficial effects of this invention are as follows: This invention creatively discovered a new mutation based on known mutations when detecting the ALS inhibitor herbicide *Brassica napus*, and developed a new molecular marker. This can better improve the molecular identification system of ALS inhibitor herbicide *Brassica napus*, avoid errors in the identification of resistant *Brassica napus* due to missed detection of new mutations, and provide a theoretical basis for the long-term management of ALS inhibitor herbicide *Brassica napus*. Attached Figure Description
[0023] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0024] Figure 1 This is a gel electrophoresis image of the PCR amplification product obtained using specific primer pair 1 after enzymatic digestion in Example 2 of the present invention; In the figure: M represents Marker DL2000, 1-10 represent sensitive bromegranate populations (S), and 11-20 represent resistant bromegranate populations (R). Detailed Implementation
[0025] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0026] The DNA extraction method using the DNAsecure novel plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd.) in the following examples is as follows: (1) Take 0.15g of fresh bromegranate single plant leaves, add liquid nitrogen to a mortar and grind them into powder, then transfer them into a 1.5mL sterile centrifuge tube; (2) Add 250µL of solution RB1 and shake well; (3) Add 30µL of 10% SDS and 15µL of RNase A to the centrifuge tube in step (2) and mix thoroughly; (4) Water bath at 55℃ for 15 minutes; (5) Centrifuge at 12000 rpm for 5 min, and gently aspirate the supernatant into another clean centrifuge tube; (6) Add 100µL of solution PB1, mix thoroughly, incubate on ice for 5 min, and centrifuge at 12000rpm for 5 min; (7) Gently aspirate the supernatant into another clean centrifuge tube, add 375µL of solution BB1, and mix thoroughly; (8) Transfer the mixture into the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the effluent; (9) Add 500µL CB1, centrifuge at 12000rpm for 30s, and discard the effluent; (10) Add 500µL WB1, centrifuge at 12000rpm for 30s, and discard the effluent; (11) Repeat step (10) once; (12) Place the adsorption column in a clean centrifuge tube, add 50µL of EB preheated at 60℃ to the center of the column, let it stand at room temperature for 1 min, then centrifuge at 12000rpm for 1 min to elute the DNA and obtain genomic DNA.
[0027] Example 1: Determination of Specific Primers I. Experimental Materials The tested *Brassica rapa* populations were all collected from wheat fields or wastelands in Hebei Province. (1) Sensitive bromegranate population (S) was collected from Handan City, Hebei Province; (2) The resistant bromegranate population (R) was collected from Baoding City, Hebei Province.
[0028] Resistance levels to flusulfuron-methyl, sulfadiazine, and mesosulfuron-methyl were determined in a resistant bromegranate population (R) using a pot experiment. The results showed that this population exhibited high resistance to all three herbicides.
[0029] II. Extraction of Genomic DNA Using the DNAsecure novel plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd.), three individual plants were selected from each of the two bromeliad populations mentioned above, and their leaf DNA was extracted to obtain genomic DNA.
[0030] III. Primer Design Based on the Ala-205-Met mutant amino acid type in the ALS gene of resistant bromeliads that is related to resistance production, a pair of primers was designed for PCR amplification.
[0031] The primer sequences obtained from this design are as follows: Forward primer ALS-F: 5'-CGCCGACATCCTCGTCGAGGC-3'; Reverse primer ALS-R: 5'-ATGATGTCCTTAAAAGCACCAC-3'.
[0032] IV. Sequencing The ALS gene coding region was amplified to 1686 bp, followed by gel recovery, ligation, transformation, blue-white screening, and sequencing.
[0033] V. Compare gene sequences The obtained partial sequence of the ALS coding region of *Brassica rapa* was compared with the ALS gene sequence of *Arabidopsis thaliana*. Sequence analysis revealed: (1) The 205th amino acid of the ALS gene in the sensitive bromegranate population (S) is the same as that in Arabidopsis thaliana, which is Ala; (2) In the resistant bromegranate population (R), the amino acid at position 205 of the ALS gene was mutated from Ala to Met; Therefore, the amino acid sequence of the molecular marker was determined as shown in SEQ ID NO.1. SEQ ID NO.1: .
[0034] VI. Design of CAPS primers and dCAPS primers Based on the amino acid mutation at position 205 in the resistant bromegranate population, and using the corresponding amino acid sequence in the sensitive bromegranate population (S) as a control, dCAPS primers were designed using the online software dCAPS finder2.0, and the amplified fragment size was 179bp; CAPS primers were designed using Geneious software, and the amplified fragment size was 595bp.
[0035] The sequences of the final CAPS / dCAPS primers are shown in Table 3: Table 3 Primers for developing CAPS / dCAPS functional markers
[0036] in: SEQ ID NO.2 is TCATCACCAACCATCTCTTCC SEQ ID NO.3 is ATCAGAGTAGTTGTAACTGGAATC SEQ ID NO.4 is CCCCGCCGTATGATCGGCACGGATC SEQ ID NO.5 is TTGGGGATATCAACCAGCACCG SEQ ID NO.6 is CCCCGCCGTATGATCGGCACGGGCC SEQ ID NO.7 is TTGGGGATATCAACCAGCACCG SEQ ID NO.8 is CCCCGCCGTATGATCGGCACGATC SEQ ID NO.9 is TTGGGGATATCAACCAGCACCG VII. Amplification of the sequences of CAPS / dCAPS primers Using the four primer pairs in Table 3 as templates, the target DNA fragments of sensitive bromeliad (S) and resistant bromeliad (R) populations were amplified. The PCR reaction systems are shown in Table 4 below: Table 4 PCR reaction system
[0037] The PCR conditions used were: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 20 s, annealing at 63℃ for 20 s, extension at 72℃ for 15 s, for 34 cycles; and final extension at 72℃ for 10 min.
[0038] The results of the PCR amplification are as follows: (1) The PCR amplification products of the genomic DNA of three single sensitive bromegranate plants using specific primer pairs 1 were all: SEQ ID NO.10 TCATCACCAACCATCTCTTCCGCCACGAGCAGGGGGAGGCCTTCGCGGCGTCCGGATACGCCCGCGCGTCCGGCCGCGTCGGCGTCTGCGTCGCCACCTCCGGCCCGGGGGCCACCAACCTCGTCTCCGCGCTCGCCGACGCTCTGCTCGACTCCATCCCCATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATTGGTACCGACGCGTTCCAGGAGACGCCCATCGTGGAGGTCACCCGTTCCATCACCAAGCACAACTACCTGGTGCTTGATGTGGAGGACATCCCCCGCGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCGGGGCCGGTGCTGGTTGATATCCCCAAGGACATCCAACAGCAGATGGCTGTGCCTGCCTGGGACACGTCCATGAGTTTGCCAGGGTACATCGCCCGCCTGCCAAAGCCACCATCTACTGAATCGCTTGAGCAGGTCCTGCGCCTGGTTGGTGAGGCAAAGCGCCCAATTCTGTATGTTGGTGGTGGCTGTGCTGCATCTGGCGAGGAGTTGCGCCGCTTTGTTGAGCTTACTGGGATTCCAGTTACAACTACTCTGAT (2) The PCR amplification products of the genomic DNA of 3 single-resistant bromegrass plants amplified using specific primer pair 1 were all: SEQ ID NO.11 TCATCACCAACCATCTCTTCCGCCACGAGCAGGGGGAGGCCTTCGCGGCGTCCGGGTACGCCCGCGCGTCCGGGCGCGTCGGCGTCTGCGTCGCCACCTCCGGCCCGGGGGCCACCAACCTCGTCTCCGCGCTCGCCGACGCTCTGCT CGACTCCATCCCTATGGTTGCCATCACTGGCCAGGTCCCCCGCCGTATGATCGGCACGGACATGTTCCAGGAGACGCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCGTG TCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGCCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAAGGACATCCAGCAGCAGATGGCTGTGCCTGCCTGGGACACGCCTATGAGTTTGCCAGGGTACATTGCCCGCCTGCCCAAGCCA CCATCTACTGAATCGCTTGAGCAGGTCCTGCGTCTGGTTGGCGAGTCACGACGCCCAATTCTGTATGTTGGTGGTGGCTGCGCTGAATCAGGCGAGGAGTTGCGCCGCTTTGTTGAGCTCACTGGGATTCCAGTTACAACTACTCTGAT (3) The PCR amplification results of the three single sensitive bromegranate genomic DNA amplified using specific primer pairs were all: SEQ ID NO.12 CCCCGCCGTATGATCGGCACGGATCCGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA (4) The PCR amplification products of the genomic DNA of the three single resistant bromegranate plants using specific primer pairs were all: SEQ ID NO.13 CCCCGCCGTATGATCGGCACGGATCTGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA (5) The PCR amplification products of the genomic DNA of the three single sensitive bromegranate plants using specific primers were all: SEQ ID NO.14 CCCCGCCGTATGATCGGCACGGGCCCGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA (6) The PCR amplification products of the genomic DNA of the three single resistant bromegranate plants using specific primer pairs were all: SEQ ID NO.15 CCCCGCCGTATGATCGGCACGGGCCTGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA (7) The PCR amplification products of the genomic DNA of three single sensitive bromegranate plants using specific primer pairs were all: SEQ ID NO.16 CCCCGCCGTATGATCGGCACGATCGCGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA (8) The PCR amplification products of the genomic DNA of the three single resistant bromegranate plants using specific primer pairs were all: SEQ ID NO.17 CCCCGCCGTATGATCGGCACGATCATGTTCCAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA 8. Construct an enzyme digestion system and digest the PCR amplification products with restriction endonucleases to obtain the digested products; The enzyme digestion system and conditions are shown in Table 5 below: Table 5 Enzyme digestion system and conditions
[0039] The restriction endonuclease used for the PCR amplification product obtained using specific primer pair 1 was MluI; the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 2 was BamHI; the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 3 was ApaI; and the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 4 was PvuI.
[0040] 9. Electrophoresis: The enzyme digestion products were detected by 2% agarose gel electrophoresis at 140V for 40 minutes. The enzyme digestion pattern was detected by agarose gel electrophoresis, and the size and number of enzyme digestion bands were used to determine whether the material had mutated.
[0041] X. Results Analysis The amplification results of three individual plants from the resistant bromegranate population (R) and three individual plants from the sensitive bromegranate population (S) were obtained by analyzing the four pairs of specific primers designed by CAPS / dCAPS (Table 3).
[0042] The amplified sequences of three single plants from the sensitive *Brassica rapa* population (S) amplified using specific primer pair 1 are shown in SEQ ID NO. 10, while the amplified sequences of three single plants from the resistant *Brassica rapa* population (R) are shown in SEQ ID NO. 11. Sequence analysis revealed that the sensitive *Brassica rapa* SEQ ID NO. 10 sequence contained a unique restriction endonuclease MluI cleavage site, namely A↓CGCGT, while the resistant *Brassica rapa* SEQ ID NO. 11 sequence did not contain an MluI cleavage site. Therefore, the restriction band length of the resistant *Brassica rapa* was 595 bp. The sensitive *Brassica rapa* was detected with two or three bands, with lengths of 209 bp and 386 bp for two bands, and 595 bp, 209 bp, and 386 bp for three bands.
[0043] The amplified sequences of three single plants from the sensitive *Brassica rapa* population using specific primer pair 2 are shown in SEQ ID NO. 12, while the amplified sequences of three single plants from the resistant *Brassica rapa* population are shown in SEQ ID NO. 13. Sequence analysis revealed that the sensitive population's SEQ ID NO. 12 sequence contained a unique restriction endonuclease site, G↓GATCC, while the resistant population's SEQ ID NO. 13 sequence did not contain a BamHI restriction site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 179 bp. The sensitive *Brassica rapa* population showed one or two bands with lengths of 158 bp or 158 bp and 179 bp, respectively, while the 21 bp band of the restriction product was not visible and migrated outside the gel during electrophoresis.
[0044] The amplified sequences of three single plants from the sensitive *Brassica rapa* population using specific primer pair 3 are shown in SEQ ID NO. 14, while the amplified sequences of three single plants from the resistant *Brassica rapa* population are shown in SEQ ID NO. 15. Sequence analysis revealed that the sensitive population's SEQ ID NO. 14 sequence contained a unique restriction endonuclease site for ApaI, namely GGGCC↓C, while the resistant population's SEQ ID NO. 15 sequence did not contain an ApaI restriction site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 179 bp. The sensitive *Brassica rapa* population showed one or two bands with lengths of 154 bp or 154 bp and 179 bp, respectively, while the 25 bp band of the restriction product was not visible and migrated outside the gel during electrophoresis.
[0045] The amplified sequences of three single plants from the sensitive *Brassica rapa* population using specific primer pair 4 are shown in SEQ ID NO. 16, while the amplified sequences of three single plants from the resistant *Brassica rapa* population are shown in SEQ ID NO. 17. Sequence analysis revealed that the sensitive population's SEQ ID NO. 16 sequence contained a unique restriction endonuclease PvuI cleavage site, namely CGAT↓CG, while the resistant population's SEQ ID NO. 17 sequence did not contain a PvuI cleavage site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 179 bp. The sensitive *Brassica rapa* population showed one or two bands with lengths of 156 bp or 156 bp and 179 bp, respectively, while the 23 bp band of the restriction product was not visible and migrated outside the gel during electrophoresis.
[0046] Example 2: Application of specific primer pairs in the identification of the anti-ALS inhibitor herbicide brome. I. Experimental Materials The tested *Brassica rapa* populations were all collected from wheat fields or wastelands in Hebei Province. (1) The sensitive bromegranate population (S) was collected from Handan City, Hebei Province, and was the same as in Example 1; (2) The resistant bromegranate population (R) was collected from Baoding City, Hebei Province, and was the same as in Example 1.
[0047] Resistance levels to flusulfuron-methyl, sulfadiazine, and mesosulfuron-methyl were determined in a resistant bromegranate population (R) using a pot experiment. The results showed that this population exhibited high resistance to all three herbicides.
[0048] II. Specific application of specific primer pairs in the identification of the anti-ALS inhibitor herbicide brome The above-mentioned susceptible bromegrass population (S) and resistant bromegrass population (R) were identified for resistance to ALS inhibitor herbicides using the following steps: Step 1: Using the DNAsecure novel plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd.), 10 individual plants were selected from each of the two above-mentioned bromegranate populations, and leaf DNA was extracted to obtain genomic DNA; Step 2: Using the genomic DNA of the sample as a template, perform PCR amplification using the specific primer pairs 1-4 in Table 3 of Example 1 above to obtain PCR amplification products; The PCR amplification system was as follows: 5 µL of 2×Es Taq MasterMix, 1 µL of forward primer (10 µM), 1 µL of reverse primer (10 µM), 1 µL of DNA template, and ddH2O added to bring the total volume to 25 µL. The PCR amplification conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 20 s, 63℃ annealing for 20 s, 72℃ extension for 15 s, for 34 cycles; and a final extension at 72℃ for 10 min.
[0049] Step 3: Digest PCR amplification products 1-4 with restriction endonucleases to obtain the digested products; The enzyme digestion system and conditions are shown in Table 6 below: Table 6 Enzyme digestion system and conditions
[0050] The restriction endonuclease used for the PCR amplification product obtained using specific primer pair 1 was MluI; the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 2 was BamHI; the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 3 was ApaI; and the restriction endonuclease used for the PCR amplification product obtained using specific primer pair 4 was PvuI.
[0051] Results: Amplified sequences from 10 individual plants of the sensitive *Brassica rapa* population (S) using specific primer pair 1 were all found in SEQ ID NO. 10, while amplified sequences from 10 individual plants of the resistant *Brassica rapa* population (R) were all found in SEQ ID NO. 11. In the resistant population, GC at positions 210 and 211 was mutated to AT. Sequence analysis revealed that the sensitive population's SEQ ID NO. 10 sequence contained a unique restriction endonuclease MluI cleavage site, namely A↓CGCGT, while the resistant population's SEQ ID NO. 11 sequence did not contain a MluI cleavage site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 595 bp (e.g., ...). Figure 1 As shown); while sensitive bromegranate populations detected two or three bands, with lengths of 209bp and 386bp for two bands, and 209bp, 386bp, and 595bp for three bands (as shown). Figure 1 (As shown). The specific primer pair 1 corresponding to this molecular marker can accurately distinguish between 10 resistant and 10 sensitive single plants based on their restriction enzyme digestion patterns, with a molecular marker accuracy of 100%.
[0052] The amplified sequences of 10 individual plants from the sensitive bromegranate population (S) amplified using specific primer pair 2 are shown in SEQ ID NO.12 (6 individual plants) and SEQ ID NO.18 (4 individual plants), while the amplified sequences of 10 individual plants from the resistant bromegranate population (R) are shown in SEQ ID NO.13. In the resistant population, position 26 was mutated from C or G to T. Sequence analysis revealed that the sensitive population's SEQ ID NO.12 sequence contained a unique restriction endonuclease BamHI cleavage site, namely G↓GATCC, while the sensitive population's SEQ ID NO.18 and the resistant population's SEQ ID NO.13 sequences did not contain a BamHI cleavage site. Therefore, the restriction band length of the resistant bromegranate population was 179 bp. The sensitive bromegranate population was detected with one or two bands, 158 bp or 158 bp and 179 bp, respectively, while the 21 bp restriction product was not visible and migrated outside the gel during electrophoresis. The specific primer pair 2 corresponding to this molecular marker can accurately distinguish 10 resistant monoclonal antibodies and 6 sensitive monoclonal antibodies based on their restriction enzyme digestion patterns. However, the restriction enzyme digestion patterns of 4 sensitive monoclonal antibodies are consistent with those of the resistant monoclonal antibodies, resulting in false positives. The accuracy rate of the molecular marker is only 80%.
[0053] SEQ ID NO.18: CCCCGCCGTATGATCGGCACGGATCGGATCGAGGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA The amplified sequences obtained from 10 individual plants of the sensitive *Brassica rapa* population using specific primer pair 3 are shown in SEQ ID NO. 14 (5 individual plants) and SEQ ID NO. 19 (5 individual plants), while the amplified sequences from 10 individual plants of the resistant *Brassica rapa* population are shown in SEQ ID NO. 15. In the resistant population, position 26 was mutated from C or G to T. Sequence analysis revealed that the sensitive population's SEQ ID NO. 14 sequence contained a unique restriction endonuclease ApaI cleavage site, namely GGGCC↓C, while the sensitive population's SEQ ID NO. 19 sequence and the resistant population's SEQ ID NO. 15 sequence did not contain an ApaI cleavage site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 179 bp. The sensitive *Brassica rapa* population was detected with one or two bands, with lengths of 154 bp or 154 bp and 179 bp, respectively, while the 25 bp restriction product was not visible and migrated outside the gel during electrophoresis. The specific primer pair 3 corresponding to this molecular marker can accurately distinguish between 10 resistant and 5 sensitive plants based on their restriction enzyme digestion patterns. However, the restriction enzyme digestion patterns of 5 sensitive plants are identical to those of the resistant plants, resulting in false positives. The accuracy rate of the molecular marker is only 75%.
[0054] SEQ ID NO.19: CCCCGCCGTATGATCGGCACGGGCCGGATCGAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA The amplified sequences obtained from 10 individual plants of the sensitive *Brassica rapa* population using specific primer pair 4 are shown in SEQ ID NO.16 (7 individual plants) and SEQ ID NO.20 (3 individual plants), while the amplified sequences from 10 individual plants of the resistant *Brassica rapa* population are shown in SEQ ID NO.17. In the resistant population, the 25th and 26th bases were mutated from GC or CG to AT. Sequence analysis revealed that the sensitive population's SEQ ID NO.16 sequence contained a unique restriction endonuclease PvuI cleavage site, namely CGAT↓CG, while the sensitive population's SEQ ID NO.20 sequence and the resistant population's SEQ ID NO.17 sequence did not contain a PvuI cleavage site. Therefore, the restriction band length of the resistant *Brassica rapa* population was 179 bp, while the sensitive *Brassica rapa* population showed one or two bands with lengths of 156 bp or 156 bp and 179 bp, respectively, and the 23 bp restriction product was not visible and migrated outside the gel during electrophoresis. The specific primer pair 4 corresponding to this molecular marker can accurately distinguish 10 resistant monoclonal antibodies and 7 sensitive monoclonal antibodies based on their restriction enzyme digestion patterns. However, the restriction enzyme digestion patterns of 3 sensitive monoclonal antibodies are consistent with those of the resistant monoclonal antibodies, resulting in false positives. The accuracy rate of the molecular marker is only 85%.
[0055] SEQ ID NO.20: CCCCGCCGTATGATCGGCACGATCCGGATCGAGGAGACGCCCATCGTGGAGGTCACTCGCTCCATCACCAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGTGTCATTCAGGAAGCCTTCTTCCTCGCGTCCTCTGGCCGCCCTGGGCCGGTGCTGGTTGATATCCCCAA Step 4: The enzyme digestion products were subjected to 2% agarose gel electrophoresis at 140V for 40 minutes. The enzyme digestion pattern was detected by agarose gel electrophoresis. The size and number of enzyme digestion bands were used to determine whether mutations had occurred in the test material. The test results are as follows: In summary, the restriction enzyme digestion band length of the molecular marker developed using specific primer pair 1 in the resistant bromegranate population was 595 bp; while the sensitive bromegranate population showed two or three bands with lengths of 209 bp and 386 bp or 209 bp, 386 bp and 595 bp, respectively. This molecular marker accurately distinguished 10 resistant and 10 sensitive plants based on their restriction enzyme digestion patterns, achieving a 100% accuracy rate.
[0056] The molecular marker developed using specific primer pair 2 produced an enzyme digestion band of 179 bp in the resistant bromeliad population; while the sensitive bromeliad population showed one or two bands with lengths of 158 bp or 158 bp and 179 bp, respectively. This molecular marker could accurately distinguish 10 resistant plants from 6 sensitive plants based on their enzyme digestion patterns, but 4 sensitive plants had enzyme digestion patterns identical to those of the resistant plants, indicating false positives. The accuracy rate of the molecular marker was only 80%.
[0057] The restriction enzyme digestion band length of the molecular marker developed using specific primer pair 3 in the resistant bromegranate population was 179 bp; while the sensitive bromegranate population showed one or two bands with lengths of 154 bp or 154 bp and 179 bp, respectively. This molecular marker could accurately distinguish between 10 resistant plants and 5 sensitive plants based on their restriction enzyme digestion patterns, but the restriction enzyme digestion patterns of 5 sensitive plants were identical to those of the resistant plants, indicating false positives. The accuracy rate of the molecular marker was only 75%.
[0058] The restriction enzyme digestion band length of the molecular marker developed using specific primer pair 4 in the resistant bromegranate population was 179 bp; while the sensitive bromegranate population showed one or two bands with lengths of 156 bp or 156 bp and 179 bp, respectively. This molecular marker could accurately distinguish 10 resistant plants and 7 sensitive plants based on their restriction enzyme digestion patterns, but 3 sensitive plants had the same restriction enzyme digestion patterns as the resistant plants, indicating false positives. The accuracy rate of the molecular marker was only 85%.
[0059] Therefore, the molecular marker developed with specific primer pair 1 can detect resistant bromeliad populations with ALS Ala-205-Met mutation with 100% accuracy, while the accuracy of the other three developed molecular markers is between 75% and 85%, with a high false positive rate.
[0060] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A molecular marker for detecting the anti-ALS inhibitor herbicide brome, characterized in that, The amino acid sequence of the molecular marker is shown in SEQ ID NO.
1. The mutated amino acid sequence of the anti-ALS inhibitor herbicide brome corresponds to the mutation of Ala to Met at position 205 of the amino acid sequence of wild-type brome.
2. The specific primer pair for detecting molecular markers of the anti-ALS inhibitor herbicide brome as described in claim 1, characterized in that, The specific primer pair is used to amplify the molecular marker, and the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. The use of the specific primer pair as described in claim 2 in the preparation of a product for detecting the anti-ALS inhibitor herbicide brome.
4. The application according to claim 3, characterized in that, The product in question is a reagent kit.
5. A method for detecting the ALS inhibitor herbicide brome, characterized in that, Includes the following steps: S1. DNA extraction: Extract genomic DNA from the test sample, *Brassica rapa*. S2. PCR amplification: Using the genomic DNA of the test substance, *Brassica rapa*, as a template, a PCR reaction system is constructed, and PCR amplification is performed using the specific primer pair described in claim 2 to obtain the PCR amplification product. S3. Enzyme digestion: Construct an enzyme digestion system and use restriction endonucleases to digest the PCR amplification products to obtain the digested products; S4. Electrophoresis: The enzyme digestion products are detected by gel electrophoresis, and the results are used for identification. When the enzyme digestion product is positive, that is, an enzyme digestion product with a band length of 595bp is obtained, the brome is an anti-ALS inhibitor herbicide brome. Conversely, when the enzyme digestion product is negative, an enzyme digestion product with two bands of 209bp and 386bp or three bands of 595bp, 209bp and 386bp is obtained, the brome is a wild-type brome.
6. The method for detecting the ALS inhibitor herbicide bromelain according to claim 5, characterized in that, In step S2, the PCR reaction system is as follows: 5µL of 2×Es Taq MasterMix, 1µL of forward primer, 1µL of reverse primer, 1µL of DNA template, and ddH2O added to bring the total volume to 25µL.
7. The method for detecting the ALS inhibitor herbicide bromelain according to claim 5, characterized in that, In step S2, the PCR amplification reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 20 s, 63℃ annealing for 20 s, 72℃ extension for 15 s, 34 cycles; and finally 72℃ extension for 10 min.
8. The method for detecting the ALS inhibitor herbicide bromelain according to claim 5, characterized in that, In step S3, the enzyme digestion system is as follows: 0.5 µL of restriction endonuclease, 5 µL of PCR amplification product, 2 µL of rCutSmart buffer, and ddH2O added to bring the total to 20 µL.
9. The method for detecting the ALS inhibitor herbicide bromelain according to claim 8, characterized in that, In step S3, the restriction endonuclease includes MluI.
10. The method for detecting the anti-ALS inhibitor herbicide brome as described in claim 5, wherein in step S3, the enzyme digestion temperature is 37°C and the enzyme digestion time is 40 min.
Citation Information
Patent Citations
Wheat ALS mutant gene as well as protein and application thereof
CN106434714A
Wheat ALS (anti-lymphocyte serum) mutant type protein endowing plants with herbicide resistance as well as gene and application thereof
CN107022540A
Detection method and reagent kit of ALS inhibitor-resistant herbicide Meloidium mongolicum
CN109750119A
Specific primer pair for detecting anti-ALS inhibitor herbicide brome, kit and detection method and application
CN113943829A
Applications of ALS mutant type gene in resisting against herbicides
WO2017177765A1