Molecular marker primer group, kit and method for identifying rubber tree triploid variety Yunnan research 77-4 and application

By designing specific molecular marker primer sets and using second-generation high-throughput sequencing technology, the accuracy problem of identifying the triploid rubber tree variety Yunyan 77-4 in existing technologies has been solved, achieving efficient and accurate variety identification.

CN121518702AActive Publication Date: 2026-02-13YUNNAN INST OF TROPICAL CROPS
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610051651.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-15
Publication Date
2026-02-13
Estimated Expiration
2046-01-15

AI Technical Summary

Technical Problem

Existing technologies are insufficient to accurately identify the triploid rubber tree variety Yunyan 77-4. SSR markers suffer from slippage genotype issues, while SNP markers have high throughput but low polymorphism at individual loci, making it difficult to distinguish polyploids.

Method used

Amplification was performed using two pairs of specifically designed molecular marker primers. Combined with next-generation high-throughput sequencing and reference genome alignment, the differences in the base sequence of the amplified products were analyzed, and accurate identification was achieved using MNP markers.

Benefits of technology

It has achieved accurate identification of the triploid rubber tree variety Yunyan 77-4. The results are not affected by environmental and human factors, the identification cycle is short, the accuracy is high, and the reproducibility is good.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518702A_ABST
    Figure CN121518702A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker primer group, a kit, a method and application for identifying a rubber tree triploid variety Yunnan research 77-4, and belongs to the field of molecular biology and genetic breeding. The molecular marker primer group is composed of two pairs of primers, each pair of primers is composed of an upstream primer and a downstream primer, the upstream primer of the first pair of primers is as shown in SEQ ID NO: 1 in a sequence table, the downstream primer of the first pair of primers is as shown in SEQ ID NO: 2 in the sequence table, the upstream primer of the second pair of primers is as shown in SEQ ID NO: 3 in the sequence table, and the downstream primer of the second pair of primers is as shown in SEQ ID NO: 4 in the sequence table. The downstream primer of the second pair of primers is shown as SEQ ID NO: 4 in the sequence table. According to the present invention, the MNP labeled primer group is used to amplify the to-be-detected sample, the obtained amplification product is sequenced, whether the to-be-detected variety is Yunnan research 77-4 is identified according to the sequencing result, and the identification is accurate.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of molecular biology and genetic breeding, in particular to a molecular marker primer set for identifying a triploid variety of rubber tree Yunnan 77-4, a kit, a method and application thereof. BACKGROUND

[0002] Rubber tree (Hevea brasiliensis) is a perennial tropical crop, which is traditionally considered to be planted no more than 17 degrees north latitude and is only suitable for low-latitude areas. China successfully commercialized the planting of rubber trees to about 25 degrees north latitude, becoming the northern limit of rubber planting in the world, which puts higher requirements on the stress resistance of varieties. Polyploid plants usually have stronger ecological adaptability than their diploid (2n) parents, especially in stress environments such as cold resistance. Yunnan 77-4 is a triploid (3n) cold-resistant high-yield variety developed by the Yunnan Institute of Tropical Crops, and is also the main variety planted in Yunnan rubber-growing areas. Its resistance and yield are better than those of conventional diploid varieties, and its promotion and planting in China are of great significance.

[0003] Accurate identification of varieties is the basis of breeding and production application. Although the currently used SSR molecular marker is relatively stable, DNA polymerase has a sliding phenomenon when amplifying the SSR site. Especially when amplifying long SSR sequences with high polymorphism, it is easy to produce false sliding genotypes. The sliding genotypes cannot be distinguished from the main genotypes in the sample, which makes it difficult to use SSR marker method for identification of polyploid plants. The SSR marker technology can only detect the length of the amplification product, and can identify the length difference of different amplification fragments, but cannot detect the specific base sequence of the amplification product, and cannot identify the base variation on different amplification products. Moreover, 6% of the SSR sites have no length difference, but have base variation. SNP marker has high throughput, but the polymorphism of a single site is low, which makes it difficult to distinguish polyploidy.

[0004] Therefore, an accurate identification method is urgently needed for important polyploid varieties such as Yunnan 77-4.

[0005] DISCLOSURE

[0006] In order to solve the problem of being unable to accurately identify the triploid variety Yunnan 77-4, the present disclosure provides a molecular marker primer set, a kit, a method and application for identifying Yunnan 77-4. The technical solution is as follows:

[0007] In one aspect, the present disclosure provides a molecular marker primer set for identifying Hevea brasiliensis triploid variety Yunyan 77-4, which consists of two pairs of primers, each pair consisting of an upstream primer and a downstream primer, the upstream primer of the first pair being as shown in SEQ ID NO: 1 in the sequence listing, the downstream primer of the first pair being as shown in SEQ ID NO: 2 in the sequence listing, the upstream primer of the second pair being as shown in SEQ ID NO: 3 in the sequence listing, and the downstream primer of the second pair being as shown in SEQ ID NO: 4 in the sequence listing.

[0008] In another aspect, the present disclosure provides a kit for identifying Hevea brasiliensis triploid variety Yunyan 77-4, which comprises the above-mentioned molecular marker primer set.

[0009] In yet another aspect, the present disclosure provides a method for identifying Hevea brasiliensis triploid variety Yunyan 77-4, which comprises: amplifying a to-be-tested sample using the above-mentioned molecular marker primer set to obtain an amplification product;

[0010] sequencing the amplification product by next-generation high-throughput sequencing to obtain sequencing data;

[0011] aligning the sequencing data to a Hevea brasiliensis reference genome to obtain a sequencing result of the to-be-tested sample;

[0012] analyzing the sequencing result to obtain different sequence types;

[0013] when the first pair of primers is used for amplification, the sequence types obtained are a combination of SEQ ID NO: 6 in the sequence listing, SEQ ID NO: 7 in the sequence listing, and SEQ ID NO: 8 in the sequence listing, and when the second pair of primers is used for amplification, the sequence types obtained are a combination of SEQ ID NO: 14 in the sequence listing, SEQ ID NO: 15 in the sequence listing, and SEQ ID NO: 17 in the sequence listing, then the to-be-tested sample is identified as Hevea brasiliensis Yunyan 77-4.

[0014] Specifically, the Hevea brasiliensis reference genome is PRJNA587314.

[0015] In still another aspect, the present disclosure provides an application of the above-mentioned molecular marker primer set, which comprises using the molecular marker primer set to distinguish between Hevea brasiliensis varieties: Yunyan 77-4, GT1, PR107, Reken 628, Reyan 106, PR228, Reken 501, Yunyan 98296, Yunyan 99229, and RRIM501.

[0016] In another aspect, the present disclosure provides an application of the above-mentioned molecular marker primer set, which comprises using the molecular marker primer set for parent identification of the rubber tree triploid variety Yunyan 77-4.

[0017] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that the embodiments of the present disclosure provide a molecular marker primer set, a kit, a method and an application for identifying the rubber tree triploid variety Yunyan 77-4. The MNP (Multiple Nucleotide Polymorphism) marker primer set is used to amplify the to-be-tested sample, the obtained amplification product is sequenced, the differences of different base sequences are analyzed according to the sequencing results, and it is determined whether the to-be-tested variety is Yunyan 77-4. The identification result is not affected by the environment and other human factors, so that the accurate identification of Yunyan 77-4 is realized. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical schemes in the embodiments of the present disclosure, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can be obtained by those skilled in the art without creative labor.

[0019] Figure 1 is a comparison diagram of the a1 sequence provided in the third embodiment of the present disclosure and the b1-h1 sequence amplified by the first pair of primers;

[0020] Figure 2 is a comparison diagram of the a2 sequence provided in the third embodiment of the present disclosure and the b2-e2 sequence amplified by the second pair of primers. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical scheme and advantages of the present disclosure clearer, the embodiments of the present disclosure will be further described in detail below with reference to the drawings.

[0022] Embodiment one

[0023] The embodiment of the present disclosure provides a molecular marker primer set for identifying Hevea brasiliensis triploid variety Yunyan 77-4, the molecular marker primer set is composed of two pairs of primers, each pair of primers is composed of an upstream primer and a downstream primer, the upstream primer of the first pair of primers is as shown in SEQ ID NO:1 in the sequence listing, specifically AAGATTAGCCCCAAAAGTTGCTAAC, the downstream primer of the first pair of primers is as shown in SEQ ID NO:2 in the sequence listing, specifically AATCTGTCGGGTTTAGTGGAGGTAT, the upstream primer of the second pair of primers is as shown in SEQ ID NO:3 in the sequence listing, specifically ACTGAGATGCATTGCACAATCAATA, and the downstream primer of the second pair of primers is as shown in SEQ ID NO:4 in the sequence listing, specifically TGGAAGCTCCGTTTATAGAAGCTTA. The related information of the two pairs of primers is shown in Table 1.

[0024] Table 1 is related information of the two pairs of primers

[0025]

[0026] Embodiment two

[0027] The embodiment of the present disclosure provides a kit for identifying Hevea brasiliensis triploid variety Yunyan 77-4, the kit comprising the molecular marker primer set provided in the embodiment one.

[0028] Embodiment three

[0029] The embodiment of the present disclosure provides a method for identifying Hevea brasiliensis triploid variety Yunyan 77-4, the method comprising: using the molecular marker primer provided in the embodiment one to identify Yunyan 77-4.

[0030] In the embodiment, 17 Hevea brasiliensis varieties are used as test samples, and the specific variety names are shown in Table 2.

[0031] Table 2 is the variety name of the 17 test samples

[0032]

[0033] DNA of the 17 test samples is extracted. In the implementation, a new plant genomic DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. is used to extract DNA of the test samples, and DNA fragments of the test samples are obtained. The specific operation is performed according to the instruction manual of the new plant genomic DNA extraction kit.

[0034] Seventeen test samples were amplified using the labeled primers provided in Example 1 of this invention to obtain amplification products. Specifically, the amplification system included: 50 ng of DNA fragment from the test sample, 0.5 μL of 10 mM dNTP (Deoxyribonucleoside triphosphate), 0.5 μL of upstream primer, 0.5 μL of downstream primer, 2.5 μL of Tap Buffer, 0.2 μL of Taq enzyme, and ddH2O was added to bring the amplification system to 20 μL. The amplification program included: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) × 30 cycles; 72℃ for 6 min. The amplification products were subjected to next-generation high-throughput sequencing, and the sequencing data were aligned to the rubber tree reference genome PRJNA587314 using Bowtie2 software to obtain the sequencing results for each test sample.

[0035] Based on the upstream and downstream primer sequences of the first primer pair, e-PCR was performed on the reference genome using TBtools software to obtain the chromosomal location, start point, and end point of the target sequence. The target sequence of the first primer pair on the reference genome was then extracted using TBtools software and named a1 (reference genome sequence).

[0036] Using Microsoft Office Excel, the sequencing results of 17 samples from the first primer pair were analyzed, revealing seven different sequence types. These seven sequence types were named b1, c1, d1, e1, f1, g1, and h1, as shown in Table 3.

[0037] Table 3 shows the reference genome sequence a1 and the different sequences obtained by amplification with the first pair of primers.

[0038]

[0039]

[0040] The sequence types in Table 3 were compared using the software DANMAN. The comparison results are as follows: Figure 1 As shown. By Figure 1 It can be seen that there are 7 base positions that differ.

[0041] Using TBtools software, the second pair of primers was used for e-PCR on the reference genome to obtain the chromosomal location, start point, and end point of the target sequence. The corresponding base sequence was then extracted using this software and named a2 (reference genome sequence).

[0042] The sequencing results of the 17 test samples using the second pair of primers were analyzed using Microsoft Office Excel software, and four different sequence types were obtained. The four different sequence types were named b2, c2, d2 and e2, as shown in Table 4.

[0043] Table 4 shows the different sequences obtained after amplification of the 17 test samples using the second pair of primers and the reference genome sequence a2.

[0044]

[0045] The sequence types in Table 4 were aligned using the software DANMAN, and the alignment results are shown in Table 5. Figure 2 As can be seen from Table 5, the sequence b2 is consistent with the reference genome a2, and there are five differences in base positions. Figure 2

[0046] Table 5 shows the genotypes obtained after amplification of the 17 test samples using the two pairs of primers.

[0047]

[0048] The genotype " / " of Rexin 106 in Table 5 indicates that no sequence was amplified, i.e., the target site of the first pair of primers on the Rexin 106 genome was not amplified, and the sequence at this site is different from that of other varieties, which is also a polymorphism. When the first pair of primers is used for amplification, the sequence types obtained are the combination of SEQ ID NO: 6 shown in the sequence listing, SEQ ID NO: 7 shown in the sequence listing, and SEQ ID NO: 8 shown in the sequence listing. When the second pair of primers is used for amplification, the sequence types obtained are the combination of SEQ ID NO: 14 shown in the sequence listing, SEQ ID NO: 15 shown in the sequence listing, and SEQ ID NO: 17 shown in the sequence listing. Therefore, the test sample is identified as Hevea brasiliensis Yunyan 77-4. This method can accurately identify the triploid variety Yunyan 77-4 of Hevea brasiliensis.

[0049] Example Four

[0050] The genotype combinations obtained after amplification of the 17 test samples using the two pairs of primers were analyzed, and it was found that there were three repeated genotype combinations: g1 + c2d2 for Zantai 32713, Dongfang 7747 and Yunyan 41; h1 + b2d2 for IAN873 and Yunyan 590; and f1 + c2 for PR300 and IRCI22. In addition, the 10 varieties have unique genotype combinations, i.e., the MNP marker primer set of the present disclosure can identify the triploid variety Yunyan 77-4, and can also distinguish GT1, PR107, Reken 628, Rexin 106, PR228, Reken 501, Yunyan 98296, Yunyan 99229 and RRIM501. The specific information is shown in Table 6.​

[0051] Table 6 Genotype combinations obtained after amplification of 26 samples using two primer pairs.

[0052]

[0053] Example 5

[0054] This disclosure provides an application of molecular marker primers for identifying the triploid rubber tree variety Yunyan 77-4. This application includes using the molecular marker primer set for parental identification of the triploid rubber tree variety Yunyan 77-4. Specifically, referring to Table 5, the genotype of the first primer pair for Yunyan 77-4 is b1c1d1 (triploid variety). Theoretically, its nuclear chromosome 2n has three possible genotypes: b1c1, c1d1, and b1d1. From the 17 samples provided in this embodiment, only the GT1 variety has b1c1; c1d1 and b1d1 are not found. Additionally, only the PR107 genotype contains d1. Therefore, the parents of Yunyan 77-4 are GT1 and PR107, and 2n originates from GT1.

[0055] Analyzing the genotypes of the second primer pair in Table 5, the genotype of the second primer pair for Yunyan 77-4 is b2c2e2 (triploid variety). Theoretically, its nuclear chromosome 2n has three possible genotypes: b2c2, c2e2, and b2e2. Searching through the 17 samples provided in this example, only variety GT1 has b2c2; c2e2 and b2e2 are not found. Furthermore, only PR107 has the genotype e2. This also proves that the parents of Yunyan 77-4 are GT1 and PR107, and that 2n originates from GT1.

[0056] Using the primer set provided in Example 1, it is possible to effectively identify that the nuclear chromosome of the triploid rubber tree variety Yunyan 77-4 originates from GT1 and PR107, and confirm that the 2n chromosome of the triploid variety Yunyan 77-4 originates from GT1, and can definitively rule out the possibility that other test samples are its parents.

[0057] Accuracy analysis of molecular marker primer set identification

[0058] Accuracy analysis was performed using two reproducibility experiments. In this embodiment, two independent experiments were conducted using different personnel, different batches of reagents, and different laboratories to simulate the identification of different batches. A high reproducibility rate means that the identification results from different laboratories can be accurately compared with each other.

[0059] A reproducibility experiment was conducted using 17 samples to be tested. The results of each experiment were analyzed, and the genotypes and combinations were recorded. See Table 7 for details.

[0060] Table 7 shows the results of the two repeated experiments.

[0061]

[0062] As shown in Table 7, the genotypes and combinations were identical in both replicate experiments. Therefore, the accuracy of the molecular marker primer set identification provided in the embodiments of this disclosure is 100%.

[0063] The identification conclusions of this invention, obtained by different personnel, batches, and laboratories, show high consistency, thus eliminating the need for parallel experiments to reduce experimental errors. This greatly facilitates the identification of triploid rubber tree varieties.

[0064] This invention provides a molecular marker primer set, kit, method, and application for identifying the triploid rubber tree variety Yunyan 77-4. The identification results are unaffected by environmental or other human factors, with a short identification cycle and high accuracy. The molecular marker primer set is used to amplify the test sample, and the amplified products are sequenced. Analysis of the sequencing results reveals multiple base differences between different varieties, enabling accurate identification of the triploid rubber tree variety Yunyan 77-4. The target sequence is amplified using a highly polymorphic molecular marker primer set, and the base differences between different varieties are compared to achieve the identification of the triploid rubber tree variety Yunyan 77-4. Reproducibility experiments further verify the accuracy and reliability of this technology.

[0065] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A molecular marker primer set for identifying the triploid rubber tree variety Yunyan 77-4, characterized in that, The molecular marker primer set consists of two pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is shown in SEQ ID NO:1 in the sequence listing, and the downstream primer of the first pair of primers is shown in SEQ ID NO:2 in the sequence listing. The upstream primer of the second pair of primers is shown in SEQ ID NO:3 in the sequence listing, and the downstream primer of the second pair of primers is shown in SEQ ID NO:4 in the sequence listing.

2. A reagent kit for identifying the triploid rubber tree variety Yunyan 77-4, characterized in that, The kit includes the molecular marker primer set as described in claim 1.

3. A method for identifying the triploid rubber tree variety Yunyan 77-4, characterized in that, The method includes: amplifying the sample to be tested using the molecular marker primer set as described in claim 1 to obtain amplification products; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data is aligned to the rubber tree reference genome to obtain the sequencing results of the sample to be tested; The sequencing results were analyzed to obtain different sequence types; When the first pair of primers is used for amplification, and the sequence type obtained is a combination of SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 in the sequence listing, and when the second pair of primers is used for amplification, and the sequence type obtained is a combination of SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17 in the sequence listing, then the sample to be tested is identified as Yunyan 77-4.

4. The method according to claim 3, characterized in that, The reference genome for the rubber tree is PRJNA587314.

5. An application of the molecular marker primer set as described in claim 1, characterized in that, The application includes using the molecular marker primer set to distinguish rubber tree varieties: Yunyan 77-4, GT1, PR107, Reken 628, Reken 106, PR228, Reken 501, Yunyan 98296, Yunyan 99229 and RRIM501.

6. An application of the molecular marker primer set as described in claim 1, characterized in that, The application includes using the molecular marker primer set for parent identification of the triploid rubber tree variety Yunyan 77-4.

Citation Information

Patent Citations

  • MNP molecular marker combination and method for constructing rubber tree DNA fingerprint spectrum

    CN118064428A

  • Molecular marker, primer and kit for identifying rubber tree variety Yunnan research 614 and application

    CN119082364A

  • Molecular marker, primer and kit for identifying rubber tree variety Yunnan research 272 and application

    CN121183016A