Method for detecting salmonella in pasteurized milk

By combining platinum-based polymer nanozyme composite probes with immunomagnetic beads, the problems of long detection time and low sensitivity in pasteurized milk Salmonella detection have been solved, achieving rapid detection with high sensitivity, which is suitable for online monitoring of dairy product production processes and market sampling inspections.

CN121522155APending Publication Date: 2026-02-13JIANGHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511945021.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Traditional methods for detecting Salmonella in pasteurized milk are time-consuming and not suitable for on-site testing. Furthermore, existing materials exhibit poor stability in complex matrices, making it difficult to meet the requirements for low-concentration detection.

Method used

By combining a platinum-based polymer nanozyme composite probe with immunomagnetic beads and amplifying the signal through a chromogenic solution, multi-site recognition and high-sensitivity detection of Salmonella can be achieved, simplifying it into a one-step rapid detection method.

Benefits of technology

It enables the detection of Salmonella in pasteurized milk as low as 10 CFU/mL, significantly improving sensitivity, simplifying operation procedures, reducing false positive results, and is suitable for online monitoring and market sampling.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121522155A_ABST
    Figure CN121522155A_ABST
Patent Text Reader

Abstract

The invention discloses a method for detecting salmonella in pasteurized milk, relates to the technical field of food detection, and provides a one-step rapid high-sensitivity detection method suitable for salmonella in pasteurized milk by constructing a platinum-based polymer nano-enzyme composite probe and combining immunomagnetic bead separation and signal amplification strategies. Based on the excellent peroxidase-like activity of the platinum-based polymer nano-enzyme, the composite probe can catalyze a chromogenic substrate to generate a strong signal amplification effect in the presence of low-concentration target bacteria, so that the detection limit of salmonella in a pasteurized milk matrix as low as 10 CFU / mL is realized; compared with a traditional culture method and part of existing immunological methods, the sensitivity is improved by one to two orders of magnitude, and the detection capacity of low-pollution-level salmonella is remarkably enhanced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of food detection, and particularly relates to a detection method of salmonella in pasteurized milk. BACKGROUND

[0002] Salmonella is one of the most common foodborne pathogens. Globally, salmonella causes 930 million cases of foodborne illness and 155,000 deaths each year. Traditional salmonella detection culture method requires time-consuming enrichment steps and selective plate culture and biochemical identification. These techniques are not suitable for on-site detection of pasteurized milk, which has a short shelf life and may have a high risk of contamination. In recent years, materials with Raman, colorimetric and fluorescent functions have been used to construct infectious devices for foodborne pathogens such as E. coli, salmonella and staphylococcus aureus. Such sensors convert the concentration of the target into the concentration of the functional material, and then, with the help of a portable instrument, the colorimetric, Raman, fluorescent and other signals of the material are read to realize the detection of the target pathogen. This detection method greatly shortens the detection time. However, due to the poor stability of these materials in complex substrates such as milk, it is often necessary to dilute or centrifuge the milk before detecting the target pathogen. In addition, relying only on the signal generated by these materials themselves makes it difficult to meet the signal conversion of low-concentration pathogens, thus limiting their application in actual samples. SUMMARY

[0003] In view of the above problems of the prior art, the present application provides a detection method of salmonella in pasteurized milk.

[0004] To achieve the above-mentioned application purposes, the technical scheme adopted by the present application is as follows: The present application provides a detection method of salmonella in pasteurized milk, which comprises the following steps: S1: using ultra-sensitive color developing solution to develop pasteurized milk with different concentrations of salmonella, and establishing a standard curve of the relationship between 420nm absorbance and salmonella concentration; S2: taking the composite probe for detecting salmonella and the immunomagnetic beads prepared based on platinum nanoparticles and adding them into the pasteurized milk to be detected, and incubating them on a shaker at room temperature; S3: after magnetic separation, the precipitate is washed with 1xPBS, and after washing, the supernatant is removed by centrifugation, the ultra-sensitive color developing solution is added, mixed and developed for 5min, then the color development is terminated by adding 2M sulfuric acid solution, the absorbance at 420nm is read, and the concentration of salmonella in the pasteurized milk to be detected is obtained according to the standard curve.

[0005] Using composite probes as signal transduction materials for Salmonella not only enables multi-site recognition of Salmonella and improves the affinity between the probe and Salmonella, but also allows each composite probe to catalyze the generation of a large amount of blue oxidized TMB in the chromogenic solution without any complex amplification steps. This not only greatly improves the detection sensitivity and reduces the detection time, but also makes the detection results visible to the naked eye.

[0006] Furthermore, the preparation method of the ultrasensitive colorimetric solution is as follows: A1: Add hydrogen peroxide to citrate buffer solution with a pH of 5 to make the hydrogen peroxide concentration in the final solution 1mM, thus obtaining solution A; A2: Add 3,3',5,5'-tetramethylbenzidine to disodium citric acid-ethylenediaminetetraacetate at pH 2.8 to make the concentration of 3,3',5,5'-tetramethylbenzidine in the final solution 1.34 mM, thus obtaining solution B; A3: Mix equal volumes of solution A and solution B thoroughly to obtain the ultrasensitive colorimetric solution.

[0007] Furthermore, the ratio of the composite probe, immunomagnetic beads, pasteurized milk to be tested, ultrasensitive colorimetric solution, and sulfuric acid solution is 200μg:30μg:25mL:100μL:50μL.

[0008] Furthermore, the composite probe used to detect Salmonella in pasteurized milk was prepared using the following steps: B1: Mix platinum-based polymer nanozyme with any aptamer a that specifically recognizes Salmonella, incubate at 37°C for 2 hours, add DNA-a with a random sequence of 30-60 bp after incubation, incubate for 2 hours, and then centrifuge and wash to obtain probe A. B2: Mix platinum-based polymer nanozyme with any Salmonella-specific aptamer b that is different from aptamer a, and incubate at 37°C for 2 hours. After incubation, add DNA-b that is 30-60 bp long and whose sequence is complementary to DNA-a. After incubation for 2 hours, centrifuge and wash to obtain probe B. B3: Mix equal volumes of probe A and probe B and incubate at 37°C for 2 hours to obtain a composite probe for detecting Salmonella in pasteurized milk. Freeze-dry the composite probe under vacuum and store it.

[0009] Furthermore, aptamer a, aptamer b, DNA-a, and DNA-b were all modified with thiol groups and dissolved in 1×PBS; When preparing probe A, 5 mg of platinum-based polymer nanozyme, 500 μL of aptamer a at a concentration of 10 μM and 500 μL of DNA-a at a concentration of 1 μM were used. When preparing probe B, 5 mg of platinum-based polymer nanozyme, 500 μL of aptamer b at a concentration of 100 μM and 500 μL of DNA-b at a concentration of 1 μM were used.

[0010] Furthermore, before using aptamers a, b, DNA-a, and DNA-b to prepare probe A or probe B, aptamers a, b, DNA-a, and DNA-b were dissolved in 1×PBS, and 10 μL of tris(2-carbonylethyl) phosphate hydrochloride was added to each of them, and they were incubated at 37°C for 1 h; tris(2-carbonylethyl) phosphate hydrochloride was dissolved in 1×PBS to a concentration of 10 mM.

[0011] Furthermore, the platinum-based polymer nanozyme was prepared using the following method: C1: Styrene, acrylic acid and ultrapure water were deoxygenated, mixed and stirred vigorously and heated to 70°C, then potassium persulfate was added, and the mixture was stirred and reacted at 70°C for 7 hours. After the reaction was completed, the mixture was naturally cooled to room temperature and then transferred to a 14000KD dialysis bag for dialysis for 7 days. The dialysis product was collected and freeze-dried under vacuum to obtain the carboxyl polymer. C2: After stirring and heating the carboxyl polymer and chloroplatinic acid to 90°C, ascorbic acid was added, and the reaction was continued for 4 hours. After the reaction was completed, the mixture was naturally cooled to room temperature, the precipitate was collected by centrifugation, washed with ultrapure water, and then freeze-dried under vacuum to obtain the platinum polymer nanozyme.

[0012] Platinum-based polymer nanozymes are simple to synthesize, inexpensive, and readily available, exhibiting good colloidal stability and uniform particle size. This material simultaneously retains the strong stability, uniformity, and abundant carboxyl functional groups of polymers, while also maintaining the high catalytic activity of platinum nanozymes.

[0013] Furthermore, the ratio of styrene, acrylic acid, ultrapure water, and potassium persulfate is 2.5 mL: 10 mL: 100 mL: 0.25 g.

[0014] Furthermore, the ratio of carboxyl polymer, chloroplatinic acid, and ascorbic acid is 100mg:10mg:50mg.

[0015] The beneficial effects of this invention are as follows: This invention proposes a one-step rapid and highly sensitive detection method for Salmonella in pasteurized milk by constructing a platinum-based polymer nanozyme composite probe and combining it with an immunomagnetic bead separation and signal amplification strategy. Based on the excellent peroxidase-like activity of platinum-based polymer nanozymes, this composite probe can catalyze a chromogenic substrate to produce a strong signal amplification effect even in the presence of low concentrations of target bacteria, achieving a detection limit of as low as 10 CFU / mL for Salmonella in pasteurized milk matrix. This represents a sensitivity improvement of one to two orders of magnitude compared to traditional culture methods and some existing immunological methods, significantly enhancing the detection capability for low-level Salmonella contamination. This method exhibits strong resistance to matrix interference for common components in pasteurized milk, requires no complex sample pretreatment, and can be used directly or after simple dilution for rapid detection of actual samples, providing a reliable tool for online monitoring and market sampling in dairy product production processes.

[0016] This invention achieves integrated isolation, enrichment, and signal labeling of Salmonella by conjugating platinum-based polymer nanozymes with specific antibodies to prepare a composite probe, which is then used in conjunction with immunomagnetic beads. The entire detection process can be completed within 1.5 hours, significantly shorter than traditional culture methods, and the simplified operation steps reduce the risk of human error and cross-contamination.

[0017] This invention utilizes immunomagnetic beads to specifically capture Salmonella, combined with the highly selective recognition of nanozyme probes. This method enables the accurate differentiation of Salmonella from other common foodborne microorganisms in the complex matrix of pasteurized milk, significantly reducing nonspecific adsorption and false positive results. Attached Figure Description

[0018] Figure 1 This is the standard curve showing the relationship between 420nm absorbance and Salmonella concentration in Example 3. Detailed Implementation

[0019] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0020] Unless otherwise specified, all raw materials used in the embodiments of the present invention are commercially available experimentally pure materials.

[0021] Example 1: Preparation of platinum-based polymer nanozymes Prepared using the following method: C1: Take 2.5 mL of styrene, 10 mL of acrylic acid and 100 mL of ultrapure water, remove oxygen by purging with argon, mix and stir vigorously and heat to 70 °C, then add 0.25 g of potassium persulfate, continue stirring and react at 70 °C for 7 h to obtain a milky white solution. Cool the milky white solution to room temperature naturally, then transfer it to a 14000 KD dialysis bag for dialysis for 7 days. Change the water 5 times a day during dialysis, collect the dialysis product, and freeze dry it under vacuum to obtain the carboxyl polymer. C2: After stirring and heating 100 mg of carboxyl polymer and 10 mg of chloroplatinic acid to 90 °C, 50 mg of ascorbic acid was added, and the reaction was continued for 4 h to obtain a dark gray solution. The dark gray solution was naturally cooled to room temperature, the precipitate was collected by centrifugation, washed 5 times with ultrapure water, and then freeze-dried under vacuum to obtain platinum polymer nanozyme.

[0022] Example 2: Preparation of composite probes Prepared using the following method: B1: Weigh 5 mg of the platinum-based polymer nanozyme prepared in Example 1 and mix it with 500 μL of aptamer a at a concentration of 10 μM. Incubate at 37 °C for 2 h. After incubation, add 500 μL of DNA-a at a concentration of 1 μM. Incubate for 2 h and then centrifuge and wash to obtain probe A. B2: Weigh 5 mg of the platinum-based polymer nanozyme prepared in Example 1 and mix it with 500 μL of aptamer b at a concentration of 100 μM. Incubate at 37 °C for 2 h. After incubation, add 500 μL of DNA-b at a concentration of 1 μM. Incubate for 2 h and then centrifuge and wash to obtain probe B. B3: Mix equal volumes of probe A and probe B and incubate at 37°C for 2 hours to obtain a composite probe for detecting Salmonella in pasteurized milk. Freeze-dry the composite probe under vacuum and store it.

[0023] Wherein, aptamer a is any aptamer that specifically recognizes Salmonella. In this embodiment, aptamer a uses the aptamer with the sequence TATGGCGGCGTCACCCGACGGGGACTTGACATTATCACAG; aptamer b is any aptamer that specifically recognizes Salmonella, different from aptamer a. In this embodiment, aptamer b uses the aptamer with the sequence GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG. DNA-a is a random sequence of 30-60 bp in length, and DNA-b is complementary to it; in this embodiment, the DNA-a sequence used is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT, and the DNA-b sequence is AAAAAAAAAAAAAAAAAAAA; alternatively, the DNA-a sequence can be GAGGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAA, and the DNA-b sequence can be TTTCCCTTATATTCTCTCTCTCTCC. Aptamer a, aptamer b, DNA-a, and DNA-b were all modified with thiol groups and dissolved in 1×PBS. Before being used to prepare probe A or probe B, 10 μL of 10 mM tris(2-carbonylethyl)phosphohydrochloride dissolved in 1×PBS was added and incubated at 37 °C for 1 h.

[0024] Example 3: Establishment of a standard curve relating 420nm absorbance to Salmonella concentration Prepare 25 mL of Salmonella solutions with concentrations of 10 CFU / mL, 20 CFU / mL, 50 CFU / mL, 100 CFU / mL, 200 CFU / mL, 500 CFU / mL, and 10 CFU / mL respectively. 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL pasteurized milk; 200 μg of the composite probe and 30 μg of immunomagnetic beads prepared in Example 2 were added to pasteurized milk with different Salmonella concentrations and incubated on a shaker at 150 rpm for 1 h at room temperature. After incubation, the immunomagnetic beads were removed by magnetic separation.

[0025] Wash three times with 500 μL of 1×PBS each time; after washing, centrifuge to remove the supernatant, add 100 μL of ultrasensitive chromogenic solution; mix well and let stand for 5 min for color development, then add 2M sulfuric acid solution to stop the color development. Use a spectrophotometer or microplate reader to read the absorbance at 420 nm for different Salmonella concentrations, and plot the results as shown below. Figure 1 The standard curve showing the relationship between absorbance and Salmonella concentration is shown. The Salmonella concentration range is quite large; in this example, samples were prepared as follows... Figure 1 The standard curve shown in 'a' represents a Salmonella concentration of 10–200 CFU / mL, and the curve is as follows: Figure 1 The Salmonella concentration shown in b is 200–1 × 10⁻⁶. 6 Standard curve of CFU / mL; The preparation method of the ultrasensitive colorimetric solution is as follows: A1: Add hydrogen peroxide to citrate buffer solution with a pH of 5 to make the hydrogen peroxide concentration in the final solution 1mM, thus obtaining solution A; A2: Add 3,3',5,5'-tetramethylbenzidine to disodium citric acid-ethylenediaminetetraacetate at pH 2.8 to make the concentration of 3,3',5,5'-tetramethylbenzidine in the final solution 1.34 mM, thus obtaining solution B; A3: Mix equal volumes of solution A and solution B thoroughly to obtain the ultrasensitive colorimetric solution.

[0026] The accuracy of the method for detecting Salmonella in commercially available room-temperature milk was verified by colorimetry using the standard curve prepared above. Spiked recovery experiments were conducted on room-temperature milk purchased from supermarkets. Spiked samples with Salmonella concentrations of 50 CFU / mL, 500 CFU / mL, and 5000 CFU / mL were prepared and repeated three times. The results showed that the average recoveries of Salmonella in the spiked samples at concentrations of 50 CFU / mL, 500 CFU / mL, and 5000 CFU / mL were 83%, 88%, and 93%, respectively, with relative standard deviations of less than 5%. This indicates that the method has excellent accuracy and reliability, can efficiently and stably detect target bacteria from complex dairy product matrices, and is minimally affected by matrix interference.

Claims

1. A method for detecting Salmonella in pasteurized milk, characterized in that, Includes the following steps: S1: The pasteurized milk at different Salmonella concentrations was developed using an ultrasensitive colorimetric reagent to establish a standard curve relating 420nm absorbance to Salmonella concentration. S2: Add the composite probe for detecting Salmonella prepared based on platinum nanoparticles and immunomagnetic beads to the pasteurized milk to be tested, and incubate in a shaker at room temperature; S3: After magnetic separation, the precipitate was washed with 1×PBS. After washing, the supernatant was removed by centrifugation. Ultrasensitive colorimetric solution was added, mixed, and allowed to stand for 5 minutes for color development. Then, 2M sulfuric acid solution was added to terminate the color development. The absorbance at 420nm was read. The concentration of Salmonella in the pasteurized milk to be tested was obtained according to the standard curve.

2. The method for detecting Salmonella in pasteurized milk according to claim 1, characterized in that, The preparation method of the ultrasensitive colorimetric solution is as follows: A1: Add hydrogen peroxide to citrate buffer solution with a pH of 5 to make the hydrogen peroxide concentration in the final solution 1mM, thus obtaining solution A; A2: Add 3,3',5,5'-tetramethylbenzidine to disodium citric acid-ethylenediaminetetraacetate at pH 2.8 to make the concentration of 3,3',5,5'-tetramethylbenzidine in the final solution 1.34 mM, thus obtaining solution B; A3: Mix equal volumes of solution A and solution B thoroughly to obtain the ultrasensitive colorimetric solution.

3. The method for detecting Salmonella in pasteurized milk according to claim 2, characterized in that, The ratio of the composite probe, immunomagnetic beads, pasteurized milk to be tested, ultrasensitive colorimetric solution, and sulfuric acid solution was 200μg:30μg:25mL:100μL:50μL.

4. The method for detecting Salmonella in pasteurized milk according to claim 3, characterized in that, The composite probe used to detect Salmonella in pasteurized milk was prepared using the following steps: B1: Mix platinum-based polymer nanozyme with any aptamer a that specifically recognizes Salmonella, incubate at 37°C for 2 hours, add DNA-a with a random sequence of 30-60 bp after incubation, incubate for 2 hours, and then centrifuge and wash to obtain probe A. B2: Mix platinum-based polymer nanozyme with any Salmonella-specific aptamer b that is different from aptamer a, and incubate at 37°C for 2 hours. After incubation, add DNA-b that is 30-60 bp long and whose sequence is complementary to DNA-a. After incubation for 2 hours, centrifuge and wash to obtain probe B. B3: Mix equal volumes of probe A and probe B and incubate at 37°C for 2 hours to obtain a composite probe for detecting Salmonella in pasteurized milk. Freeze-dry the composite probe under vacuum and store it.

5. The method for detecting Salmonella in pasteurized milk according to claim 4, characterized in that, Aptamer a, aptamer b, DNA-a, and DNA-b were all modified with thiol groups and dissolved in 1×PBS; When preparing probe A, 5 mg of platinum-based polymer nanozyme, 500 μL of aptamer a at a concentration of 10 μM and 500 μL of DNA-a at a concentration of 1 μM were used. When preparing probe B, 5 mg of platinum-based polymer nanozyme, 500 μL of aptamer b at a concentration of 100 μM and 500 μL of DNA-b at a concentration of 1 μM were used.

6. The method for detecting Salmonella in pasteurized milk according to claim 5, characterized in that, Before being used to prepare probe A or probe B, aptamers a, b, DNA-a, and DNA-b were dissolved in 1×PBS and then 10 μL of tris(2-carbonylethyl) phosphate hydrochloride was added to each aptamer, and the mixture was incubated at 37 °C for 1 h. The tris(2-carbonylethyl) phosphate hydrochloride was dissolved in 1×PBS to a concentration of 10 mM.

7. The method for detecting Salmonella in pasteurized milk according to any one of claims 4 to 6, characterized in that, Platinum-based polymer nanozymes were prepared using the following method: C1: Styrene, acrylic acid and ultrapure water were deoxygenated, mixed and stirred vigorously and heated to 70°C, then potassium persulfate was added, and the mixture was stirred and reacted at 70°C for 7 hours. After the reaction was completed, the mixture was naturally cooled to room temperature and then transferred to a 14000KD dialysis bag for dialysis for 7 days. The dialysis product was collected and freeze-dried under vacuum to obtain the carboxyl polymer. C2: After stirring and heating the carboxyl polymer and chloroplatinic acid to 90°C, ascorbic acid was added, and the reaction was continued for 4 hours. After the reaction was completed, the mixture was naturally cooled to room temperature, the precipitate was collected by centrifugation, washed with ultrapure water, and then freeze-dried under vacuum to obtain the platinum polymer nanozyme.

8. The method for detecting Salmonella in pasteurized milk according to claim 7, characterized in that, The ratio of styrene, acrylic acid, ultrapure water and potassium persulfate is 2.5 mL: 10 mL: 100 mL: 0.25 g.

9. The method for detecting Salmonella in pasteurized milk according to claim 8, characterized in that, The ratio of carboxyl polymer, chloroplatinic acid, and ascorbic acid is 100mg:10mg:50mg.