Functionalized tetrahydrofuran intermediates and synthesis thereof
By preparing compounds with specific structures through a series of chemical reaction steps, the problem of insufficient efficacy of existing antisense oligonucleotides is solved, and the performance and target gene repression ability of splice-conversion oligonucleotides are improved.
Patent Information
- Application Number
- CN202480039881.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-06-02
- Filing Date
- 2024-05-31
- Publication Date
- 2026-02-13
AI Technical Summary
Existing antisense oligonucleotides exhibit poor efficacy in suppressing target gene expression, necessitating the development of modified splice-conversion oligonucleotides that demonstrate improved performance and efficacy.
Through a series of chemical reaction steps, including protection, reductive cleavage, alkylation, deprotection, and installation of phosphoramide groups, compounds with specific structures are prepared for the synthesis of splice-conversion oligonucleotides.
It improves the performance and efficacy of splice-converting oligonucleotides and enhances their ability to inhibit target genes.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_3
Abstract
Description
[0001] Cross-reference to related applications
[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 470,639, filed June 2, 2023, which is incorporated herein by reference in its entirety for all purposes. Background Technology
[0003] Antisense oligonucleotides are nucleic acid-based compounds that can be used to suppress the expression of certain disease-related genes. While antisense oligonucleotides can often be engineered to hybridize with target genes, conventional antisense oligonucleotides typically exhibit poor efficacy. To develop modified antisense oligonucleotides that exhibit improved performance and efficacy for the prevention, improvement, and treatment of diseases, it is necessary to develop compounds (i.e., building blocks) that can be used to synthesize splice-converting oligonucleotides (e.g., splice-converting oligonucleotides containing one or more spacer groups) and methods for preparing such compounds. Summary of the Invention
[0004] This article discloses a method for preparing compounds of formula (A):
[0005] (A)
[0006] The method includes:
[0007] Compounds with protected formula (I):
[0008] (I),
[0009] This produces the compound of formula (II):
[0010] (II),
[0011] in
[0012] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0013] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0014] This article also discloses a method for preparing compounds of formula (A):
[0015] (A)
[0016] The method includes:
[0017] Reduction of cleavage compounds of form (II):
[0018] (II),
[0019] This produces the compound of formula (III):
[0020] (III).
[0021] This article also discloses a method for preparing compounds of formula (A):
[0022] (A)
[0023] The method includes:
[0024] Alkylation of the compound of formula (III):
[0025] (III),
[0026] This produces a compound of formula (IV):
[0027] (IV),
[0028] in
[0029] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0030] This article also discloses a method for preparing compounds of formula (A):
[0031] (A)
[0032] The method includes:
[0033] To deprotect the compound of formula (IV):
[0034] (IV),
[0035] This produces a compound of formula (V):
[0036] (V),
[0037] in
[0038] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0039] This article also discloses a method for preparing compounds of formula (A):
[0040] (A)
[0041] The method includes:
[0042] Protected (V) compounds:
[0043] (V),
[0044] This produces a compound of formula (VI):
[0045] (VI),
[0046] in
[0047] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3
[0048] This article also discloses a method for preparing compounds of formula (A):
[0049] (A)
[0050] The method includes:
[0051] Install a phosphoramide group onto the compound of formula (VI):
[0052] (VI),
[0053] This produces a compound of formula (A):
[0054] (A)
[0055] This article also discloses a method for preparing compounds of formula (A):
[0056] (A)
[0057] The method includes:
[0058] Compounds with protected formula (I):
[0059] (I),
[0060] This produces the compound of formula (II):
[0061] (II),
[0062] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0063] (III),
[0064] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0065] (IV),
[0066] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0067] (V),
[0068] Protecting the compound of formula (V) yields the compound of formula (VI):
[0069] (VI),
[0070] By attaching a phosphoramide group to the compound of formula (VI), a compound of formula (A) is produced.
[0071] in
[0072] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0073] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0074] This article discloses a method for preparing compounds of formula (VI):
[0075] (VI),
[0076] The method includes:
[0077] Compounds with protected formula (I):
[0078] (I),
[0079] This produces the compound of formula (II):
[0080] (II),
[0081] in
[0082] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0083] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0084] This article also discloses a method for preparing compounds of formula (VI):
[0085] (VI)
[0086] The method includes:
[0087] Reduction of cleavage compounds of form (II):
[0088] (II),
[0089] This produces the compound of formula (III):
[0090] (III).
[0091] This article also discloses a method for preparing compounds of formula (VI):
[0092] (VI)
[0093] The method includes:
[0094] Alkylation of the compound of formula (III):
[0095] (III),
[0096] This produces a compound of formula (IV):
[0097] (IV),
[0098] in
[0099] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0100] This article also discloses a method for preparing compounds of formula (VI):
[0101] (VI),
[0102] The method includes:
[0103] To deprotect the compound of formula (IV):
[0104] (IV),
[0105] This produces a compound of formula (V):
[0106] (V),
[0107] in
[0108] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0109] This article also discloses a method for preparing compounds of formula (VI):
[0110] (VI),
[0111] The method includes:
[0112] Protected (V) compounds:
[0113] (V),
[0114] This produces a compound of formula (VI).
[0115] in
[0116] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0117] This article also discloses a method for preparing compounds of formula (VI):
[0118] (VI),
[0119] The method includes:
[0120] Compounds with protected formula (I):
[0121] (I),
[0122] This produces the compound of formula (II):
[0123] (II),
[0124] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0125] (III),
[0126] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0127] (IV),
[0128] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0129] (V),
[0130] Protecting the compound of formula (V) yields the compound of formula (VI).
[0131] in
[0132] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0133] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0134] This article discloses a method for preparing compounds of formula (V):
[0135] (V),
[0136] The method includes:
[0137] Compounds with protected formula (I):
[0138] (I),
[0139] This produces the compound of formula (II):
[0140] (II),
[0141] in
[0142] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0143] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0144] This article also discloses a method for preparing compounds of formula (V):
[0145] (V),
[0146] The method includes:
[0147] Reduction of cleavage compounds of form (II):
[0148] (II),
[0149] This produces the compound of formula (III):
[0150] (III).
[0151] This article also discloses a method for preparing compounds of formula (V):
[0152] (V),
[0153] The method includes:
[0154] Alkylation of the compound of formula (III):
[0155] (III),
[0156] This produces a compound of formula (IV):
[0157] (IV),
[0158] in
[0159] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0160] This article also discloses a method for preparing compounds of formula (V):
[0161] (V),
[0162] The method includes:
[0163] To deprotect the compound of formula (IV):
[0164] (IV),
[0165] This produces a compound of formula (V).
[0166] in
[0167] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0168] This article also discloses a method for preparing compounds of formula (V):
[0169] (V),
[0170] The method includes:
[0171] Compounds with protected formula (I):
[0172] (I),
[0173] This produces the compound of formula (II):
[0174] (II),
[0175] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0176] (III),
[0177] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0178] (IV),
[0179] The compound of formula (IV) is deprotected to produce the compound of formula (V).
[0180] in
[0181] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0182] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0183] This article discloses a method for preparing compounds of formula (IV):
[0184] (IV),
[0185] The method includes:
[0186] Compounds with protected formula (I):
[0187] (I),
[0188] This produces the compound of formula (II):
[0189] (II),
[0190] in
[0191] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0192] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0193] This article also discloses a method for preparing compounds of formula (IV):
[0194] (IV),
[0195] The method includes:
[0196] Reduction of cleavage compounds of form (II):
[0197] (II),
[0198] This produces the compound of formula (III):
[0199] (III).
[0200] This article also discloses a method for preparing compounds of formula (IV):
[0201] (IV),
[0202] The method includes:
[0203] Alkylation of the compound of formula (III):
[0204] (III),
[0205] This produces a compound of formula (IV).
[0206] in
[0207] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0208] This article also discloses a method for preparing compounds of formula (IV):
[0209] (IV),
[0210] The method includes:
[0211] Compounds with protected formula (I):
[0212] (I),
[0213] This produces the compound of formula (II):
[0214] (II),
[0215] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0216] (III),
[0217] Alkylation of the compound of formula (III) yields the compound of formula (IV).
[0218] in
[0219] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0220] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0221] This article discloses a method for preparing compounds of formula (III):
[0222] (III),
[0223] The method includes:
[0224] Compounds with protected formula (I):
[0225] (I),
[0226] This produces the compound of formula (II):
[0227] (II),
[0228] in
[0229] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0230] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0231] This article also discloses a method for preparing compounds of formula (III):
[0232] (III),
[0233] The method includes:
[0234] Reduction of cleavage compounds of form (II):
[0235] (II),
[0236] This produces a compound of formula (III).
[0237] in
[0238] R 2 and R 3Each is independently an H or C1-C6 alkyl group.
[0239] This article also discloses a method for preparing compounds of formula (III):
[0240] (III),
[0241] The method includes:
[0242] Compounds with protected formula (I):
[0243] (I),
[0244] This produces the compound of formula (II):
[0245] (II),
[0246] The reduction and cleavage of compound (II) yields compound (III).
[0247] in
[0248] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0249] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0250] This article discloses a method for preparing compounds of formula (II):
[0251] (II),
[0252] The method includes:
[0253] Compounds with protected formula (I):
[0254] (I),
[0255] This produces a compound of formula (II).
[0256] in
[0257] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0258] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0259] This article discloses a method for preparing splice-switching oligonucleotides containing one or more spacer groups, the method comprising:
[0260] Compounds with protected formula (I):
[0261] (I),
[0262] This produces the compound of formula (II):
[0263] (II),
[0264] in
[0265] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0266] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0267] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0268] Reduction of cleavage compounds of form (II):
[0269] (II),
[0270] This produces the compound of formula (III):
[0271] (III).
[0272] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0273] Alkylation of the compound of formula (III):
[0274] (III),
[0275] This produces a compound of formula (IV):
[0276] (IV),
[0277] in
[0278] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0279] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0280] To deprotect the compound of formula (IV):
[0281] (IV),
[0282] This produces a compound of formula (V):
[0283] (V),
[0284] in
[0285] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0286] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0287] Protected (V) compounds:
[0288] (V),
[0289] This produces a compound of formula (VI):
[0290] (VI),
[0291] in
[0292] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH 3。
[0293] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0294] Install a phosphoramide group on the compound of formula (VI):
[0295] (VI),
[0296] This produces a compound of formula (A):
[0297] (A),
[0298] in
[0299] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0300] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacer groups, the method comprising:
[0301] Compounds with protected formula (I):
[0302] (I),
[0303] This produces the compound of formula (II):
[0304] (II),
[0305] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0306] (III),
[0307] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0308] (IV),
[0309] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0310] (V),
[0311] Protecting the compound of formula (V) yields the compound of formula (VI):
[0312] (VI),
[0313] By attaching a phosphoramide group to the compound of formula (VI), a compound of formula (A) is produced:
[0314] (A),
[0315] in
[0316] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0317] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0318] This document discloses a method for preparing splice-conversion oligonucleotides comprising one or more spacer groups, the method comprising any one of the methods described herein, or a combination thereof.
[0319] This document discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (A). This document also discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (I). This document further discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (II). This document further discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (III). This document further discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (IV). This document further discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (V). This document further discloses a method for preparing splice-converting oligonucleotides containing one or more spacer groups using a compound of formula (VI).
[0320] In some embodiments, the splice-transfer oligonucleotide containing one or more spacer groups is any splice-transfer oligonucleotide containing one or more spacer groups described in PCT Publication No. WO2021 / 247800, which is incorporated herein by reference in its entirety.
[0321] This article discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0322] (B),
[0323] The method includes:
[0324] Compounds with protected formula (I):
[0325] (I),
[0326] This produces the compound of formula (II):
[0327] (II),
[0328] in
[0329] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3;
[0330] R 2 and R 3 Each is independently an H or C1-C6 alkyl group; and
[0331] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0332] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0333] (B),
[0334] The method includes:
[0335] Reduction of cleavage compounds of form (II):
[0336] (II),
[0337] This produces the compound of formula (III):
[0338] (III),
[0339] in
[0340] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3;
[0341] R 2 and R 3 Each is independently an H or C1-C6 alkyl group; and
[0342] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0343] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0344] (B),
[0345] The method includes:
[0346] Alkylation of the compound of formula (III):
[0347] (III),
[0348] This produces a compound of formula (IV):
[0349] (IV),
[0350] in
[0351] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0352] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0353] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0354] (B),
[0355] The method includes:
[0356] To deprotect the compound of formula (IV):
[0357] (IV),
[0358] This produces a compound of formula (V):
[0359] (V),
[0360] in
[0361] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0362] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0363] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0364] (B),
[0365] The method includes:
[0366] Protected (V) compounds:
[0367] (V),
[0368] This produces a compound of formula (VI):
[0369] (VI),
[0370] in
[0371] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0372] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0373] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0374] (B),
[0375] The method includes:
[0376] Install a phosphoramide group on the compound of formula (VI):
[0377] (VI),
[0378] This produces a compound of formula (A):
[0379] (A),
[0380] in
[0381] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0382] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0383] This article also discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0384] (B),
[0385] The method includes:
[0386] Compounds with protected formula (I):
[0387] (I),
[0388] This produces the compound of formula (II):
[0389] (II),
[0390] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0391] (III),
[0392] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0393] (IV),
[0394] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0395] (V),
[0396] Protecting the compound of formula (V) yields the compound of formula (VI):
[0397] (VI),
[0398] By attaching a phosphoramide group to the compound of formula (VI), a compound of formula (A) is produced:
[0399] (A),
[0400] in
[0401] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3;
[0402] R 2 and R 3 Each is independently an H or C1-C6 alkyl group; and
[0403] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0404] This article discloses a method for preparing splice-conversion oligonucleotides containing one or more spacers of formula (B):
[0405] (B),
[0406] The method includes any one of the methods described herein, or a combination thereof, wherein each The symbol represents the connection point between the nucleoside and the nucleotide.
[0407] In some implementations, the method further includes:
[0408] Reduction of cleavage compounds of form (II):
[0409] (II),
[0410] This produces the compound of formula (III):
[0411] (III).
[0412] In some implementations, the method further includes:
[0413] Alkylation of the compound of formula (III):
[0414] (III),
[0415] This produces a compound of formula (IV):
[0416] (IV),
[0417] in
[0418] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0419] In some implementations, the method further includes:
[0420] To deprotect the compound of formula (IV):
[0421] (IV),
[0422] This produces a compound of formula (V):
[0423] (V),
[0424] in
[0425] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0426] In some implementations, the method further includes:
[0427] Protected (V) compounds:
[0428] (V),
[0429] This produces a compound of formula (VI):
[0430] (VI),
[0431] in
[0432] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0433] In some implementations, the method further includes:
[0434] Install a phosphoramide group on the compound of formula (VI):
[0435] (VI),
[0436] This produces a compound of formula (A):
[0437] (A)
[0438] In some embodiments, the protecting compound (I) comprises contacting the compound of formula (I) with a first base. In some embodiments, the first base is an inorganic base. In some embodiments, the first base is a hydride base. In some embodiments, the first base is NaH. In some embodiments, the protecting compound (I) comprises contacting the compound of formula (I) with Bn-X 1 Contact, in which X 1 It is a leaving group. In some embodiments, X 1 It is a halogenated group. In some implementations, X 1 It is –Cl, –Br, or –I. In some implementations, X 1 Yes –Br. In some embodiments, the protection formula (I) involves contacting the compound of formula (I) with a first solvent. In some embodiments, the first solvent is a polar solvent. In some embodiments, the first solvent is tetrahydrofuran (THF). In some embodiments, the protection formula (I) involves raising the reaction temperature to reflux. In some embodiments, the protection formula (I) involves raising the reaction temperature to about 65°C.
[0439] In some embodiments, reducing the compound of formula (II) involves contacting the compound of formula (II) with an activator. In some embodiments, the activator comprises a trialkylsilyl cation. In some embodiments, the activator comprises a trimethylsilyl cation. In some embodiments, the activator is trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, reducing the compound of formula (II) involves contacting the compound of formula (II) with a reducing agent. In some embodiments, the reducing agent is an organosilicon reducing agent. In some embodiments, the reducing agent is a trialkylsilane. In some embodiments, the reducing agent is triethylsilane. In some embodiments, the reducing agent is triethylsilane. In some embodiments, reducing the compound of formula (II) involves contacting the compound of formula (II) with a second solvent. In some embodiments, the second solvent is a halogenated solvent. In some embodiments, the second solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the second solvent is dichloromethane (DCM). In some embodiments, reducing the cleavage compound of formula (II) involves lowering the reaction temperature to below 0°C. In some embodiments, reducing the cleavage compound of formula (II) involves lowering the reaction temperature to about -18°C. In some embodiments, alkylating the compound of formula (III) involves contacting the compound of formula (III) with a second base.
[0440] In some embodiments, the second base is an inorganic base. In some embodiments, the second base is a hydride base. In some embodiments, the second base is NaH. In some embodiments, alkylating a compound of formula (III) involves contacting the compound of formula (III) with an alkylating agent. In some embodiments, the alkylating agent is R. 1 –X 2 , where X 2 It is a leaving group. In some embodiments, X 2 It is a halogenated group. In some implementations, X 2 It is –Cl, –Br, or –I. In some implementations, X 2 Yes –Br. In some implementations, X 2 Yes – I. In some embodiments, alkylating a compound of formula (III) involves contacting the compound of formula (III) with a third solvent. In some embodiments, the third solvent is a polar solvent. In some embodiments, the third solvent is tetrahydrofuran (THF). In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to below about 10°C. In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to about -10°C to about 10°C. In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to about 0°C.
[0441] In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with a first catalyst. In some embodiments, the first catalyst is a palladium catalyst. In some embodiments, the first catalyst is a palladium (O) catalyst. In some embodiments, the first catalyst is palladium on carbon. In some embodiments, the first catalyst is about 5% by weight palladium on carbon. In some embodiments, the first catalyst is about 10% by weight palladium on carbon. In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with about 30 mol% of the first catalyst. In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen. In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen at atmospheric pressure. In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with a fourth solvent. In some embodiments, the fourth solvent is a protic solvent. In some embodiments, the fourth solvent is methanol or ethanol. In some embodiments, the fourth solvent is methanol. In some embodiments, deprotection of the compound of formula (IV) involves a reaction temperature of about 23°C.
[0442] In some embodiments, the compound of formula (V) comprises contacting the compound of formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6-dimethylpyridine (2,6-dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (dimethylpyridine).
[0443] In some embodiments, the protecting compound (V) comprises contacting the compound of formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP). In some embodiments, deprotecting the compound of formula (V) comprises contacting the compound of formula (V) with about 50 mol% of the second catalyst. In some embodiments, the protecting compound (V) comprises contacting the compound of formula (V) with DMT-X. 3 Contact, in which X 3 It is a leaving group. In some embodiments, X 3 It is a halogenated group. In some implementations, X 3 It is –Cl, –Br, or –I. In some implementations, X 3Yes –Cl. In some embodiments, the compound of protection formula (V) involves lowering the reaction temperature to below about 10°C. In some embodiments, the compound of protection formula (V) involves lowering the reaction temperature to about -10°C to about 10°C. In some embodiments, the compound of protection formula (V) involves lowering the reaction temperature to about 0°C. In some embodiments, the compound of protection formula (V) involves contacting the compound of formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6-dimethylpyridine (dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (dimethylpyridine). In some embodiments, protecting the compound of formula (V) involves contacting the compound of formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP). In some embodiments, deprotecting the compound of formula (V) involves contacting the compound of formula (V) with about 50 mol% of the second catalyst.
[0444] In some embodiments, attaching a phosphorus amide group to a compound of formula (VI) comprises contacting the compound of formula (VI) with a fourth base. In some embodiments, the fourth base is an organic base. In some embodiments, the fourth base is an amine base. In some embodiments, the fourth base is triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA). In some embodiments, the fourth base is N,N-diisopropylethylamine (DIPEA). In some embodiments, attaching a phosphorus amide group to a compound of formula (VI) comprises contacting the compound of formula (VI) with a phosphorus amide reagent.
[0445] In some implementations, the phosphoramide reagent is , where X 5 It is a leaving group. In some embodiments, X 5 It is a halogenated group. In some implementations, X 5 It is –Cl, –Br, or –I. In some implementations, X 5Yes –Cl. In some embodiments, the phosphoramidite reagent is 2-cyanoethyl N,N-diisopropylchlorophosphamide. In some embodiments, attaching the phosphoramidite group to the compound of formula (VI) includes contacting the compound of formula (VI) with a fifth solvent. In some embodiments, the fifth solvent is a halogenated solvent. In some embodiments, the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the fifth solvent is dichloromethane (DCM). In some embodiments, attaching the phosphoramidite group to the compound of formula (VI) includes lowering the reaction temperature to below about 10°C. In some embodiments, attaching the phosphoramidite group to the compound of formula (VI) includes lowering the reaction temperature to about -10°C to about 10°C. In some embodiments, attaching the phosphoramidite group to the compound of formula (VI) includes lowering the reaction temperature to about 0°C.
[0446] This article discloses a compound of formula (A):
[0447] (A)
[0448] in
[0449] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0450] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0451] This article also discloses a compound of formula (I):
[0452] (I)
[0453] in
[0454] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0455] This article also discloses a compound of formula (II):
[0456] (II)
[0457] in
[0458] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0459] This article also discloses a compound of formula (III):
[0460] (III).
[0461] This article also discloses a compound of formula (IV):
[0462] (IV)
[0463] in
[0464] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0465] This paper also discloses a compound of formula (V):
[0466] (V)
[0467] in
[0468] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0469] This article also discloses a compound of formula (VI):
[0470] (VI)
[0471] in
[0472] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0473] This document discloses a composition comprising a compound of formula (A):
[0474] (I)
[0475] in
[0476] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0477] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0478] This document also discloses a composition comprising a compound of formula (I):
[0479] (I)
[0480] in
[0481] R 2 and R3 Each is independently an H or C1-C6 alkyl group.
[0482] This document also discloses a composition comprising a compound of formula (II):
[0483] (II)
[0484] in
[0485] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0486] This document also discloses a composition comprising a compound of formula (III):
[0487] (III).
[0488] This document also discloses a composition comprising a compound of formula (IV):
[0489] (IV)
[0490] in
[0491] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0492] This document also discloses a composition comprising a compound of formula (V):
[0493] (V)
[0494] in
[0495] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0496] This document also discloses a composition comprising a compound of formula (VI):
[0497] (VI)
[0498] in
[0499] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0500] In some implementation schemes, R 1 Yes – Me. In some implementations, R 1 Yes – Et. In some implementations, R 1It is –CH2OCH3. In some implementations, R 1 It is –(CH2)2OCH3.
[0501] In some implementation schemes, R 2 It is an H or C1-C3 alkyl group. In some embodiments, R 2 It is H, –Me, –Et, or –nPr. In some implementations, R 2 Yes – Me.
[0502] In some implementation schemes, R 3 It is an H or C1-C3 alkyl group. In some embodiments, R 3 It is H, –Me, –Et, or –nPr. In some implementations, R 3 Yes – Me.
[0503] In some embodiments, the compound of formula (A) is a compound of formula (A1):
[0504] (A1)
[0505] In some embodiments, the compound of formula (I) is the same as the compound of formula (Ia):
[0506] (Ia).
[0507] In some embodiments, the compound of formula (A) is a compound of formula (II-a):
[0508] (II-a).
[0509] In some embodiments, the compound of formula (A) is a compound of formula (III-a):
[0510] (III-a).
[0511] In some embodiments, the compound of formula (A) is a compound of formula (IV-a):
[0512] (IV-a).
[0513] In some embodiments, the compound of formula (A) is a compound of formula (Va):
[0514] (Va).
[0515] In some embodiments, the compound of formula (A) is a compound of formula (VI-a):
[0516] (VI-a).
[0517] This article discloses a compound for use with formula (A):
[0518] (A)
[0519] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0520] (B),
[0521] in
[0522] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0523] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0524] This article also discloses a compound for use with formula (I):
[0525] (I)
[0526] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0527] (B),
[0528] in
[0529] R 2 and R 3 Each is independently an H or C1-C6 alkyl group; and
[0530] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0531] This article also discloses a compound for use with formula (II):
[0532] (II)
[0533] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0534] (B),
[0535] in
[0536] R 2 and R 3 Each is independently an H or C1-C6 alkyl group; and
[0537] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0538] This article also discloses a compound for use with formula (III):
[0539] (III)
[0540] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0541] (B),
[0542] in
[0543] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0544] This article also discloses a compound for use with formula (IV):
[0545] (IV)
[0546] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0547] (B),
[0548] in
[0549] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0550] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0551] This article also discloses a compound for use with formula (V):
[0552] (V)
[0553] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0554] (B),
[0555] in
[0556] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0557] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0558] This article also discloses a compound for use with formula (VI):
[0559] (VI)
[0560] A method for preparing splice-converting oligonucleotides containing one or more spacer groups of formula (B):
[0561] (B),
[0562] in
[0563] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0564] Each The symbol represents the connection point between the nucleoside and the nucleotide. Detailed Implementation
[0565] Features and other details of this disclosure will now be described in more specific terms. Certain terms used in this specification, embodiments, and appended claims are collected herein. These definitions should be read in light of the remainder of this disclosure and understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
[0566] The methods or approaches disclosed herein can be used to synthesize or prepare compounds that can be used to synthesize splice-conversion oligonucleotides. The methods or approaches disclosed herein can be used to synthesize or prepare splice-conversion oligonucleotides (e.g., splice-conversion oligonucleotides containing one or more spacer groups). Other methods or approaches disclosed herein can be used to synthesize or prepare compounds or compositions (e.g., compounds of formulas (A), (I), (II), (III), (IV), (V), and (VI) and their subforms, and compositions containing compounds of formulas (A), (I), (II), (III), (IV), (V), and (VI) and their subforms), which can be used to synthesize splice-conversion oligonucleotides containing one or more spacer groups), wherein each variable (i.e., R...) 1 R 2 and R 3 All are as defined and described in this document.
[0567] definition
[0568] As used herein, “alkyl” refers to a straight-chain or branched saturated hydrocarbon group having 1 to 6 carbon atoms (“C1-C6 alkyl”). Common alkyl abbreviations include –Me (–CH3), –Et (–CH2CH3), –iPr (–CH(CH3)2), –nPr (–CH2CH2CH3), –nBu (–CH2CH2CH2CH3), –iBu (–CH2CH(CH3)2), or –tBu (–C(CH3)).
[0569] As used herein, the terms “antisense oligonucleotide” or “AON” or “splicing-conversion oligonucleotide” cover any one of a parent oligonucleotide, an oligonucleotide variant, an oligonucleotide containing one or more spacer groups, or an oligonucleotide variant containing one or more spacer groups. Examples of antisense oligonucleotides include oligonucleotides that comprise a sequence of any antisense oligonucleotide containing any one of the sequences described in PCT Publication No. WO 2021 / 247800, which is incorporated herein by reference in its entirety.
[0570] As used in this article, "nucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.
[0571] As used herein, the term “leaving group” has its common meaning in the field of synthetic organic chemistry and refers to an atom or group that can be replaced by a nucleophile. Examples of suitable leaving groups include, but are not limited to, halogens (i.e., –F, –Cl, –Br, or –I) and sulfonates such as toluenesulfonates (toluenesulfonates, -OTs), methanesulfonates (methanesulfonates, -OMs), or trifluoromethanesulfonates (trifluoromethanesulfonates, -OTf).
[0572] As used in this article, “2'- O "-(2-methoxyethyl)" (also known as 2'-MOE and 2'-O(CH2)2OCH3 and MOE) refers to the 2' position of the furanose ring. O -Methoxyethyl modification. In this disclosure, 2'-O-(2-methoxyethyl) is modified with "2'- O- "Methoxyethyl" is used interchangeably. The sugar moiety in a nucleoside modified with 2'-MOE is a modified sugar.
[0573] As used in this article, “nucleic acid” refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, non-coding RNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA).
[0574] As used in this article, "nucleobase" refers to a heterocyclic portion that can pair with a base of another nucleic acid.
[0575] As used herein, “modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. “Unmodified nucleobase” refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0576] As used herein, "modified nucleoside" means a nucleoside that has only a modified sugar moiety or a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. Modified nucleosides include abase-free nucleosides, which lack a nucleobase. However, modified nucleosides do not contain a spacer group or other groups that cannot connect to a nucleobase.
[0577] As used in this article, “oligonucleotide” means a polymer of one or more segments of linked nucleosides, each of which may be modified or unmodified and is independent of each other.
[0578] The term "oligonucleotide containing one or more spacer groups" or "oligonucleotide containing spacer groups" refers to an oligonucleotide having at least one spacer group. In various embodiments, an oligonucleotide containing one or more spacer groups may contain one, two, three, four, five, six, seven, eight, nine, or ten spacer groups. Typically, oligonucleotides containing one or more spacer groups are described with reference to the corresponding parent oligonucleotide or the corresponding oligonucleotide variant. Exemplary oligonucleotides containing one or more spacer groups are described in PCT Publication No. WO 2021 / 247800, which is incorporated herein by reference in its entirety.
[0579] The terms “preparation,” “synthesis,” and “generation” are used interchangeably in this article.
[0580] The terms “method” and “way” are used interchangeably in this article.
[0581] As used herein, a "spacer" refers to a nucleoside substitution group (e.g., a non-nucleoside group that replaces a nucleoside present in a parent oligonucleotide). A spacer is characterized by the absence of a nucleoside base and the replacement of the nucleoside sugar portion with a non-sugar substitute. One or more spacer non-sugar substitutes lack an aldehyde, ketone, acetal, ketal, hemiacetal, or hemiketal group. Therefore, one or more spacer non-sugar substitutes can be linked via nucleoside intermolecular junctions to the 3' and 5' positions of the nucleoside adjacent to the spacer, as described herein, but cannot form covalent bonds with a nucleotide base (i.e., cannot link a nucleoside base to another group, such as a nucleoside intermolecular bond, a conjugated group, or a terminal group in the oligonucleotide). Typically, oligonucleotides containing one or more spacers are described with respect to a parent oligonucleotide in which the spacer substitutes a nucleoside of the parent oligonucleotide.
[0582] This disclosure also includes fluorescently labeled compounds of this disclosure. This disclosure also includes isotopically labeled compounds of this disclosure, which are identical to those described herein, except that one or more atoms are replaced by atoms having atomic masses or mass numbers different from those found in abundance in nature. Examples of isotopes that may be incorporated into the compounds of this disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as... 2 H, 3 H, 11 C 13 C 14 C 15 N、 18 O、 17 O、 31 P, 32 P, 33 P, 35 S, 18 F and 36 Cl.
[0583] Compounds and Compositions
[0584] The compounds or compositions disclosed herein can be used to synthesize splice-conversion oligonucleotides (e.g., splice-conversion oligonucleotides containing one or more spacer groups).
[0585] This article discloses a compound of formula (A):
[0586] (A)
[0587] in
[0588] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0589] This article also discloses a compound of formula (I):
[0590] (I)
[0591] in
[0592] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0593] This article also discloses a compound of formula (II):
[0594] (II)
[0595] in
[0596] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0597] This article also discloses a compound of formula (III):
[0598] (III).
[0599] This article also discloses a compound of formula (IV):
[0600] (IV)
[0601] in
[0602] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0603] This paper also discloses a compound of formula (V):
[0604] (V)
[0605] in
[0606] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0607] This article also discloses a compound of formula (VI):
[0608] (VI)
[0609] in
[0610] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0611] This document discloses a composition comprising a compound of formula (A):
[0612] (A)
[0613] in
[0614] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0615] This document also discloses a composition comprising a compound of formula (I):
[0616] (I)
[0617] in
[0618] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0619] This document also discloses a composition comprising a compound of formula (II):
[0620] (II)
[0621] in
[0622] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0623] This document also discloses a composition comprising a compound of formula (III):
[0624] (III).
[0625] This document also discloses a composition comprising a compound of formula (IV):
[0626] (IV)
[0627] in
[0628] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0629] This document also discloses a composition comprising a compound of formula (V):
[0630] (V)
[0631] in
[0632] R 1It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0633] This document also discloses a composition comprising a compound of formula (VI):
[0634] (VI)
[0635] in
[0636] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0637] In some embodiments, the compound of formula (A) is a compound of formula (A1):
[0638] (A1)
[0639] In some embodiments, the compound of formula (I) is the same as the compound of formula (Ia):
[0640] (Ia).
[0641] In some embodiments, the compound of formula (II) is the compound of formula (II-a):
[0642] (II-a).
[0643] In some embodiments, the compound of formula (III) is the compound of formula (III-a):
[0644] (III-a).
[0645] In some embodiments, the compound of formula (IV) is the compound of formula (IV-a):
[0646] (IV-a).
[0647] In some embodiments, the compound of formula (V) is a compound of formula (Va):
[0648] (Va).
[0649] In some embodiments, the compound of formula (VI) is a compound of formula (VI-a):
[0650] (VI-a).
[0651] In some implementation schemes, R 1It is –Me or –Et. In some implementations, R 1 It is –CH2OCH3 or –(CH2)2OCH3. In some implementations, R 1 Yes – Me. In some implementations, R 1 Yes – Et. In some implementations, R 1 It is –CH2OCH3. In some implementations, R 1 It is –(CH2)2OCH3.
[0652] In some implementation schemes, R 2 It is an H or C1-C3 alkyl group. In some embodiments, R 2 It is H, –Me, –Et, or –nPr. In some implementations, R 2 It is –Me, –Et, or –nPr. In some implementations, R 2 Yes – Me. In some implementations, R 2 Yes – Et. In some implementations, R 2 It is –nPr.
[0653] In some implementation schemes, R 3 It is an H or C1-C3 alkyl group. In some embodiments, R 3 It is H, –Me, –Et, or –nPr. In some implementations, R 3 It is –Me, –Et, or –nPr. In some implementations, R 3 Yes – Me. In some implementations, R 3 Yes – Et. In some implementations, R 3 It is –nPr.
[0654] In some implementation schemes, R 2 Yes – Me and R 3 Yes – Me.
[0655] In some embodiments, the compound of formula (A) is:
[0656] .
[0657] In some embodiments, the compound of formula (A) or formula (A1) is:
[0658] .
[0659] In some embodiments, the compound of formula (A) is:
[0660] .
[0661] In some embodiments, the compound of formula (A) or formula (A1) is:
[0662] .
[0663] In some embodiments, the compound of formula (A) is:
[0664] .
[0665] In some embodiments, the compound of formula (A) or formula (A1) is:
[0666] .
[0667] In some embodiments, the compound of formula (A) is:
[0668] .
[0669] In some embodiments, the compound of formula (A) or formula (A1) is:
[0670] .
[0671] In some implementations, the compound of formula (IV) is:
[0672] .
[0673] In some embodiments, the compound of formula (IV) or formula (IV-a) is:
[0674] .
[0675] In some implementations, the compound of formula (IV) is:
[0676] .
[0677] In some embodiments, the compound of formula (IV) or formula (IV-a) is:
[0678] .
[0679] In some implementations, the compound of formula (IV) is:
[0680] .
[0681] In some embodiments, the compound of formula (IV) or formula (IV-a) is:
[0682] .
[0683] In some implementations, the compound of formula (IV) is:
[0684] .
[0685] In some embodiments, the compound of formula (IV) or formula (IV-a) is:
[0686] .
[0687] In some embodiments, the compound of formula (V) is:
[0688] .
[0689] In some embodiments, the compound of formula (V) or formula (Va) is:
[0690] .
[0691] In some embodiments, the compound of formula (V) is:
[0692] .
[0693] In some embodiments, the compound of formula (V) or formula (Va) is:
[0694] .
[0695] In some embodiments, the compound of formula (V) is:
[0696] .
[0697] In some embodiments, the compound of formula (V) or formula (Va) is:
[0698] .
[0699] In some embodiments, the compound of formula (V) is:
[0700] .
[0701] In some embodiments, the compound of formula (V) or formula (Va) is:
[0702] .
[0703] In some embodiments, the compound of formula (VI) is:
[0704] .
[0705] In some embodiments, the compound of formula (VI) or formula (VI-a) is:
[0706] .
[0707] In some embodiments, the compound of formula (VI) is:
[0708] .
[0709] In some embodiments, the compound of formula (VI) or formula (VI-a) is:
[0710] .
[0711] In some embodiments, the compound of formula (VI) is:
[0712] .
[0713] In some embodiments, the compound of formula (VI) or formula (VI-a) is:
[0714] .
[0715] In some embodiments, the compound of formula (VI) is:
[0716] .
[0717] In some embodiments, the compound of formula (VI) or formula (VI-a) is:
[0718] .
[0719] This document discloses compositions comprising compounds comprising formula (A) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (I) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (II) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (III) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (IV) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (V) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (VI) or any of its subforms. This document also discloses compositions comprising compounds comprising formula (A), formula (I), formula (II), formula (III), formula (IV), formula (V), formula (VI) or any of their subforms, or any combination thereof.
[0720] Synthesis method
[0721] This document discloses methods or approaches for synthesizing or preparing splice-converting oligonucleotides comprising one or more spacer groups. This document further discloses methods or approaches for synthesizing or preparing splice-converting oligonucleotides comprising one or more spacer groups of formula (B):
[0722] (B)
[0723] in
[0724] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0725] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0726] In some implementations, the spacer basis of equation (B) is:
[0727] .
[0728] In some implementations, the spacer basis of equation (B) is:
[0729] .
[0730] In some implementations, the spacer basis of equation (B) is:
[0731] .
[0732] In some implementations, the spacer basis of equation (B) is:
[0733] .
[0734] In some embodiments, the spacer basis of formula (B) is the spacer basis of formula (B1), wherein:
[0735] (B1)
[0736] in
[0737] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0738] Each The symbol represents the connection point between the nucleoside and the nucleotide.
[0739] In some implementations, the spacer base of formula (B) or formula (B1) is:
[0740] .
[0741] In some implementations, the spacer base of formula (B) or formula (B1) is:
[0742] .
[0743] In some implementations, the spacer base of formula (B) or formula (B1) is:
[0744] .
[0745] In some implementations, the spacer base of formula (B) or formula (B1) is:
[0746] .
[0747] In some embodiments, the manner or method for synthesizing or preparing a splice-conversion oligonucleotide comprising one or more spacer groups of formula (B) includes one or more of the following synthetic steps: benzyl protection; reductive cleavage; alkylation; benzyl deprotection; DMT protection; and phosphoramidite mounting.
[0748] In some embodiments, the manner or method for synthesizing or preparing a splice-converting oligonucleotide comprising one or more spacer groups of formula (B) includes one or more of the following synthetic steps: protecting a compound of formula (I); reducing and cleaving a compound of formula (II); alkylating a compound of formula (III); deprotecting a compound of formula (IV); protecting a compound of formula (V); and attaching a phosphoramidite group to a compound of formula (VI) to produce a compound of formula (A), wherein each variable (i.e., R) 1 R 2 and R 3 As defined and described in this document.
[0749] In various embodiments, the manner or method for synthesizing or preparing a splice-converting oligonucleotide comprising one or more spacer groups of formula (B) includes using one or more of the following compounds: compounds of formula (I); compounds of formula (II); compounds of formula (III); compounds of formula (IV); compounds of formula (V); compounds of formula (VI); and compounds of formula (A), wherein each variable (i.e., R) 1 R 2 and R 3 As defined and described in this document.
[0750] This document discloses methods or approaches for synthesizing or preparing compounds of formula (A) or compositions comprising compounds of formula (A), wherein each variable (i.e., R) 1 As defined and described herein. This document discloses ways or methods for synthesizing or preparing compounds of formula (VI) or compositions comprising formula (VI), wherein each variable (i.e., R) is specified in the following manner.1 As defined and described herein. This document discloses ways or methods for synthesizing or preparing compounds of formula (V) or compositions comprising formula (V), wherein each variable (i.e., R) is specified in the following manner. 1 As defined and described herein. This document discloses ways or methods for synthesizing or preparing compounds of formula (IV) or containing formula (IV) compounds, wherein each variable (i.e., R) is specified in the following manner. 1 As defined and described herein. This document discloses methods or approaches for synthesizing or preparing compounds of formula (III) or containing compounds of formula (III). This document also discloses methods or approaches for synthesizing or preparing compounds of formula (II) or containing compounds of formula (II), wherein each variable (i.e., R) 2 and R 3 As defined and described in this document.
[0751] This article discloses a method for preparing compounds of formula (A):
[0752] (A)
[0753] The method includes:
[0754] Compounds with protected formula (I):
[0755] (I),
[0756] This produces the compound of formula (II):
[0757] (II),
[0758] in
[0759] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0760] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0761] This article also discloses a method for preparing compounds of formula (A):
[0762] (A)
[0763] The method includes:
[0764] Reduction of cleavage compounds of form (II):
[0765] (II),
[0766] This produces the compound of formula (III):
[0767] (III).
[0768] This article also discloses a method for preparing compounds of formula (A):
[0769] (A)
[0770] The method includes:
[0771] Alkylation of the compound of formula (III):
[0772] (III),
[0773] This produces a compound of formula (IV):
[0774] (IV),
[0775] in
[0776] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0777] This article also discloses a method for preparing compounds of formula (A):
[0778] (A)
[0779] The method includes:
[0780] To deprotect the compound of formula (IV):
[0781] (IV),
[0782] This produces a compound of formula (V):
[0783] (V),
[0784] in
[0785] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0786] This article also discloses a method for preparing compounds of formula (A):
[0787] (A)
[0788] The method includes:
[0789] Protected (V) compounds:
[0790] (V),
[0791] This produces a compound of formula (VI):
[0792] (VI),
[0793] in
[0794] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3
[0795] This article also discloses a method for preparing compounds of formula (A):
[0796] (A)
[0797] The method includes:
[0798] Install a phosphoramide group on the compound of formula (VI):
[0799] (VI),
[0800] This produces a compound of formula (A):
[0801] (A)
[0802] This article also discloses a method for preparing compounds of formula (A):
[0803] (A)
[0804] The method includes:
[0805] Compounds with protected formula (I):
[0806] (I),
[0807] This produces the compound of formula (II):
[0808] (II),
[0809] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0810] (III),
[0811] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0812] (IV),
[0813] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0814] (V),
[0815] Protecting the compound of formula (V) yields the compound of formula (VI):
[0816] (VI),
[0817] By attaching a phosphoramide group to the compound of formula (VI), a compound of formula (A) is produced.
[0818] in
[0819] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0820] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0821] This article discloses a method for preparing compounds of formula (VI):
[0822] (VI),
[0823] The method includes:
[0824] Compounds with protected formula (I):
[0825] (I),
[0826] This produces the compound of formula (II):
[0827] (II),
[0828] in
[0829] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0830] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0831] This article also discloses a method for preparing compounds of formula (VI):
[0832] (VI)
[0833] The method includes:
[0834] Reduction of cleavage compounds of form (II):
[0835] (II),
[0836] This produces the compound of formula (III):
[0837] (III).
[0838] This article also discloses a method for preparing compounds of formula (VI):
[0839] (VI)
[0840] The method includes:
[0841] Alkylation of the compound of formula (III):
[0842] (III),
[0843] This produces a compound of formula (IV):
[0844] (IV),
[0845] in
[0846] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0847] This article also discloses a method for preparing compounds of formula (VI):
[0848] (VI),
[0849] The method includes:
[0850] To deprotect the compound of formula (IV):
[0851] (IV),
[0852] This produces a compound of formula (V):
[0853] (V),
[0854] in
[0855] R 1It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0856] This article also discloses a method for preparing compounds of formula (VI):
[0857] (VI),
[0858] The method includes:
[0859] Protected (V) compounds:
[0860] (V),
[0861] This produces a compound of formula (VI).
[0862] in
[0863] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0864] This article also discloses a method for preparing compounds of formula (VI):
[0865] (VI),
[0866] The method includes:
[0867] Compounds with protected formula (I):
[0868] (I),
[0869] This produces the compound of formula (II):
[0870] (II),
[0871] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0872] (III),
[0873] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0874] (IV),
[0875] Deprotecting the compound of formula (IV) yields the compound of formula (V):
[0876] (V),
[0877] Protecting the compound of formula (V) yields the compound of formula (VI).
[0878] in
[0879] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0880] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0881] This article discloses a method for preparing compounds of formula (V):
[0882] (V),
[0883] The method includes:
[0884] Compounds with protected formula (I):
[0885] (I),
[0886] This produces the compound of formula (II):
[0887] (II),
[0888] in
[0889] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0890] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0891] This article also discloses a method for preparing compounds of formula (V):
[0892] (V),
[0893] The method includes:
[0894] Reduction of cleavage compounds of form (II):
[0895] (II),
[0896] This produces the compound of formula (III):
[0897] (III).
[0898] This article also discloses a method for preparing compounds of formula (V):
[0899] (V),
[0900] The method includes:
[0901] Alkylation of the compound of formula (III):
[0902] (III),
[0903] This produces a compound of formula (IV):
[0904] (IV),
[0905] in
[0906] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0907] This article also discloses a method for preparing compounds of formula (V):
[0908] (V),
[0909] The method includes:
[0910] To deprotect the compound of formula (IV):
[0911] (IV),
[0912] This produces a compound of formula (V).
[0913] in
[0914] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0915] This article also discloses a method for preparing compounds of formula (V):
[0916] (V),
[0917] The method includes:
[0918] Compounds with protected formula (I):
[0919] (I),
[0920] This produces the compound of formula (II):
[0921] (II),
[0922] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0923] (III),
[0924] Alkylation of the compound of formula (III) yields the compound of formula (IV):
[0925] (IV),
[0926] The compound of formula (IV) is deprotected to produce the compound of formula (V).
[0927] in
[0928] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0929] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0930] This article discloses a method for preparing compounds of formula (IV):
[0931] (IV),
[0932] The method includes:
[0933] Compounds with protected formula (I):
[0934] (I),
[0935] This produces the compound of formula (II):
[0936] (II),
[0937] in
[0938] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0939] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0940] This article also discloses a method for preparing compounds of formula (IV):
[0941] (IV),
[0942] The method includes:
[0943] Reduction of cleavage compounds of form (II):
[0944] (II),
[0945] This produces the compound of formula (III):
[0946] (III).
[0947] This article also discloses a method for preparing compounds of formula (IV):
[0948] (IV),
[0949] The method includes:
[0950] Alkylation of the compound of formula (III):
[0951] (III),
[0952] This produces a compound of formula (IV).
[0953] in
[0954] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[0955] This article also discloses a method for preparing compounds of formula (IV):
[0956] (IV),
[0957] The method includes:
[0958] Compounds with protected formula (I):
[0959] (I),
[0960] This produces the compound of formula (II):
[0961] (II),
[0962] The compound of formula (II) is reduced and cleaved to produce the compound of formula (III):
[0963] (III),
[0964] Alkylation of the compound of formula (III) yields the compound of formula (IV).
[0965] in
[0966] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0967] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0968] This article discloses a method for preparing compounds of formula (III):
[0969] (III),
[0970] The method includes:
[0971] Compounds with protected formula (I):
[0972] (I),
[0973] This produces the compound of formula (II):
[0974] (II),
[0975] in
[0976] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0977] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0978] This article also discloses a method for preparing compounds of formula (III):
[0979] (III),
[0980] The method includes:
[0981] Reduction of cleavage compounds of form (II):
[0982] (II),
[0983] This produces a compound of formula (III).
[0984] in
[0985] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0986] This article also discloses a method for preparing compounds of formula (III):
[0987] (III),
[0988] The method includes:
[0989] Compounds with protected formula (I):
[0990] (I),
[0991] This produces the compound of formula (II):
[0992] (II),
[0993] The reduction and cleavage of compound (II) yields compound (III).
[0994] in
[0995] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[0996] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[0997] This article discloses a method for preparing compounds of formula (II):
[0998] (II),
[0999] The method includes:
[1000] Compounds with protected formula (I):
[1001] (I),
[1002] This produces a compound of formula (II).
[1003] in
[1004] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[1005] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[1006] In any of the embodiments described herein, the manner or method includes:
[1007] Compounds with protected formula (I):
[1008] (I),
[1009] This produces the compound of formula (II):
[1010] (II),
[1011] in
[1012] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[1013] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[1014] In some embodiments, the protection of the compound of formula (I) involves contacting the compound of formula (I) with a first base.
[1015] In some embodiments, the first base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, hydride base, or hydroxide base. Exemplary carbonate bases include, but are not limited to, Li₂CO₃, Na₂CO₃, K₂CO₃, and Cs₂CO₃. Exemplary hydride bases include, but are not limited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the first base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the first base is NaH.
[1016] In some embodiments, the protecting compound of formula (I) includes reacting the compound of formula (I) with Bn-X. 1 Contact, in which X 1 It is a leaving group. Exemplary leaving groups include, but are not limited to, halogroups and sulfonates. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or –OTf. In some embodiments, X 1 It is a halogenated group. In some implementations, X 1 It is –Cl, –Br, or –I. In some implementations, X 1 Yes -Cl. In some implementations, X 1 Yes –Br. In some implementations, X 1 Yes – I. In some implementations, X 1 It is a sulfonate ester. In some embodiments, X 1It can be OTs, –OMs, or –OTf.
[1017] In some embodiments, protecting the compound of formula (I) involves contacting the compound of formula (I) with a first solvent. In some embodiments, the first solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the first solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the first solvent is acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the first solvent is tetrahydrofuran (THF).
[1018] In some embodiments, contacting the compound of formula (I) with the first solvent includes dissolving the compound of formula (I) in the first solvent.
[1019] In some embodiments, the compound of protective formula (I) includes raising the reaction temperature to reflux. In some embodiments, the compound of protective formula (I) includes raising the reaction temperature to above about 23°C (e.g., about 23°C, about 25°C, about 27°C, about 29°C, about 30°C, about 32°C, about 34°C, about 36°C, about 38°C, about 40°C, about 42°C, about 44°C, about 46°C, about 48°C, about 50°C, about 55°C, about 60°C, about 65°C, about 70°C, about 75°C, about 80°C, about 85°C, about 90°C, about 95°C, about 100°C, about 110°C, about 120°C, or about 130°C). In some embodiments, the compound of protective formula (I) includes raising the reaction temperature to about 50°C, about 55°C, about 60°C, about 65°C, about 70°C, or about 75°C. In some embodiments, the compound of protection formula (I) involves raising the reaction temperature to about 65°C.
[1020] In any of the embodiments described herein, the manner or method includes:
[1021] Reduction of cleavage compounds of form (II):
[1022] (II),
[1023] This produces the compound of formula (III):
[1024] (III),
[1025] in
[1026] R 1It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and
[1027] R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
[1028] In some embodiments, reducing and cracking the compound of formula (II) involves contacting the compound of formula (II) with an activator. In some embodiments, the activator comprises a trialkylsilyl cation. Exemplary alkyl groups of the trialkylsilyl cation include methyl, ethyl, and propyl groups. In some embodiments, the activator comprises a trimethylsilyl cation. In some embodiments, the activator comprises a leaving group (e.g., a halogroup or sulfonate). In some embodiments, the activator comprises a trimethylsilyl cation and a leaving group (e.g., a halogroup or sulfonate). Exemplary activators comprising a trimethylsilyl cation include, but are not limited to, trimethylsilyl chloride (TMCl) and trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activator is trimethylsilyl chloride (TMSCl) or trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activator is trimethylsilyl trifluoromethanesulfonate (TMSOTf).
[1029] In some embodiments, reducing and cracking the compound of formula (II) involves contacting the compound of formula (II) with a reducing agent. In some embodiments, the reducing agent is an organosilicon reducing agent. In some embodiments, the reducing agent is a silane. In some embodiments, the reducing agent is a trialkylsilane. Exemplary alkyl groups of trialkylsilanes include methyl, ethyl, and propyl groups. In some embodiments, the reducing agent is triethylsilane.
[1030] In some embodiments, reducing and cracking the compound of formula (II) involves contacting the compound of formula (II) with a second solvent. In some embodiments, the second solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1-dichloroethane, 1,2-dichloroethane, cis-1,2-dichloroethylene, trans-1,2-dichloroethylene, 1,2-dichloropropane, 1,1,1-trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the second solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the second solvent is dichloromethane (DCM) or 1,2-dichloroethane. In some embodiments, the second solvent is dichloromethane (DCM).
[1031] In some embodiments, contacting the compound of formula (II) with the second solvent includes dissolving the compound of formula (II) in the second solvent.
[1032] In some embodiments, the reductive cleavage (II) compound comprises reducing the reaction temperature to below about 0°C (e.g., about -40°C, about -38°C, about -36°C, about -34°C, about -32°C, about -30°C, about -28°C, about -26°C, about -24°C, about -22°C, about -20°C, about -18°C, about -16°C, about -14°C, about -12°C, about -10°C, about -8°C, about -6°C, about -4°C, or about -2°C). In some embodiments, the reductive cleavage (II) compound comprises reducing the reaction temperature to about -28°C, about -26°C, about -24°C, about -22°C, about -20°C, about -18°C, about -16°C, about -14°C, about -12°C, about -10°C, or about -8°C. In some embodiments, the reductive cleavage (II) compound comprises reducing the reaction temperature to about -18°C.
[1033] In any of the embodiments described herein, the manner or method includes:
[1034] Alkylation of the compound of formula (III):
[1035] (III),
[1036] This produces a compound of formula (IV):
[1037] (IV),
[1038] in
[1039] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[1040] In some embodiments, alkylating a compound of formula (III) involves contacting the compound of formula (III) with a second base. In some embodiments, the second base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, hydride base, or hydroxide base. Exemplary carbonate bases include, but are not limited to, Li₂CO₃, Na₂CO₃, K₂CO₃, and Cs₂CO₃. Exemplary hydride bases include, but are not limited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the second base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the second base is NaH.
[1041] In some embodiments, alkylating a compound of formula (III) involves contacting the compound of formula (III) with an alkylating agent. In some embodiments, the alkylating agent is R. 1 –X 2 , where X 2 It is a leaving group. Exemplary leaving groups include, but are not limited to, halogroups and sulfonates. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or –OTf. In some embodiments, X 2 It is a halogenated group. In some implementations, X 2 It is –Cl, –Br, or –I. In some implementations, X 2 Yes -Cl. In some implementations, X 2 Yes –Br. In some implementations, X 2 Yes – I. In some implementations, X 2 It is a sulfonate ester. In some embodiments, X 2 It can be OTs, –OMs, or –OTf.
[1042] In some embodiments, alkylating a compound of formula (III) involves contacting the compound of formula (III) with a third solvent. In some embodiments, the third solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the third solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the third solvent is acetonitrile, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the third solvent is tetrahydrofuran (THF).
[1043] In some embodiments, contacting the compound of formula (III) with a third solvent includes dissolving the compound of formula (III) in the third solvent.
[1044] In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to below about 10°C (e.g., about -40°C, about -38°C, about -36°C, about -34°C, about -32°C, about -30°C, about -28°C, about -26°C, about -24°C, about -22°C, about -20°C, about -18°C, about -16°C, about -14°C, about -12°C, about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to about -10°C to about 10°C (e.g., about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some embodiments, alkylating a compound of formula (III) involves lowering the reaction temperature to about 0°C.
[1045] In any of the embodiments described herein, the manner or method includes:
[1046] To deprotect the compound of formula (IV):
[1047] (IV),
[1048] This produces a compound of formula (V):
[1049] (V),
[1050] in
[1051] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[1052] In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with a first catalyst. In some embodiments, the first catalyst is a palladium catalyst. In some embodiments, the first catalyst is a palladium (0) catalyst. In some embodiments, the first catalyst is palladium on carbon. In some embodiments, the first catalyst is about 5% by weight palladium on carbon. In some embodiments, the first catalyst is about 10% by weight palladium on carbon.
[1053] In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with about 1 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 18 mol%, about 20 mol%, about 25 mol%, 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, or about 50 mol%. In some embodiments, deprotecting the compound of formula (IV) involves contacting the compound of formula (IV) with about 30 mol% of the first catalyst.
[1054] In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen gas. In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen gas at atmospheric pressure. In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen gas at about 0.9 atm, about 0.91 atm, about 0.92 atm, about 0.93 atm, about 0.94 atm, about 0.95 atm, about 0.96 atm, about 0.97 atm, about 0.98 atm, about 0.99 atm, about 1 atm, about 1.01 atm, about 1.02 atm, about 1.03 atm, about 1.04 atm, about 1.05 atm, about 1.06 atm, about 1.07 atm, about 1.08 atm, about 1.09 atm, or about 1.1 atm. In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen at about 1 atm. In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with hydrogen at a pressure of about 0.5 MPa to about 1.5 MPa (e.g., about 0.5 MPa, about 0.6 MPa, about 0.7 MPa, about 0.8 MPa, about 0.9 MPa, about 1.0 MPa, about 1.1 MPa, about 1.2 MPa, about 1.3 MPa, about 1.4 MPa, or about 1.5 MPa).
[1055] In some embodiments, deprotecting a compound of formula (IV) involves contacting the compound of formula (IV) with a fourth solvent. In some embodiments, the fourth solvent is a protic solvent. Exemplary protic solvents include, but are not limited to, alcohol solvents, such as methanol and ethanol. In some embodiments, the fourth solvent is methanol or ethanol. In some embodiments, the fourth solvent is methanol.
[1056] In some embodiments, contacting the compound of formula (IV) with the fourth solvent includes dissolving the compound of formula (IV) in the fourth solvent.
[1057] In some embodiments, deprotecting the compound of formula (IV) involves a reaction temperature of room temperature. In some embodiments, deprotecting the compound of formula (IV) involves a reaction temperature of ambient temperature. In some embodiments, deprotecting the compound of formula (IV) involves a reaction temperature of about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, or about 26°C. In some embodiments, deprotecting the compound of formula (IV) involves a reaction temperature of about 23°C.
[1058] In any of the embodiments described herein, the manner or method includes:
[1059] Protected (V) compounds:
[1060] (V),
[1061] This produces a compound of formula (VI):
[1062] (VI),
[1063] in
[1064] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[1065] In some embodiments, the compound of formula (V) comprises contacting the compound of formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6-dimethylpyridine (dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (dimethylpyridine).
[1066] In some embodiments, the protecting compound (V) involves contacting the compound of formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP).
[1067] In some embodiments, deprotecting the compound of formula (V) involves contacting the compound of formula (V) with about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, about 20 mol%, about 22 mol%, about 24 mol%, about 25 mol%, about 27 mol%, about 29 mol%, about 30 mol%, about 32 mol%, about 34 mol%, about 35 mol%, about 37 mol%, about 39 mol%, about 40 mol%, about 42 mol%, about 44 mol%, about 45 mol%, about 48 mol%, about 50 mol%, about 55 mol%, or about 60 mol%. In some embodiments, deprotecting the compound of formula (V) involves contacting the compound of formula (V) with about 50 mol% of the second catalyst.
[1068] In some embodiments, the protecting compound (V) comprises reacting a compound of formula (V) with DMT-X. 3 Contact, in which X 3 It is a leaving group. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or –OTf. In some embodiments, X 3 It is a halogenated group. In some implementations, X 3 It is –Cl, –Br, or –I. In some implementations, X 3 Yes –Cl. In some implementations, X 3 Yes –Br. In some implementations, X 3 Yes – I. In some implementations, X 3 It is a sulfonate ester. In some embodiments, X 3 It can be OTs, –OMs, or –OTf.
[1069] In some embodiments, the protective (V) compound comprises reducing the reaction temperature to below about 10°C (e.g., about -40°C, about -38°C, about -36°C, about -34°C, about -32°C, about -30°C, about -28°C, about -26°C, about -24°C, about -22°C, about -20°C, about -18°C, about -16°C, about -14°C, about -12°C, about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some embodiments, the protective (V) compound comprises reducing the reaction temperature to about -10°C to about 10°C (e.g., about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some implementations, the protected (V) compound involves lowering the reaction temperature to approximately 0°C.
[1070] In any of the embodiments described herein, the manner or method includes:
[1071] Install a phosphoramide group on the compound of formula (VI):
[1072] (VI),
[1073] This produces a compound of formula (A):
[1074] (A),
[1075] in
[1076] R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
[1077] In some embodiments, attaching a phosphoramidite group to the compound of formula (VI) includes contacting the compound of formula (VI) with a fourth base. In some embodiments, the fourth base is an organic base. In some embodiments, the fourth base is an amine base. In some embodiments, the fourth base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, 2,6-dimethylpyridine (dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the fourth base is triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA). In some embodiments, the fourth base is N,N-diisopropylethylamine (DIPEA).
[1078] In some embodiments, attaching a phosphoramidite group to a compound of formula (VI) includes contacting the compound of formula (VI) with a phosphoramidite reagent.
[1079] In some implementations, the phosphoramide reagent is , where X 5 It is a leaving group. Exemplary leaving groups include, but are not limited to, halogroups and sulfonates. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or –OTf. In some embodiments, X 5 It is a halogenated group. In some implementations, X 5 It is –Cl, –Br, or –I. In some implementations, X 5 Yes –Cl. In some implementations, X 5 Yes –Br. In some implementations, X 5 Yes – I. In some implementations, X 5 It is a sulfonate ester. In some embodiments, X 5 It is OTs, –OMs, or –OTf. In some embodiments, the phosphoramidite agent is 2-cyanoethyl N,N-diisopropylchlorophosphoramidite.
[1080] In some embodiments, attaching a phosphoramidite group to the compound of formula (VI) includes contacting the compound of formula (VI) with a fifth solvent. In some embodiments, the fifth solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1-dichloroethane, 1,2-dichloroethane, cis-1,2-dichloroethylene, trans-1,2-dichloroethylene, 1,2-dichloropropane, 1,1,1-trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the fifth solvent is dichloromethane (DCM) or 1,2-dichloroethane. In some embodiments, the fifth solvent is dichloromethane (DCM).
[1081] In some embodiments, contacting the compound of formula (V) with the fifth solvent includes dissolving the compound of formula (V) in the fifth solvent.
[1082] In some embodiments, attaching a phosphoramidite group to a compound of formula (VI) includes lowering the reaction temperature to below about 10°C (e.g., about -40°C, about -38°C, about -36°C, about -34°C, about -32°C, about -30°C, about -28°C, about -26°C, about -24°C, about -22°C, about -20°C, about -18°C, about -16°C, about -14°C, about -12°C, about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some embodiments, attaching a phosphorus amide group to a compound of formula (VI) includes lowering the reaction temperature to about -10°C to about 10°C (e.g., about -10°C, about -8°C, about -6°C, about -4°C, about -2°C, about 0°C, about 2°C, about 4°C, about 6°C, about 8°C, or about 10°C). In some embodiments, attaching a phosphorus amide group to a compound of formula (VI) includes lowering the reaction temperature to about 0°C.
[1083] Example
[1084] This disclosure is further illustrated by the following embodiments, which are provided for illustrative purposes only. These embodiments should not be construed as limiting the scope of this disclosure in any way.
[1085] Example 1. UNC13A antisense oligonucleotide
[1086] One or more spacer bases with the following structures were evaluated in human motor neurons (hMNs) derived from iPSCs:
[1087]
[1088] Several UNC13A antisense oligonucleotides were used. Cells were seeded at a density of 40,000 cells / well in 96-well plates. Antisense oligonucleotides targeting TDP43 (AON) were transfected with Endoporter (Gene Tools, Philomath, OR, USA) to reduce the expression of the full-length UNC13A transcript and increase the expression of the UNC13A cryptic exon. The mediator control consisted of motor neuron treatment using Endoporter alone. Positive controls included cells treated with TDP43 AON only (“AON TDP43” or “TDP43 AON”).
[1089] TDP43 AON is a gapmer oligonucleotide with the following sequence and chemical properties: (SEQ ID NO: 13) = Phosphothioester, underlined = DNA, others = 2'-MOE RNA; each "C" is 5-MeC.
[1090] To assess the ability of UNC13A AON to reduce the level of UNC13A cryptic exons, antisense oligonucleotides targeting UNC13A were co-incubated with TDP43 AON in an Endoporter in culture medium before being added to cells. After 72 hours, the antisense oligonucleotides and Endoporter were washed away, and the medium was replaced with fresh medium only. Six days later, RNA was collected from 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR targeting UNC13A cryptic exons was performed using TaqMan probes, followed by quantification using reference GAPDH.
[1091] Transcript levels (e.g., UNC13A cryptic exons and TDP43 transcripts) were detected using TaqMan via RT-qPCR. Specifically, RT-qPCR was performed using the Thermofisher® TaqMan gene expression assay Hs03929097_g1 to detect GAPDH. The UNC13a cryptic exon was detected using a custom sequence.
[1092] UNC13a hidden exon:
[1093] Forward primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 1)
[1094] Reverse primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 2)
[1095] Probe sequence: AGTTCTTTCCAGGAAACCCAGGCA (SEQ ID NO: 3)
[1096] To assess the ability of UNC13A AON to reduce the level of UNC13A correct splicing (CS) exon 20 / 21 junction, an antisense oligonucleotide targeting UNC13A was co-incubated with TDP43 AON in an Endoporter in culture medium before being added to cells. After 72 hours, the antisense oligonucleotide and Endoporter were washed away and replaced with fresh culture medium only. Six days later, RNA was collected from 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR targeting the UNC13A CS exon 20 / 21 junction was performed using TaqMan probes, followed by quantification using reference GAPDH.
[1097] Transcript levels (e.g., UNC13A exon 20 / 21 and TDP43 transcripts) were detected using TaqMan via RT-qPCR. Specifically, RT-qPCR was performed using the Thermofisher® TaqMan gene expression assay Hs03929097_g1 to detect GAPDH. The UNC13a exon 20 / 21 junction was detected using the TaqMan gene expression assay Hs01000584_m1.
[1098] RT-qPCR was performed on an Applied Biosystems® 7500 real-time PCR system. One reverse transcription cycle was performed at 50°C for 5 minutes. One RT inactivation / initial denaturation cycle was performed at 95°C for 20 seconds. Forty-five amplification cycles were performed, with a 1-second hold at 95°C followed by a 20-second hold at 60°C.
[1099] UNC13A-caching (Ct) was normalized using GAPDH (ΔCt). To visualize quantitative changes (e.g., a reduction in UNC13A-caching percentage), the normalized UNC13A-caching signal was further normalized using the mediator (treated with Endoporter only, ΔΔCt). The relative amount of transcript levels (RQ) was expressed using the equation RQ=2. -ΔΔCt The RQ values were calculated and used to describe the comparison between the treated condition and the normal health level (1.0). The RQ values for the UNC13A latent condition were normalized using the following formula:
[1100]
[1101] As shown in Tables 1, 2, and 3, the ability of UNC13A AONs (e.g., UNC13A oligonucleotides without spacers or with one or two spacers) to reduce UNC13A transcripts with cryptic exons was tested. In some cases, UNC13A AONs with spacers reduced the level of cryptic UNC13A exons. In some cases, UNC13A AONs without spacers reduced the level of cryptic UNC13A exons. Specific AON sequences were labeled according to their corresponding SEQ ID NO.
[1102] The correctly spliced UNC13A (Ct) is also normalized using GAPDH (ΔCt). To visualize quantitative changes (e.g., the increase in correctly spliced UNC13A %), the normalized correctly spliced UNC13A signal is further normalized using a medium (processed with Endoporter only, ΔΔCt).
[1103] The relative amount of transcript levels (RQ) was calculated using the equation RQ = 2^(-ΔΔCt) and used to describe the comparison between the treated condition and the normal healthy level (1.0). RQ values for correct UNC13A splicing were normalized using the following formula:
[1104]
[1105] Table 1. Exemplary UNC13A AONs evaluated in human-derived iPSC motor neurons
[1106] Table 1. Exemplary UNC13A AONs (including UNC13A oligonucleotides with spacers)
[1107]
[1108] *Unless otherwise stated, each nucleoside of the antisense oligonucleotides shown in Table 1 is a modified nucleoside with a 2'-O-(2-methoxyethyl)(2'-MOE) sugar moiety, each "C" is replaced by 5-methylcytosine (5-MeC), and all internucleotide bonds are phosphate thioester bonds.
[1109] The spacer group represented by S# is not a nucleoside. S# represents a spacer group with the following structure:
[1110] .
[1111] Table 2. Performance of exemplary UNC13A AONs evaluated in human-derived iPSC motor neurons.
[1112]
[1113] *Unless otherwise stated, each nucleoside of the antisense oligonucleotides shown in Table 2 is a modified nucleoside with a 2'-O-(2-methoxyethyl)(2'-MOE) sugar moiety, each "C" is replaced by 5-methylcytosine (5-MeC), and all internucleotide bonds are phosphate thioester bonds. Spacers indicated by S# are not nucleosides. S# represents a spacer with the following structure:
[1114] .
[1115] Table 3. Performance of exemplary UNC13A AONs evaluated in human-derived iPSC motor neurons.
[1116]
[1117] *Unless otherwise stated, each nucleoside of the antisense oligonucleotides shown in Table 2 is a modified nucleoside with a 2'-O-(2-methoxyethyl)(2'-MOE) sugar moiety, each "C" is replaced by 5-methylcytosine (5-MeC), and all internucleotide bonds are phosphate thioester bonds. Spacers indicated by S# are not nucleosides. S# represents a spacer with the following structure:
[1118] .
[1119] Example 2. Synthesis of the 2'-methoxy structural unit
[1120]
[1121] Step 1: Benzyl protection
[1122]
[1123] ((3aR,5R,6R,6aR)-6-(benzyloxy)-5-((benzyloxy)methyl)-2,2-dimethyltetrahydrofurano[2,3-d][1,3]dioxacyclopentene(2)
[1124] Sodium hydride (60% dispersion in mineral oil, 5.77 g, 144 mmol) was added to a solution of 1,2-O-isopropylidene-D-ribofuranoside (8.00 g, 41.2 mmol) in THF (240 mL), and the mixture was stirred at room temperature for 10 min. Benzyl bromide (32.5 mL, 268 mmol) was then added, and the reaction was stirred at room temperature for 10 min, followed by stirring at 65 °C for 8 h. TLC showed complete consumption of the starting material. The reaction was then quenched with a saturated aqueous solution of ammonium chloride and extracted with ethyl acetate (x3). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by silica gel column chromatography (5–65% ethyl acetate in hexane solution) to give compound 2 (15.0 g, 98% yield) as a pale yellow oil. 22 H 26 The calculated mass of O5 is 370.18; the measured mass is 388.3 (M+NH4). + .
[1125] 1 H NMR (400 MHz, CDCl3): δ 7.37 – 7.23 (m, 10H), 5.75 (d, J = 3.7 Hz, 1H), 4.73 (d, J= 12.0 Hz, 1H), 4.59 – 4.46 (m, 4H), 4.18 (ddd, J = 9.1, 3.8,2.1 Hz, 1H), 3.86 (dd, J = 9.1, 4.4 Hz, 1H), 3.76 (dd, J = 11.2, 2.0 Hz, 1H), 3.56 (dd, J = 11.2, 3.9 Hz, 1H), 1.59 (s, 3H), 1.36 (s, 3H).
[1126] LCMS: CSH C18 AMB (3 minutes): R T = 1.73 minutes.
[1127] Step 2: Cleavage of reduced acetone
[1128]
[1129] (3S,4S,5R)-4-(benzyloxy)-5-((benzyloxy)methyl)tetrahydrofuran-3-ol(3)
[1130] Triethylsilane (6.97 mL, 43.2 mmol) was added to a solution of compound 2 (1.00 g, 2.70 mmol) in anhydrous dichloromethane (13 mL), and the mixture was cooled to -18 °C. Trimethylsilyl trifluoromethanesulfonate (5.92 mL, 32.4 mmol) was then added dropwise, and the reaction was stirred at -18 °C for 3 h. TLC showed complete consumption of the starting material. The reaction was then quenched with a saturated aqueous sodium bicarbonate solution and extracted with dichloromethane (x2). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by silica gel column chromatography (10–60% ethyl acetate in heptane) to give compound 3 (665 mg, 78% yield) as a colorless oil. 19 H 22 The calculated mass of O4 is 314.15; the measured mass is 332.0 (M+NH4). + .
[1131] 1H NMR (400 MHz, CDCl3): δ 7.38 – 7.26 (m, 10H), 4.61 – 4.47 (m, 4H), 4.26 – 4.19 (m, 1H), 4.08 – 4.01 (m, 2H), 3.99 – 3.94 (m, 1H), 3.79 (dd, J =9.7, 4.0 Hz, 1H), 3.60 (dd, J = 10.5, 3.7 Hz, 1H), 3.51 (dd, J = 10.5, 4.3Hz, 1H), 2.67 (br s, 1H).
[1132] LCMS: CSH C18 AmF (3 minutes): R T = 1.42 minutes.
[1133] Step 3: Alkylation
[1134]
[1135] (2R,3S,4S)-3-(benzyloxy)-2-((benzyloxy)methyl)-4-methoxytetrahydrofuran(4)
[1136] Sodium hydride (60% dispersion in mineral oil, 127 mg, 3.17 mmol) was added to a solution of compound 3 (332 mg, 1.06 mmol) in THF (6.64 mL) at room temperature, and the mixture was stirred for 10 min. The mixture was then cooled to 0 °C, and iodomethane (66.4 µL, 1.06 mmol) was added to the reaction mixture. The temperature was then allowed to slowly reach room temperature, and the reaction was continued for 3 h. LCMS showed complete consumption of the starting material. The reaction was then quenched with saturated ammonium chloride aqueous solution and extracted with ethyl acetate (x 2). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by reversed-phase column chromatography (10 mM ammonium formate aqueous buffer in 10–50% acetonitrile) to give compound 4 (264 mg, 76% yield) as a colorless oil. 22 H 27 The calculated mass of NO5 is 328.40; the measured mass is 346.0 (M+NH4). + Note: Some starting material compound 3 was also recovered during the purification process.
[1137] 1H NMR (400 MHz, CDCl3): δ 7.37 – 7.26 (m, 10H), 4.61 (app dd, J =38.0, 12.0 Hz, 2H), 4.54 (app dd, J = 28.9, 12.0 Hz, 2H), 4.12 – 4.07 (m,1H), 3.99 (dd, J = 9.7, 4.7 Hz, 1H), 3.97 – 3.89 (m, 2H), 3.81 (m, 1H), 3.63(dd, J = 10.7, 3.3 Hz, 1H), 3.51 (dd, J = 10.7, 4.3 Hz, 1H), 3.40 (s, 3H).
[1138] LCMS: CSH C18 AmF (3 minutes): R T = 1.57 minutes.
[1139] Step 4: Hydrogenolysis
[1140]
[1141] (2R,3S,4S)-2-(hydroxymethyl)-4-methoxytetrahydrofuran-3-ol(5)
[1142] Pd / C (257 mg, 241 µmol) was added to a degassed and nitrogen-backfilled (x 3) solution of compound 4 in methanol (2.07 mL), and the mixture was stirred at room temperature under a hydrogen atmosphere (balloon) for 16 hours. LC-MS and TLC showed complete consumption of the starting material. The reaction mixture was then purged with nitrogen and filtered through a celite pad, washed with methanol. The filtrate was concentrated under vacuum to give compound 5 (118 mg). The crude product was used for the next step without further purification.
[1143] 1 H NMR (400 MHz, CDCl3): δ 4.14 – 4.07 (m, 1H), 4.04 (dd, J = 9.8, 4.6Hz, 1H), 3.91 – 3.81 (m, 3H), 3.80 – 3.74 (m, 1H), 3.71 – 3.63 (m, 1H), 3.45(s, 3H), 2.67 (d,J = 8.1 Hz, 1H), 1.89 (dd, J = 7.7, 4.9 Hz, 1H).
[1144] Step 5: DMT Protection
[1145]
[1146] (2R,3S,4S)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-methoxytetrahydrofuran-3-ol(6)
[1147] At 0 °C, 4-dimethylaminopyridine (49.1 mg, 398 µmol) was added to a suspension of compound 5 (118 mg, 796 µmol) and 4 Å molecular sieve (17 mg) in dimethylpyridine (3.27 mL) and dichloromethane (1.63 mL), followed by the addition of a solution of 4,4′-dimethoxytriphenylmethyl chloride (358 mg, 1.04 mmol) in dichloromethane (1.5 mL). The temperature was allowed to slowly reach room temperature, and the reaction was stirred for 2 hours. LCMS and TLC showed that the reaction was complete, so heptane (2 mL) and methanol (2 mL) were added, and the mixture was concentrated under vacuum. The residue was then dissolved in ethyl acetate, washed with saturated aqueous copper sulfate solution (x2), washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude residue was purified by silica gel column chromatography (50–100% ethyl acetate in heptane) to give compound 6 (220 mg, 59% yield, in two steps) as a pale yellow oil. 29 H 33 The calculated mass of NO7 is 450.52; the measured mass is 472.8 (M+Na). + .
[1148] 1 H NMR (400 MHz, CDCl3): δ 7.47 – 7.42 (m, 2H), 7.36 – 7.31 (m, 4H), 7.31 – 7.27 (m, 2H), 7.23 – 7.15 (m, 1H), 6.85 – 6.79 (m, 4H), 4.15 – 4.08(m, 2H), 3.96 – 3.86 (m, 3H), 3.79 (s, 6H), 3.45 (s, 3H), 3.31 (dd, J = 10.1, 3.5 Hz, 1H), 3.13 (dd, J= 10.1, 4.8 Hz, 1H), 2.63 (d, J = 6.9 Hz, 1H).
[1149] LCMS: CSH C18 AmB (3 minutes): R T = 1.66 minutes.
[1150] Step 6: Phosphite Installation
[1151]
[1152] (2R,3S,4S)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-methoxytetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphonamide (7)
[1153] Add to the suspension of compound 6 (220 mg, 488 µmol) in anhydrous dichloromethane (5.29 mL) N, N 1,2-Diisopropylethylamine (743 µL, 4.24 mmol) was added, and the resulting solution was cooled to 0 °C under a nitrogen atmosphere. Then, 2-cyanoethyl... N,N -Diisopropylphosphonamide (229 µL, 977 µmol) was added, and the resulting solution was brought to room temperature and stirred for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was then cooled to 0 °C, diluted with dichloromethane, washed with cold saturated sodium bicarbonate aqueous solution, washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was then purified by silica gel column chromatography (5% triethylamine in ethyl acetate and hexane solution, 5-80%), and lyophilized to give compound 7 ((2 R ,3 S 4 S )-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-methoxytetrahydrofuran-3-yl(2-cyanoethyl)diisopropylphosphonamide) (100 mg, 31% yield), is a colorless oil (a mixture of diastereomers at PIII). C 36 H 47 The calculated mass of N₂O₇P is 650.31; the measured mass is 651.5 (M+H). + .
[1154] 1¹H NMR (400 MHz, DMSO-d6) (mixture of diastereomers): δ 7.46 – 7.38 (m, 2H), 7.34 – 7.24 (m, 6H), 7.24 – 7.17 (m, 1H), 6.93 – 6.84 (m, 4H), 4.27 – 4.11 (m, 1H), 4.03 – 3.92 (m, 2H), 3.92 – 3.84 (m, 1H), 3.82 – 3.74 (m, 2H), 3.74 – 3.71 (m, 6H), 3.59 – 3.42 (m, 3H), 3.40 – 3.30 (m, 3H), 3.27 – 3.16 (m, 1H), 2.97 (td, J = 9.7, 5.2 Hz, 1H), 2.76 (t, J = 5.7 Hz, 1H), 2.55 (t, J = 5.9 Hz, 1H), 1.17 – 1.04 (m, 9H), 0.93 (d, J = 6.7 Hz, 3H).
[1155] 31 P NMR (162 MHz, DMSO-d6) (a mixture of diastereomers): δ 149.23, 149.11.
[1156] LCMS (a mixture of diastereomers): CSH C18 AMB (3 minutes): R T = 2.14 and 2.15 minutes.
[1157] Example 3. Synthesis of 2'-MOE structural units
[1158]
[1159] Step 1: Benzyl protection
[1160]
[1161] ((3aR,5R,6R,6aR)-6-(benzyloxy)-5-((benzyloxy)methyl)-2,2-dimethyltetrahydrofurano[2,3-d][1,3]dioxacyclopentene(2)
[1162] Sodium hydride (60% dispersion in mineral oil, 5.77 g, 144 mmol) was added to a solution of 1,2-O-isopropylidene-D-ribofuranoside (8.00 g, 41.2 mmol) in THF (240 mL), and the mixture was stirred at room temperature for 10 min. Benzyl bromide (32.5 mL, 268 mmol) was then added, and the reaction was stirred at room temperature for 10 min, followed by stirring at 65 °C for 8 h. TLC showed complete consumption of the starting material. The reaction was then quenched with a saturated aqueous solution of ammonium chloride and extracted with ethyl acetate (x3). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by silica gel column chromatography (5–65% ethyl acetate in hexane solution) to give compound 2 (15.0 g, 98% yield) as a pale yellow oil. 22 H 26 The calculated mass of O5 is 370.18; the measured mass is 388.3 (M+NH4). + .
[1163] 1 H NMR (400 MHz, CDCl3): δ 7.37 – 7.23 (m, 10H), 5.75 (d, J = 3.7 Hz, 1H), 4.73 (d, J = 12.0 Hz, 1H), 4.59 – 4.46 (m, 4H), 4.18 (ddd, J = 9.1, 3.8,2.1 Hz, 1H), 3.86 (dd, J = 9.1, 4.4 Hz, 1H), 3.76 (dd, J = 11.2, 2.0 Hz, 1H), 3.56 (dd, J = 11.2, 3.9 Hz, 1H), 1.59 (s, 3H), 1.36 (s, 3H).
[1164] LCMS: CSH C18 AMB (3 minutes): R T = 1.73 minutes.
[1165] Step 2: Cleavage of reduced acetone
[1166]
[1167] (3S,4S,5R)-4-(benzyloxy)-5-((benzyloxy)methyl)tetrahydrofuran-3-ol(3)
[1168] Triethylsilane (6.97 mL, 43.2 mmol) was added to a solution of compound 2 (1.00 g, 2.70 mmol) in anhydrous dichloromethane (13 mL), and the mixture was cooled to -18 °C. Trimethylsilyl trifluoromethanesulfonate (5.92 mL, 32.4 mmol) was then added dropwise, and the reaction was stirred at -18 °C for 3 h. TLC showed complete consumption of the starting material. The reaction was then quenched with a saturated aqueous sodium bicarbonate solution and extracted with dichloromethane (x2). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by silica gel column chromatography (10–60% ethyl acetate in heptane) to give compound 3 (665 mg, 78% yield) as a colorless oil. 19 H 22 The calculated mass of O4 is 314.15; the measured mass is 332.0 (M+NH4). + .
[1169] 1 H NMR (400 MHz, CDCl3): δ 7.38 – 7.26 (m, 10H), 4.61 – 4.47 (m, 4H), 4.26 – 4.19 (m, 1H), 4.08 – 4.01 (m, 2H), 3.99 – 3.94 (m, 1H), 3.79 (dd, J =9.7, 4.0 Hz, 1H), 3.60 (dd, J = 10.5, 3.7 Hz, 1H), 3.51 (dd, J = 10.5, 4.3Hz, 1H), 2.67 (br s, 1H).
[1170] LCMS: CSH C18 AmF (3 minutes): R T = 1.42 minutes.
[1171] Step 3: Alkylation
[1172]
[1173] (2R,3S,4S)-3-(benzyloxy)-2-((benzyloxy)methyl)-4-(2-methoxyethoxy)tetrahydrofuran(4)
[1174] Sodium hydride (60% dispersion in mineral oil, 127 mg, 3.17 mmol) was added to a solution of compound 3 (332 mg, 1.06 mmol) in THF (6.64 mL) at room temperature, and the mixture was stirred for 10 min. The mixture was then cooled to 0 °C, and 2-bromoethyl methyl ether (205 µL, 2.11 mmol) was added to the reaction mixture. The reaction mixture was then heated to room temperature and monitored by LCMS and TLC. After a period of time, no reaction was observed, so the reaction mixture was heated to 40 °C and monitored by LCMS. Heating was continued overnight at 40 °C. At this point (reaction time = 19 h), LCMS indicated a desired product conversion of 60%, with the remaining 40% being the starting material. The temperature was increased to 60 °C, and the reaction was monitored by LCMS. Impurities were generated after 2 hours, so the reaction was stopped and cooled to room temperature. The mixture was then quenched with a saturated aqueous ammonium chloride solution and extracted with ethyl acetate (x 2). The organic layer was further washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude product was purified by reversed-phase column chromatography (10-75% acetonitrile in 10 mM ammonium formate aqueous buffer) to give compound 4 (250 mg, 64% yield) as a colorless oil. 22 H 28 The calculated mass of O5 is 372.45; the measured mass is 372.9 (M+H). + Note: 100 mg (30%) of starting material compound 3 was also recovered during the purification process.
[1175] 1 H NMR (400 MHz, CDCl3): δ 7.36 – 7.27 (m, 10H), 4.61 (app dd, J =49.3, 11.9 Hz, 2H), 4.54 (app q, J = 12.1 Hz, 2H), 4.15 – 4.09 (m, 1H), 4.06 – 4.00 (m, 2H), 3.95 – 3.89 (m, 2H), 3.70 – 3.59 (m, 3H), 3.59 – 3.55 (m, 2H), 3.51 (dd, J = 10.6, 4.4 Hz, 1H), 3.38 (s, 3H).
[1176] LCMS: CSH C18 AmF (3 minutes): R T = 1.58 minutes.
[1177] Step 4: Hydrogenolysis
[1178]
[1179] (2R,3R,4S)-2-(hydroxymethyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol(5)
[1180] Pd / C (71.4 mg, 67.1 µmol) was added to a degassed and nitrogen-backfilled (x 3) solution of compound 4 in methanol (1.72 mL), and the mixture was stirred at room temperature under a hydrogen atmosphere (balloon) for 16 hours. LCMS and TLC showed incomplete conversion, so additional Pd / C (150 mg, 141 µmol) was added, and the mixture was stirred overnight under a hydrogen atmosphere. LCMS and TLC showed complete conversion, so the reaction mixture was purged with nitrogen and filtered through a diatomaceous earth pad, washed with methanol. The filtrate was concentrated under vacuum to give compound 5 (125 mg, 97% yield). The crude product was used for the next step without further purification.
[1181] 1 H NMR (400 MHz, CDCl3): δ 4.12 – 4.01 (m, 2H), 4.01 – 3.92 (m, 1H), 3.89 – 3.76 (m, 4H), 3.73 – 3.62 (m, 2H), 3.62 – 3.49 (m, 2H), 3.49 – 3.40 (m, 2H), 3.40 – 3.31 (m, 3H).
[1182] Step 5: DMT Protection
[1183]
[1184] (2R,3S,4S)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-(2-methoxyethoxy)tetrahydrofuran-3-ol(6)
[1185] At 0 °C, 4-dimethylaminopyridine (40.1 mg, 325 µmol) was added to a suspension of compound 5 (125 mg, 650 µmol) and 4 Å molecular sieve (17 mg) in dimethylpyridine (2.67 mL) and dichloromethane (1.33 mL), followed by the addition of a solution of 4,4′-dimethoxytriphenylmethyl chloride (292 mg, 845 µmol) in dichloromethane (1 mL). The temperature was allowed to slowly reach room temperature, and the reaction was stirred for 2 hours. LCMS and TLC showed that the reaction was complete, so heptane (2 mL) and methanol (2 mL) were added, and the mixture was concentrated under vacuum. The residue was then dissolved in ethyl acetate, washed with saturated aqueous copper sulfate solution (x2), washed with brine, dried over sodium sulfate, and concentrated under vacuum. The crude residue was purified by silica gel column chromatography (0-20% acetone in a heptane solution containing 30% MeOH) to give compound 6 (160 mg, 48% yield) as a pale yellow oil. 29 H 34 The calculated mass of O7 is 494.58; the measured mass is 516.7 (M+Na). + .
[1186] 1 H NMR (400 MHz, CDCl3): δ 7.46 – 7.43 (m, 2H), 7.36 – 7.31 (m, 4H), 7.30 – 7.27 (m, 2H), 7.22 – 7.16 (m, 1H), 6.84 – 6.80 (m, 4H), 4.18 – 4.12(m, 1H), 4.11 – 4.06 (m, 2H), 4.00 – 3.95 (m, 1H), 3.88 – 3.81 (m, 2H), 3.79(s, 6H), 3.71 – 3.64 (m, 1H), 3.62 – 3.56 (m, 1H), 3.55 – 3.49 (m, 1H), 3.40(s, 3H), 3.33 – 3.27 (m, 2H), 3.10 (dd, J = 10.1, 4.7 Hz, 1H).
[1187] LCMS: CSH C18 AmF (3 minutes): R T = 1.68 minutes.
[1188] By incorporating references
[1189] All publications and patents mentioned herein are incorporated herein by reference in their entirety for all purposes, just as each individual publication or patent is specifically and individually incorporated by reference. In the event of any conflict, this specification, including any definitions herein, shall prevail.
[1190] Equivalent Case
[1191] While specific embodiments of this disclosure have been discussed, the foregoing description is exemplary only and not restrictive. Many variations of this disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of this disclosure should be determined by reference to the full scope of the claims and their equivalents, the description, and such variations.
[1192] Those skilled in the art will recognize or be able to determine that many equivalents of the specific embodiments described herein can be achieved using only at most conventional experiments. Such equivalents are intended to be within the scope of the following claims.
Claims
1. A method for preparing a compound of formula (A): (A) The method includes: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
2. The method of claim 1, wherein the method further comprises: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
3. The method of claim 1 or 2, wherein the method further comprises: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
4. The method of any one of claims 1-3, wherein the method further comprises: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
5. The method of any one of claims 1-4, wherein the method further comprises: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
6. The method of any one of claims 1-5, wherein the method further comprises: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A): (A), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
7. A method for preparing a compound of formula (A): (A) The method includes: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
8. The method of claim 7, wherein the method further comprises: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
9. The method of claim 7 or 8, wherein the method further comprises: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
10. The method of any one of claims 7-9, wherein the method further comprises: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
11. The method of any one of claims 7-10, wherein the method further comprises: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A): (A), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
12. The method of any one of claims 7-11, wherein the method further comprises: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
13. A method for preparing a compound of formula (A): (A) The method includes: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
14. The method of claim 13, wherein the method further comprises: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
15. The method of claim 13 or 14, wherein the method further comprises: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
16. The method of any one of claims 13-15, wherein the method further comprises: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A): (A), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
17. The method of any one of claims 13-16, wherein the method further comprises: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
18. The method of any one of claims 13-17, wherein the method further comprises: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
19. A method for preparing a compound of formula (A): (A) The method includes: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
20. The method of claim 19, wherein the method further comprises: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
21. The method of claim 19 or 20, wherein the method further comprises: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A): (A), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
22. The method of any one of claims 19-21, wherein the method further comprises: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
23. The method of any one of claims 19-22, wherein the method further comprises: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
24. The method of any one of claims 19-23, wherein the method further comprises: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
25. A method for preparing a compound of formula (A): (A) The method includes: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
26. The method of claim 25, wherein the method further comprises: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A): (A)。 27. The method of claim 25 or 26, wherein the method further comprises: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
28. The method of any one of claims 25-27, wherein the method further comprises: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
29. The method of any one of claims 25-28, wherein the method further comprises: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
30. The method of any one of claims 25-29, wherein the method further comprises: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
31. A method for preparing a compound of formula (A): (A) The method includes: Install a phosphoramide group on the compound of formula (VI): (WE), This produces a compound of formula (A). in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
32. The method of claim 31, wherein the method further comprises: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
33. The method of claim 31 or 32, wherein the method further comprises: Reduction of cleavage compounds of form (II): (II), This produces the compound of formula (III): (III), in R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
34. The method of any one of claims 31-33, wherein the method further comprises: Alkylation of the compound of formula (III): (III), This produces a compound of formula (IV): (IV), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
35. The method of any one of claims 31-34, wherein the method further comprises: To deprotect the compound of formula (IV): (IV), This produces a compound of formula (V): (V), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
36. The method of any one of claims 31-35, wherein the method further comprises: Protected (V) compounds: (V), This produces a compound of formula (VI): (WE), in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
37. A method for preparing a compound of formula (A): (A) The method includes: Compounds with protected formula (I): (I), This produces the compound of formula (II): (II), The compound of formula (II) is reduced and cleaved to produce the compound of formula (III): (III), Alkylation of the compound of formula (III) yields the compound of formula (IV): (IV), Deprotecting the compound of formula (IV) yields the compound of formula (V): (V), Protecting the compound of formula (V) yields the compound of formula (VI): (WE), By attaching a phosphoramide group to the compound of formula (VI), a compound of formula (A) is produced. in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3; and R 2 and R 3 Each is independently an H or C1-C6 alkyl group.
38. A method for preparing a splice-conversion oligonucleotide comprising one or more spacer groups, the method comprising any one of the methods of claims 1-22.
39. A method for preparing splice-conversion oligonucleotides containing one or more spacer groups of formula (B): (B), It includes any one of the methods described in claims 1-22. in Each The symbol represents the connection point between the nucleoside and the nucleotide.
40. The method according to any one of claims 1-39, wherein the compound of protection formula (I) comprises contacting the compound of formula (I) with a first base.
41. The method of claim 40, wherein the first base is an inorganic base.
42. The method of claim 40, wherein the first base is a hydride base.
43. The method of claim 40, wherein the first base is NaH.
44. The method according to any one of claims 1-43, wherein the compound of protecting formula (I) comprises reacting the compound of formula (I) with Bn-X 1 Contact, in which X 1 It is a leaving group.
45. The method of claim 44, wherein X 1 It is a halogenated group.
46. The method of claim 44, wherein X 1 It is –Cl, –Br, or –I.
47. The method of claim 44, wherein X 1 Yes –Br.
48. The method of any one of claims 1-47, wherein protecting the compound of formula (I) involves contacting the compound of formula (I) with a first alkaline solvent.
49. The method of claim 48, wherein the first solvent is a polar solvent.
50. The method of claim 48, wherein the first solvent is tetrahydrofuran (THF).
51. The method of any one of claims 1-49, wherein the compound of protective formula (I) comprises raising the reaction temperature to reflux.
52. The method according to any one of claims 1-49, wherein the compound of protective formula (I) comprises raising the reaction temperature to about 65°C.
53. The method according to any one of claims 1-52, wherein reducing the cleavage of the compound of formula (II) comprises contacting the compound of formula (II) with an activator.
54. The method of claim 53, wherein the activator comprises a trialkylsilyl cation.
55. The method of claim 53, wherein the activator comprises a trimethylsilyl cation.
56. The method of claim 53, wherein the activator is trimethylsilyl trifluoromethanesulfonate (TMSOTf).
57. The method of any one of claims 1-56, wherein reducing the cleavage of the compound of formula (II) comprises contacting the compound of formula (II) with a reducing agent.
58. The method of claim 57, wherein the reducing agent is an organosilyl reducing agent.
59. The method of claim 57, wherein the reducing agent is a trialkylsilane.
60. The method of claim 57, wherein the reducing agent is triethylsilane.
61. The method of any one of claims 1-60, wherein reducing the cleavage of the compound of formula (II) comprises contacting the compound of formula (II) with a second solvent.
62. The method of claim 61, wherein the second solvent is a halogenated solvent.
63. The method of claim 61, wherein the second solvent is dichloromethane (DCM) or dichloroethane (DCE).
64. The method of claim 61, wherein the second solvent is dichloromethane (DCM).
65. The method of any one of claims 1-64, wherein reducing the cleavage compound of formula (II) comprises lowering the reaction temperature to below about 0°C.
66. The method of any one of claims 1-64, wherein reducing the cleavage compound of formula (II) comprises lowering the reaction temperature to about -18°C.
67. The method of any one of claims 1-66, wherein alkylating the compound of formula (III) comprises contacting the compound of formula (III) with a second base.
68. The method of claim 67, wherein the second base is an inorganic base.
69. The method of claim 67, wherein the second base is a hydride base.
70. The method of claim 67, wherein the second base is NaH.
71. The method of any one of claims 1-70, wherein alkylating a compound of formula (III) comprises contacting the compound of formula (III) with an alkylating agent.
72. The method of claim 71, wherein the alkylating agent is R 1 –X 2 , where X 2 It is a leaving group.
73. The method of claim 71, wherein X 2 It is a halogenated group.
74. The method of claim 71, wherein X 2 It is –Cl, –Br, or –I.
75. The method of claim 71, wherein X 2 Yes –Br.
76. The method of claim 71, wherein X 2 Yes-I.
77. The method of any one of claims 1-76, wherein alkylating a compound of formula (III) comprises contacting the compound of formula (III) with a third solvent.
78. The method of claim 77, wherein the third solvent is a polar solvent.
79. The method of claim 77, wherein the third solvent is tetrahydrofuran (THF).
80. The method of any one of claims 1-79, wherein alkylating the compound of formula (III) comprises lowering the reaction temperature to below about 10°C.
81. The method of any one of claims 1-79, wherein alkylating the compound of formula (III) comprises lowering the reaction temperature to about -10°C to about 10°C.
82. The method of any one of claims 1-79, wherein alkylating the compound of formula (III) comprises lowering the reaction temperature to about 0°C.
83. The method of any one of claims 1-82, wherein deprotecting the compound of formula (IV) comprises contacting the compound of formula (IV) with a first catalyst.
84. The method of claim 83, wherein the first catalyst is a palladium catalyst.
85. The method of claim 83, wherein the first catalyst is a palladium (0) catalyst.
86. The method of claim 83, wherein the first catalyst is palladium on carbon.
87. The method of claim 83, wherein the first catalyst is about 5% by weight palladium on carbon.
88. The method of claim 83, wherein the first catalyst is about 10% by weight palladium on carbon.
89. The method of claim 83, wherein deprotecting the compound of formula (IV) comprises contacting the compound of formula (IV) with about 30 mol% of a first catalyst.
90. The method of any one of claims 1-89, wherein deprotecting the compound of formula (IV) comprises contacting the compound of formula (IV) with hydrogen gas.
91. The method of claim 90, wherein deprotecting the compound of formula (IV) comprises contacting the compound of formula (IV) with hydrogen at atmospheric pressure.
92. The method according to any one of claims 1-91, wherein deprotecting the compound of formula (IV) comprises contacting the compound of formula (IV) with a fourth solvent.
93. The method of claim 92, wherein the fourth solvent is a proton solvent.
94. The method of claim 92, wherein the fourth solvent is methanol or ethanol.
95. The method of claim 92, wherein the fourth solvent is methanol.
96. The method of any one of claims 1-95, wherein deprotecting the compound of (IV) comprises a reaction temperature of about 23°C.
97. The method according to any one of claims 1-96, wherein the compound of protecting formula (V) comprises contacting the compound of formula (V) with a third base.
98. The method of claim 97, wherein the third base is an organic base.
99. The method of claim 97, wherein the third base is an amine base.
100. The method of claim 97, wherein the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine.
101. The method of claim 97, wherein the third base is pyridine, dialkylpyridine, or trialkylpyridine.
102. The method of claim 97, wherein the third base is pyridine, 2,6-dimethylpyridine (dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine.
103. The method of claim 97, wherein the third base is 2,6-dimethylpyridine (dimethylpyridine).
104. The method according to any one of claims 1-103, wherein the compound of protection formula (V) comprises contacting the compound of formula (V) with a second catalyst.
105. The method of claim 104, wherein the second catalyst is an organic catalyst.
106. The method of claim 104, wherein the second catalyst is an amine catalyst.
107. The method of claim 104, wherein the second catalyst is 4-dimethylaminopyridine (DMAP).
108. The method of claim 104, wherein the compound of protection formula (V) comprises contacting the compound of formula (V) with about 50 mol% of a second catalyst.
109. The method according to any one of claims 1-108, wherein the compound of protecting formula (V) comprises reacting the compound of formula (V) with DMT-X. 3 Contact, in which X 3 It is a leaving group.
110. The method of claim 109, wherein X 3 It is a halogenated group.
111. The method of claim 109, wherein X 3 It is –Cl, –Br, or –I.
112. The method of claim 109, wherein X 3 It is –Cl.
113. The method according to any one of claims 1-112, wherein the compound protecting (V) comprises lowering the reaction temperature to below about 10°C.
114. The method according to any one of claims 1-112, wherein the compound protecting (V) comprises lowering the reaction temperature to about -10°C to about 10°C.
115. The method of any one of claims 1-112, wherein the compound protecting (V) comprises lowering the reaction temperature to about 0°C.
116. The method according to any one of claims 1-115, wherein the compound of protecting formula (V) comprises contacting the compound of formula (V) with a third base.
117. The method of claim 116, wherein the third base is an organic base.
118. The method of claim 116, wherein the third base is an amine base.
119. The method of claim 116, wherein the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine.
120. The method of claim 116, wherein the third base is pyridine, dialkylpyridine, or trialkylpyridine.
121. The method of claim 116, wherein the third base is pyridine, 2,6-dimethylpyridine (dimethylpyridine), 2,4,6-trimethylpyridine, 2,6-diisopropylpyridine, or 2,6-di-tert-butylpyridine.
122. The method of claim 116, wherein the third base is 2,6-dimethylpyridine (dimethylpyridine).
123. The method according to any one of claims 1-122, wherein the compound of protection formula (V) comprises contacting the compound of formula (V) with a second catalyst.
124. The method of claim 123, wherein the second catalyst is an organic catalyst.
125. The method of claim 123, wherein the second catalyst is an amine catalyst.
126. The method of claim 123, wherein the second catalyst is 4-dimethylaminopyridine (DMAP).
127. The method of claim 123, wherein deprotecting the compound of formula (V) comprises contacting the compound of formula (V) with about 50 mol% of a second catalyst.
128. The method of any one of claims 1-127, wherein attaching a phosphoramidite group to the compound of formula (VI) comprises contacting the compound of formula (VI) with a fourth base.
129. The method of claim 128, wherein the fourth base is an organic base.
130. The method of claim 128, wherein the fourth base is an amine base.
131. The method of claim 128, wherein the fourth base is triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA).
132. The method of claim 128, wherein the fourth base is N,N-diisopropylethylamine (DIPEA).
133. The method according to any one of claims 1-132, wherein attaching a phosphoramidite group to the compound of formula (VI) comprises contacting the compound of formula (VI) with a phosphoramidite reagent.
134. The method of claim 133, wherein the phosphoramide reagent is , where X 5 It is a leaving group.
135. The method of claim 134, wherein X 5 It is a halogenated group.
136. The method of claim 134, wherein X 5 It is –Cl, –Br, or –I.
137. The method of claim 134, wherein X 5 It is –Cl.
138. The method of claim 133, wherein the phosphoramidite reagent is 2-cyanoethyl N,N-diisopropylchlorophosphoramidite.
139. The method of any one of claims 1-138, wherein attaching a phosphoramide group to the compound of formula (VI) comprises contacting the compound of formula (VI) with a fifth solvent.
140. The method of claim 139, wherein the fifth solvent is a halogenated solvent.
141. The method of claim 139, wherein the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE).
142. The method of claim 139, wherein the fifth solvent is dichloromethane (DCM).
143. The method according to any one of claims 1-142, wherein attaching a phosphoramidite group to the compound of formula (VI) comprises lowering the reaction temperature to below about 10°C.
144. The method according to any one of claims 1-142, wherein attaching a phosphoramide group to the compound of formula (VI) comprises lowering the reaction temperature to about -10°C to about 10°C.
145. The method according to any one of claims 1-142, wherein attaching a phosphoramidite group to the compound of formula (VI) comprises lowering the reaction temperature to about 0°C.
146. The method according to any one of claims 1-145, wherein R 1 Yes – Me.
147. The method according to any one of claims 1-145, wherein R 1 Yes – Et.
148. The method according to any one of claims 1-145, wherein R 1 It is –CH2OCH3.
149. The method according to any one of claims 1-145, wherein R 1 It is –(CH2)2OCH3.
150. The method according to any one of claims 1-149, wherein R 2 It is an H or C1-C3 alkyl group.
151. The method according to any one of claims 1-150, wherein R 2 It can be H, –Me, –Et, or –nPr.
152. The method according to any one of claims 1-151, wherein R 2 Yes – Me.
153. The method according to any one of claims 1-152, wherein R 3 It is an H or C1-C3 alkyl group.
154. The method according to any one of claims 1-153, wherein R 3 It can be H, –Me, –Et, or –nPr.
155. The method according to any one of claims 1-154, wherein R 3 Yes – Me.
156. A compound of formula (A): (A) in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
157. A compound of formula (IV): (IV) in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
158. A compound of formula (V): (V) in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
159. A compound of formula (VI): (WE) in R 1 It is –Me, –Et, –CH2OCH3 or –(CH2)2OCH3.
160. The compound according to any one of claims 156-159, wherein R 1 Yes – Me.
161. The compound according to any one of claims 156-159, wherein R 1 Yes – Et.
162. The compound according to any one of claims 156-159, wherein R 1 It is –CH2OCH3.
163. The compound according to any one of claims 156-159, wherein R 1 It is –(CH2)2OCH3.
Citation Information
Patent Citations
Treatment of neurological diseases using modulators of gene transcripts
WO2021247800A2