Application of miR-8069 inhibitor

Abstract

The invention discloses application of a miR-8069 inhibitor, and belongs to the technical field of biological medicine.The inventor discovers that expression of miR-8069 in plasma of an IS patient is abnormally increased in the study of IS pathogenesis, and further cell experiments discover that by inhibiting expression of miR-8069, adverse effects caused by OGD / R treatment on cell viability, apoptosis and ROS can be effectively improved; the traditional Chinese medicine composition has a remarkable treatment effect on IS. OGD / R induced cell damage is often used as a model of in vitro cerebral apoplexy in research. The miR-8069 inhibitor disclosed by the invention is used for preparing a medicine for treating the cerebral apoplexy disease, and the nucleotide sequence of the miR-8069 inhibitor is as follows: ACGCCGACCGCCCAACCAUCC.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a miR-8069 inhibitor. Background Technology

[0002] Stroke, commonly known as apoplexy, is an acute cerebrovascular disease that can be divided into ischemic stroke (IS) and hemorrhagic stroke, both caused by vascular occlusion or rupture. However, effective treatments and drugs are currently lacking. Although recombinant tissue plasminogen activator (rt-PA) thrombolysis and endovascular thrombectomy are important clinical treatments, they cannot salvage neuronal damage caused by hypoxia and have stringent time windows (4.5 h and 24 h), allowing only a small percentage of patients to receive treatment. Furthermore, post-thrombolysis reperfusion causes severe secondary damage to brain tissue and the cerebrovascular system, exacerbating the inflammatory response and the risk of hemorrhagic transformation (HT), disability, and death. Therefore, discovering alternative drugs and novel drug targets for cerebral ischemia-reperfusion injury is crucial.

[0003] MicroRNAs (miRNAs) are small, single-stranded non-coding RNA molecules composed of 18-25 nucleotides. They can regulate gene expression by targeting the 3'UTR of mRNA or promoting mRNA degradation. miRNAs play a crucial role in almost all cellular activities, exerting their biological functions through multiple pathways. The OGD / R (oxygen-glucose deprivation / reperfusion) cell model is the most fundamental and classic in vitro experimental model for studying ischemic stroke. It directly simulates key pathophysiological processes in stroke development, providing an irreplaceable platform for elucidating disease mechanisms and screening therapeutic drugs. Increasing research indicates that miRNAs play a crucial role in regulating stroke progression and are potential drug targets for treating ischemic stroke. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to identify and discover miRNA biomarkers related to the treatment of ischemic stroke (IS). In their research on the pathogenesis of IS, the inventors discovered that miR-8069 expression is abnormally elevated in the plasma of IS patients. Further cell experiments revealed that inhibiting miR-8069 expression effectively mitigated the adverse effects of OGD / R treatment on cell viability, apoptosis, and ROS, demonstrating a significant therapeutic effect on IS. OGD / R-induced cell damage is frequently used as an in vitro model of stroke in research.

[0005] The miR-8069 inhibitor described in this invention is used to prepare a drug for treating stroke, and its nucleotide sequence is as follows: ACGCCGACCGCCCCCAACCAUCC.

[0006] The beneficial effects of this invention are:

[0007] This invention is the first to discover that miR-8069 is significantly overexpressed in the plasma of IS patients. Further cell experiments showed that pre-transfection of neuronal cells with a miR-8069 inhibitor can effectively reduce the increase in miR-8069 expression levels caused by OGD / R treatment (P < 0.001), effectively increase the decrease in cell viability caused by OGD / R treatment (P < 0.001), effectively reduce the increase in cell apoptosis rate caused by OGD / R treatment (P < 0.01), and effectively reduce the increase in ROS caused by OGD / R treatment (P < 0.001). Attached Figure Description

[0008] Figure 1 The expression status of miR-8069 in plasma ( ### This indicates that compared with the control group, p < 0.001).

[0009] Figure 2 A comparative figure showing the effects of miR-8069 inhibitors on miR-8069 expression in neurons induced by OGD / R treatment. ### This indicates that compared with the control group, p < 0.001; *** (Indicates p < 0.001 compared to the model group).

[0010] Figure 3 A comparative diagram showing the effects of miR-8069 inhibitors on the effects of OGD / R treatment on neuronal cell viability. #### This indicates that compared with the control group, p < 0.0001; *** (Indicates p < 0.001 compared to the model group).

[0011] Figure 4 A comparative figure showing the effect of miR-8069 inhibitors on neuronal apoptosis induced by OGD / R treatment. #### This indicates that compared with the control group, p < 0.0001; ** (Indicates p < 0.01 compared to the model group).

[0012] Figure 5 A comparative diagram showing the effects of miR-8069 inhibitors on reactive oxygen species (ROS) induced by OGD / R treatment in neurons. #### The value was marked as p < 0.0001 compared to the control group; **** This indicates that p < 0.001 compared to the model group. Detailed Implementation

[0013] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0014] 1. Expression characteristics and clinical significance of miR-8069 in IS patients

[0015] 1.1 Main reagents and consumables

[0016] Reagent Name company miRcute miRNA Extraction and Isolation Kit Tiangen chloroform Xilong Science Anhydrous ethanol Xilong Science miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Quantitative Real-Time Detection Kit (SYBR Green) Tiangen

[0017] 1.2 Main Instruments

[0018] Instrument Name company Vortex mixer SCILOGEX High-speed refrigerated centrifuge SCILOGEX Handheld centrifuge SCILOGEX 96-well plate centrifuge Qilinbell water bath Jintan Science and Technology Quantitative PCR instrument Roche

[0019] 1.3 Experimental Methods

[0020] 1.3.1 Sample Collection

[0021] Plasma samples were collected from 5 patients with ischemic stroke and 5 healthy volunteers (control group) (a total of 10 subjects) as study subjects. Plasma sample preparation method: Approximately 4 mL of fasting peripheral venous blood was collected from the subjects. After collection, the plasma samples were stored in sodium citrate anticoagulant tubes, centrifuged (3000 rpm, 4℃, 10 min), and the plasma was immediately stored in a -80℃ freezer for later use.

[0022] 1.3.2 Primer Design and Synthesis

[0023] The corresponding sequence was obtained from the NCBI database, and primers for miR-8069 were designed. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequence is as follows: miR-8069 Forward: 5'-GGATGGTTGGGGGCGGTCGGCGT-3'.

[0024] 1.3.3 miRNA extraction

[0025] Take 200 µL of plasma sample and extract miRNA from the plasma sample using the miRcute miRNA extraction and isolation kit.

[0026] 1.3.4 miRNA reverse transcription

[0027] The reverse transcription system was performed according to the miRNA cDNA first-strand synthesis kit instructions.

[0028] Element volume 2×miRNA RT Reaction Buffer 10 μL miRNA RT Enzyme Mix 2 μL miRNA samples 8 μL

[0029] Bring the total volume of the three reagents to 20 µL, gently shake, centrifuge for 3-5 s to mix the reactants, incubate at 42°C for 60 min, then at 95°C for 3 min to obtain the first strand of reverse-transcribed cDNA. Immediately place on ice or store at -20°C.

[0030] 1.3.5 qPCR detection of target gene expression

[0031] Following the instructions for the miRNA fluorescence quantitative detection kit, add the following reagents to each well of a 96-well PCR plate in the order specified in the sample loading instructions.

[0032] Element volume 2×miRcute Plus miRNA PreMix (SYBR&ROX) 5 μL Forward Primer 0.2 μL Reverse Primer (10 µM) 0.2 μL miRNA first-strand cDNA 1 μL <![CDATA[ddH2O]]> 3.6 μL Total system 10 µL

[0033] The above system was thoroughly mixed, briefly centrifuged, and then placed in a LightCycler 96 instrument for detection. Amplification signals were collected. The following were the quantitative PCR conditions: pre-denaturation 95℃, 600s; 95℃: 5s, 60℃: 30s, 72℃: 30s, 45 cycles; melting curve analysis: 95℃: 15s; 60℃: 30s; 95℃: 1s. U6 was selected as an internal control. For the analysis of relative expression levels of the target gene, 2... -△△Ct The method is used for calculation.

[0034] 1.3.6 Statistical Analysis

[0035] The analysis and comparison were performed using GraphPad Prism 9.0.0. The two independent samples t-test was used to compare between groups, and P < 0.05 was considered statistically significant.

[0036] 1.4 Experimental Results

[0037] The results are as follows Figure 1 As shown, compared with healthy volunteers (control group), the expression level of miR-8069 in the plasma of IS patients was significantly increased (p<0.001).

[0038] 2. Neuroprotective effect of miR-8069 inhibitors against OGD / R-induced neuronal cell damage

[0039] 2.1 Main reagents and consumables

[0040] Reagent Name company DMEM high glucose medium Gibco Hanks' Balanced Salt Solution (HBSS) Gibco Papain Sigma DNase I Solarborg Neurobasal-A culture medium Gibco B-27 Additive Gibco Penicillin-Streptomycin (P / S) Gibco <![CDATA[lipofectamine TM 3000]]> Gibco Trizol Thermo Fisher Isopropanol Xilong Science chloroform Xilong Science Anhydrous ethanol Xilong Science miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Quantitative Real-Time Detection Kit (SYBR Green) Tiangen Annexin V-FITC Apoptosis Detection Kit Azure Sky Reactive oxygen species detection kit Azure Sky

[0041] 2.2 Main Instruments

[0042] Instrument Name company Cell incubator Thermo Fisher Scientific 3141 Clean bench Haier HCB-1300V Inverted microscope OLYMPUS BX53 Nanophotometer IMPLEN Quantitative PCR instrument Roche Flow cytometer ACEA Novocyte 2060R

[0043] 2.3 Experimental Methods

[0044] 2.3.1 Primary cortical neuron culture of tree shrews

[0045] Take tree shrews within 24 hours after birth (Institute of Medical Biology, Chinese Academy of Medical Sciences, license number SCXK (Yunnan) K2023 - 0003). After disinfection with 75% alcohol immersion, decapitate the brain on ice, rinse it in pre-cooled HBSS solution, then strip the meninges and blood vessels on the cortical surface on ice, remove the cerebellum and brainstem, isolate the cerebral cortex, cut the collected cortex into small pieces (about 0.5 - 1 mm 3 in size), resuspend and mix well by pipetting, add a mixture of 2 mg / mL papain and 200 U / mL DNase I at 37°C, place it in a cell culture incubator, after reacting at 37°C for 30 minutes, add DMEM high-glucose complete medium to terminate digestion, and gently pipette into a single cell suspension. Then filter and collect the suspension through a 70 μm sieve, centrifuge at 1000 r / min for 5 minutes, discard the supernatant, resuspend the cells by pipetting with DMEM high-glucose complete medium, and count the cell concentration of the mother liquid. Adjust the appropriate cell density and inoculate it in a cell culture plate coated with rat tail glue. Four hours after inoculation, completely replace the DMEM high-glucose complete medium with Neurobasal-A medium (supplemented with 2% B27, 1% double antibiotics, 1% glutamine), and then replace half of the medium every two days. Culture in vitro for 7 days for subsequent experiments.

[0046] 2.3.2 Establishment of glucose and oxygen deprivation / reoxygenation model

[0047] On the 8th day of neuron culture, establish a glucose and oxygen deprivation / reoxygenation (OGD / R) model. The specific method is as follows: Discard the normal medium, wash twice with PBS, add glucose-free and serum-free DMEM medium, and place the cells in an incubator (37°C, 95% N2, 5% CO2) for OGD treatment; After 2 hours, take out the cells, discard the DMEM medium, change the medium to normal Neurobasal-A medium, that is, start reoxygenation, and perform subsequent detections after 18 hours.

[0048] 2.3.3 Cell treatment

[0049] Experimental grouping and treatment:

[0050] ① Control group: Neuron cells are cultured normally;

[0051] ② OGD / R group: Establish the OGD / R model of neuron cells according to 2.3.2;

[0052] ③ miR-8069 inhibitor group: Dilute the miR-8069 inhibitor sequence with lipofectamine TMMix 3000g of transfection reagent, gently mix, and incubate at room temperature for 20 min to form a transfection complex. Add the above mixture to neuronal cells cultured for 7 days, gently shake the cell plate to mix thoroughly, and incubate in a 5% CO2, 37℃ incubator for 24 h to construct an OGD / R model. The self-designed miR-8069 inhibitor sequence is as follows: ACGCCGACCGCCCCCAACCAUCC, synthesized by Shanghai Sangon Biotech Co., Ltd.

[0053] 2.3.4 qPCR detection

[0054] Cells from different treatment groups were collected, and total RNA was extracted using the Trizol method. The concentration and purity of total RNA were detected using a micro spectrophotometer. The RNA was then reverse transcribed into cDNA, and PCR amplification was performed using a Roche quantitative PCR instrument. The reaction conditions were: pre-denaturation 95℃ for 600 s; 95℃: 5 s, 60℃: 30 s, 72℃: 30 s, 45 cycles; melting curve analysis: 95℃: 15 s; 60℃: 30 s; 95℃: 1 s. U6 was selected as an internal control, and 2 was used for relative expression level analysis of the target gene. -△△Ct The method is used for calculation.

[0055] 2.3.5 Cell viability assay

[0056] Cell viability was assessed using CCK-8 reagent. After cell culture in each group, the original culture medium was removed, and fresh Neurobasal-A medium containing 10% CCK-8 was added at 100 μL / well. The cells were then incubated at 37°C in the dark for 2 hours. The absorbance at 450 nm was then measured using a full-wavelength microplate reader.

[0057] 2.3.6 Flow Cytometry Apoptosis

[0058] Cells from different treatment groups were collected, resuspended in 400 μL of binding buffer, and 5 μL of Annexin V-FITC was added and gently mixed. After incubation in the dark for 15 min, 10 μL of PI was added and mixed. After reacting at room temperature in the dark for 5 min, the cells were analyzed by flow cytometry.

[0059] 2.3.7 ROS Detection

[0060] The DCFH-DA probe was used to detect ROS levels in neuronal cells. The specific procedure was as follows: DCFH-DA was diluted with serum-free medium (final concentration 10 μmol / L). Cells from different treatment groups were collected, and 1 mL of DCFH-DA dilution was added to the cells. The cells were incubated at 37°C for 20 min. After centrifugation at 350 g for 5 min, the supernatant was discarded, and the cells were washed three times with serum-free cell culture medium to thoroughly remove any unextracted DCFH-DA. After centrifugation at 350 g for 5 min, the supernatant was discarded, the cells were resuspended in PBS, and the data were analyzed by flow cytometry.

[0061] 2.3.8 Statistical Analysis

[0062] The analysis and comparison were performed using GraphPad Prism 9.0.0. One-way ANOVA was used for comparisons between groups, and LSD method was used for pairwise comparisons. A p-value < 0.05 was considered statistically significant.

[0063] 2.4 Experimental Results

[0064] 2.4.1 Effects of miR-8069 inhibitors on miR-8069 expression in neuronal cells after OGD / R treatment

[0065] The results are as follows Figure 2 As shown, the expression level of miR-8069 in neurons was significantly increased after OGD / R treatment (P < 0.001); pre-transfection of neurons with a miR-8069 inhibitor could effectively reduce the increase in miR-8069 expression level caused by OGD / R treatment (P < 0.001).

[0066] 2.4.2 Effects of miR-8069 inhibitor on neuronal cell viability after OGD / R treatment

[0067] The results are as follows Figure 3 As shown, OGD / R treatment significantly reduced cell viability in neurons (P < 0.0001); pre-transfection of neurons with miR-8069 inhibitor effectively reduced the cell viability reduction caused by OGD / R treatment (P < 0.001).

[0068] 2.4.3 Effects of miR-8069 inhibitor on OGD / R treatment on neuronal apoptosis

[0069] The results are as follows Figure 4 As shown, the apoptosis rate of neurons was significantly increased after OGD / R treatment (P < 0.0001); pre-transfection of neurons with miR-8069 inhibitor can effectively reduce the increase in apoptosis rate caused by OGD / R treatment (P < 0.01).

[0070] 2.4.4 Effects of miR-8069 inhibitor on OGD / R treatment of reactive oxygen species (ROS) in neurons

[0071] The results are as follows Figure 5 As shown, the ROS level in neurons was significantly increased after OGD / R treatment (P < 0.0001); pre-transfection of neurons with miR-8069 inhibitor effectively reduced the increase in ROS caused by OGD / R treatment (P < 0.001).

Claims

1. Use of a miR-8069 inhibitor, characterized in that, The inhibitor is used for preparing medicine for treating stroke disease, and its nucleotide sequence is ACGCCGACCGCCCCCAACCAUCC.

Images