Black fungus strain and cultivation method thereof

Abstract

The invention discloses a black fungus strain and a cultivation method thereof, and relates to the technical field of edible fungi, and the preservation number of the black fungus strain is CCTCC NO: M2025971. The black fungus strain provided by the invention has the characteristics of short production cycle, high yield, good quality and rich polysaccharide and polyphenol substances, solves the problems of unstable quality and yield of black fungus in the prior art, and has a good popularization prospect.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, and more specifically to a strain of black fungus and its cultivation method. Background Technology

[0002] Black fungus ( Auricularia heimuer F. Wu et al., also known as cloud ear, light ear, black vegetable, etc., belongs to the kingdom Mycota, phylum Eumycota, subphylum Basidiomycotina, class Agaricomycetes, order Auriculariales, family Auriculariaceae, genus Auricularia (F. Wu et al.). Auricularia Black fungus is not only rich in colloids, proteins, and various vitamins and minerals, giving it high nutritional value, but it also has medicinal value such as lowering blood lipids, anti-tumor effects, and immune regulation. Therefore, black fungus has great application potential in the fields of food, medicine, and cosmetics.

[0003] Over the past decade or so, with the rapid development of the black fungus industry, the production model has gradually shifted from traditional log cultivation to substrate cultivation, leading to a continuous expansion of black fungus production scale in Heilongjiang Province. However, with increased production and expanding market demand, the cultivation of black fungus has encountered problems with unstable fruiting body yield and quality. Especially during the hot summer months, phenomena such as thinning of the fruiting bodies, poor color, red roots, and fruiting body leakage often occur, resulting in unstable yield and quality. This not only affects the market competitiveness of black fungus but also seriously restricts the healthy development of enterprises. This is caused by both the strain and the cultivation model. Among them, the strain is the foundation of the edible fungus industry, playing a leading role, and its quality directly determines the yield and quality of black fungus.

[0004] Therefore, in order to ensure the stability of black fungus yield and quality, how to overcome the shortcomings of existing technologies and select black fungus strains with strong stress resistance has become an important problem that urgently needs to be solved in the field of microbial technology. Summary of the Invention

[0005] In view of this, the present invention provides a strain of black fungus and a method for its cultivation.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A strain of *Auricularia auricula-judae* has been deposited at the China Center for Type Culture Collection (CCTCCNO: M2025971), located at Wuhan University, Wuhan, China. The strain is classified and named as follows: Auricularia heimuer DL-Ah001, deposited on May 6, 2025.

[0007] Another object of the present invention is to provide a method for cultivating the above-mentioned black fungus strain, comprising the following steps: (1) Propagation of mother culture: Black fungus was inoculated onto sterilized mother culture test tubes and cultured at 25°C in the dark for 7 days until the mycelium covered the slant. (2) Preparation of liquid culture in shake flask: The mycelium obtained in step (1) was inoculated into the shake flask culture medium using a sterilized inoculation rake and inoculation shovel, and cultured at 26℃, 165 rpm, and in the dark for 8 days to obtain the liquid culture in shake flask. (3) Preparation of liquid culture in fermentation tank: Pour the liquid culture obtained in step (2) into the fermentation tank, control the temperature of the fermentation tank at 25°C, the aeration rate at a ratio of liquid volume to air volume per minute of 1:0.7, the tank pressure at 0.03 MPa, and culture for 9 days to obtain the liquid culture in fermentation tank; (4) Preparation of culture medium: The liquid culture medium obtained in step (3) is inoculated into the culture bag culture medium. Each culture bag is inoculated with 15 mL and placed in the culture room for cultivation. The number of culture bags is 80-85 bags per cubic meter. For the first 2 days, the culture is placed in a dark culture room at 26℃. Then the temperature is controlled to 23℃ for constant temperature cultivation. The air humidity is kept at 55-65% throughout the process, and the carbon dioxide concentration in the air is controlled at 2000-2500 ppm until the mycelium fills the culture bag. (5) Post-ripening incision: After the mycelium has fully grown in the bag, continue to cultivate for 15 days to complete the post-ripening of the mycelium. In spring, move it into a small arched shed, make nail-shaped holes with an opening depth of 5 mm, and make 160 incisions per bag. Avoid direct sunlight. Use straw curtains or plastic sheets to keep warm at night. Place it for 5 days to allow the mycelium to recover until the incisions are completely healed. (6) Ear management: Place the punctured and recovered mushroom sticks in separate beds, with a bed width of 1.4 to 1.6 m. Start watering 3 days after placement. In the early stage, do not spray water on the mushroom sticks, but spray water on the ground or the greenhouse wall. When the ear buds have basically formed, spray water directly on the surface of the mushroom sticks and keep the air humidity at about 85%. Ventilate in the morning and evening as needed. At noon, cover the greenhouse roof with a shade net to prevent overheating. When the ear pieces gradually lighten in color and reach seven or eight tenths maturity, harvest them. Follow the principle of harvesting the large ones and leaving the small ones, and harvesting the upper ones and leaving the lower ones. Stop watering for 3 to 4 days after harvesting and then continue the same management.

[0008] Preferred method: The preparation method of the mother culture test tube culture medium in step (1) is as follows: Peel the potatoes and put them in a pot to boil. After the water boils, continue to boil for 20 minutes. Filter the potato residue with gauze and leave the potato liquid. Add 20 g of glucose and 17 g of agar to each liter of potato liquid. After boiling until the agar melts, PDA culture medium is obtained. Pour the culture medium into glass test tubes with a specification of 20×200, 12 mL per tube. Sterilize at 121℃ for 20 minutes, place on a slant, cool and set aside. The preparation method of the shake flask culture medium in step (2) is as follows: Weigh 200 g of potatoes, peel them, and put them in a pot. Then weigh 20 g of wheat bran, wrap it in 4 layers of gauze, tie it with a rubber band, and put it in the pot with the potatoes. Boil the mixture together, and continue boiling for 20 minutes after the water boils. Filter the broth with gauze, and add 20 g of glucose, 5 g of brown sugar, 2 g of KH2PO4, 1 g of MgSO4, and V to each liter of filtrate. B1 10 mg, measure 600 mL and pour into a 1000 mL Erlenmeyer flask, sterilize at 121℃ for 30 min, sterilize at 121℃ for 20 min, and then cool for later use; The preparation method of the fermenter culture medium in step (3) is as follows: Pour 1000 L of tap water into the fermenter, and then add 3 kg of soybean flour, 7 kg of corn flour, 4 kg of glucose, 6 kg of brown sugar, 1.5 kg of peptone, 0.6 kg of KH2PO4, and 0.25 kg of MgSO4 in sequence. First, purge the cold air in the tank with hot steam, and then pressurize it to 0.11 MPa with hot steam for 90 min. After it is cooled to 25°C, add the liquid inoculum in the shake flask. The preparation method of the culture medium in step (4) is as follows: weigh the main and auxiliary materials according to the proportion of sawdust 82%, wheat bran 12%, soybean meal 2%, corn flour 2%, lime 1% and gypsum 1%, put them into a cultivation bag with a folded diameter of 16 cm and a height of 35 cm, each bag weighing 2.4 kg, sterilize at 121℃ for 2 h and then cool for later use.

[0009] Another object of the present invention is to provide applications of the above-mentioned black fungus strain, said applications being the production of polysaccharides or polyphenols, or the use of it as a parent to cultivate new varieties of black fungus.

[0010] Beneficial Effects: This invention discloses a black fungus strain and its cultivation method. The black fungus strain provided by this invention completes fruiting before the hottest days of summer, is heat-resistant, and features a short production cycle, high yield, good quality, and is rich in polysaccharides and polyphenols. It solves the problem of unstable quality and yield of black fungus in existing technologies and has good prospects for promotion. Attached Figure Description

[0011] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0012] Figure 1 Phylogenetic tree of strain DL-Ah001 based on ITS sequence; Figure 2 This is a colony morphology diagram of strain DL-Ah001; Figure 3 Scanning electron microscopy (SEM) structure of mycelia of strain DL-Ah001; Figure 4 Morphological diagram of the fruiting body of strain DL-Ah001; Figure 5 The morphology of mushroom fruiting bodies cultivated by strain DL-Ah001 in Yabuli Town, Shangzhi City, Harbin, Heilongjiang Province; Figure 6 The morphology of mushroom fruiting bodies cultivated by strain DL-Ah001 in Zhenzhushan Township, Shangzhi City, Harbin, Heilongjiang Province; Figure 7 The morphology of mushroom bodies cultivated by strain DL-Ah001 in Shitouhezi Town, Shangzhi City, Harbin, Heilongjiang Province. Detailed Implementation

[0013] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0014] Example 1 Obtaining and identifying the Auricularia auricula strain DL-Ah001 1. Wild wood ear mushrooms collected from the Lesser Khingan Mountains were selected and hybridized to obtain strain DL-Ah001.

[0015] Mature black fungus fruiting bodies with intact morphology and free from insect damage were collected in the Lesser Khingan Mountains during spring and autumn. They were rinsed twice with 75% ethanol and sterile water, cut into small pieces with sterile scissors, and then cultured on plates at 25°C in the dark. A total of 12 original strains were obtained.

[0016] The obtained pure strains were inoculated onto PDA plates and cultured for 7 days under dark conditions at 25℃, 28℃, 30℃, and 32℃, respectively. The mycelial growth rate was determined using the cross-cross method, and strains that grew normally and rapidly under high temperature were selected for the fruiting test.

[0017] The strain was inoculated into the culture medium and the ear was produced according to the conventional method. The ear was harvested when it was seven or eight tenths mature. The ear production cycle was recorded, and the expansion degree, color, ear thickness, ear diameter and other characteristics were measured. The strain with high market acceptance was selected as the parent.

[0018] Parental spores were collected using the hook suspension method. The spore suspension was obtained by rinsing with sterile water and spread onto PDA plates. The plates were incubated at 25°C in the dark. Single colonies were picked and cultured, yielding 25 mononuclear strains from each parent. A total of 625 hybridization combinations were created by pairwise pairing. Strains were screened using the same method described above, and the selected strain was named DL-Ah001 (its colony morphology is shown in the appendix). Figure 2 For the microscopic morphology of hyphae, please refer to the appendix. Figure 3 ).

[0019] 2. Mycelial DNA was extracted from strain DL-Ah001 and amplified by PCR using ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO. 2) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO. 3) as primers. The ITS sequence of strain DL-Ah001 was sequenced by Harbin Ruibo Biotechnology Co., Ltd., and its ITS sequence is shown in SEQ ID NO. 1. A phylogenetic tree was constructed (see Appendix). Figure 1 ).

[0020] , SEQ ID NO.1.

[0021] 3. Preservation Based on the morphological characteristics and molecular identification results of strain DL-Ah001, it was ultimately identified as Auricularia auricula-judae and named 'Heihouyuan'. Auricularia auricula-judae DL-Ah001 was deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M2025971, located at Wuhan University, Wuhan, China. It was classified and named... Auricularia heimuer DL-Ah001, deposited on May 6, 2025.

[0022] Example 2 Black fungus DL-Ah001 multi-point trial in 2023 1. Test site (1) Yabuli Town, Shangzhi City, Harbin, Heilongjiang Province; (2) Pearl Mountain Township, Shangzhi City, Harbin, Heilongjiang Province; (3) Shitouhezi Town, Shangzhi City, Harbin, Heilongjiang Province.

[0023] 2. Cultivation methods (1) Propagation of mother culture: Black fungus DL-Ah001 was inoculated onto sterilized mother culture test tube culture medium and placed at 25℃ for 7 days in the dark, until the mycelium covered the slant.

[0024] Mother culture medium: Weigh 200 g of potatoes, peel them, and put them in a pot. Add 1 L of water and boil. After boiling, continue boiling for 20 minutes. Filter the potato residue with gauze, leaving the potato liquid. Add 20 g of glucose and 17 g of agar to each liter of potato liquid. Boil until the agar dissolves to obtain PDA medium. Pour the medium into 20×200 glass test tubes, 12 mL per tube. Sterilize at 121℃ for 20 minutes, then arrange on slant agar and cool for later use.

[0025] (2) Preparation of liquid culture in shake flask: The mycelium obtained in step (1) was inoculated into the shake flask culture medium using a sterilized inoculation rake and inoculation shovel, and cultured at 26℃, 165 rpm, and in the dark for 8 days to obtain the liquid culture in shake flask.

[0026] Shake flask culture medium: Weigh 200 g of potatoes, peel them, and place them in a pot. Weigh 20 g of wheat bran, wrap it in four layers of gauze, tie the opening with a rubber band, and place it in the pot. Add 1 L of water and boil together with the potatoes. After boiling, continue boiling for 20 minutes. Filter the broth through gauze. Add 20 g of glucose, 5 g of brown sugar, 2 g of KH₂PO₄, 1 g of MgSO₄, and V to each liter of filtrate. B1 Measure 10 mg, pour 600 mL into a 1000 mL Erlenmeyer flask, sterilize at 121℃ for 30 min, and cool for later use.

[0027] (3) Preparation of liquid culture in fermenter: Pour the liquid culture obtained in step (2) into the fermenter, control the fermenter temperature to 25°C, the aeration rate to 1:0.7 V / V (liquid volume / air volume) per minute, the tank pressure to 0.03 MPa, and culture in the dark for 9 days to obtain the liquid culture in fermenter.

[0028] Fermentation tank culture medium: Pour 1000 L of tap water into the fermenter, then add 3 kg of soybean flour, 7 kg of corn flour, 4 kg of glucose, 6 kg of brown sugar, 1.5 kg of peptone, 0.6 kg of KH2PO4, and 0.25 kg of MgSO4 in sequence. First, purge the cold air in the tank with hot steam, then pressurize it to 0.11 MPa with hot steam and sterilize for 90 min. After it cools to 25°C, add the liquid inoculum in the shake flask.

[0029] (4) Preparation of culture: From October to February of the following year, the liquid culture obtained from the fermenter in step (3) is inoculated into the culture medium of the culture bag. Each culture bag is inoculated with 15 mL and placed in the culture room for cultivation. The number of culture bags is 80 to 85 per cubic meter. For the first 2 days, the culture bag is placed in a dark culture room at 26℃. Then the temperature is controlled to 23℃ for constant temperature cultivation. The air humidity is maintained at 55 to 65% throughout the process, and the carbon dioxide concentration in the air is controlled at 2000 to 2500 ppm until the mycelium fills the culture bag.

[0030] Culture medium for cultivation bags: Weigh out the main and auxiliary materials according to the ratio of 82% sawdust, 12% wheat bran, 2% soybean meal, 2% corn flour, 1% lime, and 1% gypsum, and pack them into cultivation bags with a folded diameter of 16 cm and a height of 35 cm. Each bag weighs 2.4 kg. Sterilize at 121℃ for 2 h and then cool for later use.

[0031] (5) Post-ripening incision: After the mycelium has fully grown in the bag, continue to cultivate for 15 days to complete the post-ripening of the mycelium. In spring, move it into a small arched shed, make nail-shaped holes with an opening depth of 5 mm, and make 160 incisions per bag. Avoid direct sunlight. Use straw curtains or plastic sheets to keep warm at night, control the temperature at 20~25℃ and the humidity at 80~90%. Let it sit for 5 days to allow the mycelium to recover until the incisions are completely healed.

[0032] (6) Ear emergence management: At the end of April, place the punctured and recovered mushroom logs in separate beds, each 1.4–1.6 m wide. After 3 days, begin watering. Initially, do not spray water onto the mushroom logs, but spray water onto the ground or the greenhouse walls to maintain an air humidity of 80–90%. Once the ear buds have basically formed, spray water directly onto the surface of the mushroom logs and maintain an air humidity of around 85%. Ventilate the greenhouse in the morning and evening as needed, and cover the roof with a shade net at noon to prevent overheating. When the ear buds gradually lighten in color, have basically unfolded, and have just begun to show scattered white spores on the underside, they are considered 70–80% mature and are ready for harvesting. Harvest according to the principle of picking the larger ones and leaving the smaller ones, and picking the upper ones and leaving the lower ones. After harvesting, stop watering for 3–4 days before resuming watering and harvesting. The first batch of ear emergence is completed by the end of May, and the second batch is completed before the beginning of July.

[0033] (7) Drying A drying rack, approximately 0.6 m high, 1.5 m wide, and 10 m long, is constructed using wooden stakes or steel pipes. Small wooden poles or steel pipes are fixed to the longitudinal pipes every 75 cm or so to serve as support beams. The mesh is pulled taut and fixed to the support beams, and an arched frame is built on top of it. During drying, the harvested black fungus is placed directly on the drying rack, with the fungus pieces piled up to a thickness of 3-5 cm. In the evening or on rainy days, plastic sheets are stretched onto the arched frame and dried until the moisture content of the fungus pieces is ≤12%. Each bag of dried fungus can yield 60-70 g.

[0034] (8) Survey and statistics Surveys and data collection were conducted at different locations and demonstration sites, mainly observing the main characteristics of the tested strains and calculating the yield. For the mycelium growth cycle, germination rate, and yield, 50 bags were randomly selected from each group. For agronomic traits such as fruiting body thickness, diameter, and expansion rate, 200 fruiting bodies were randomly selected from each group to calculate the average value.

[0035] The statistical method used was R software for statistical processing. Data were expressed as mean ± standard deviation. Mean squared (±s) is used. First, the Shapiro–Wilk test was used to assess the normality of the data, and the Levene test to assess homogeneity of variance. When the data conformed to a normal distribution and had homogeneity of variance, the aov() function was used for one-way ANOVA, followed by the TukeyHSD() function for post-hoc multiple comparisons. If the variances were unequal, Welch correction was applied to the ANOVA results, and the Games–Howell test was used for pairwise comparisons. When the data did not conform to a normal distribution, the Kruskal–Wallis nonparametric test was used, supplemented by the Dunn test for post-hoc multiple comparisons. The significance grouping letters for all multiple comparisons were generated by the multcompLetters4() function, with p < 0.05 considered statistically significant.

[0036] The statistical results are shown in Tables 1 and 2 and Appendix. Figure 4 -Appendix Figure 7 .

[0037] Table 1. Culture period and germination rate of DL-Ah001 black fungus in multi-point experiment

[0038] Table 2. Main agronomic traits and yield performance of DL-Ah001 black fungus in multi-location trials.

[0039] The black fungus strain DL-Ah001 of this invention is a medium-maturing variety with a short production cycle. It can complete fruiting before the hottest days of summer, and its mycelium is robust, germinates quickly, and has strong resistance to contaminating bacteria. The fruiting body is black, the ear flaps are gelatinous and elastic, and the characteristics are stable. The ear shape is ear-shaped. It has high application value and good market prospects.

[0040] Example 3 Black Fungus DL-Ah001 Sample Comparison Test 1. Test varieties (1) Black fungus DL-Ah001. (2) Black fungus strain 'Heishan'. (3) Black fungus strain 'Heiwei Banjin'. 'Heishan' and 'Heiwei Banjin' are both existing varieties, provided by the Forest Protection Department of the College of Forestry, Northeast Forestry University.

[0041] 2. Cultivation method: Same as in Example 2.

[0042] 3. Survey and Statistics (1) The main characteristics and yield of the tested strains were analyzed and statistically analyzed. For the culture period, germination rate and yield, 50 bags were randomly selected from each group. For agronomic traits such as fruiting body thickness, diameter and expansion rate, 200 fruiting bodies were randomly selected from each group and the average value was calculated. The results are shown in Tables 3 and 4.

[0043] Table 3. Cultivation period and germination rate of 'DL-Ah001', 'Heishan', and 'Heiwei Banjin' varieties in comparative experiments.

[0044] Table 4. Main agronomic traits and yield performance of 'DL-Ah001', 'Heishan', and 'Heiwei semi-gluten' varieties in comparative trials.

[0045] (2) Quantitative detection of active ingredients Polysaccharide content determination: The harvested black fungus fruiting bodies were dried in a 40℃ oven to constant weight, pulverized, and passed through an 80-mesh sieve. 1.0 g of sample was accurately weighed, and 4.0 mL of petroleum ether was added. After shaking for 3 h, the sample was allowed to stand overnight. The petroleum ether was discarded, and the sample was dried at 40℃. 45 mL of water was added, and the sample was extracted with ultrasonic assistance at 60℃ for 30 min. After centrifugation at 5000 rpm for 5 min, the precipitate was discarded. 180 mL of anhydrous ethanol was added, and the sample was allowed to stand overnight at 4℃. After centrifugation at 6200 rpm for 10 min, the supernatant was discarded. The precipitate was dissolved in 20 mL of distilled water. After cooling to 4℃, 20 mL of 10% trichloroacetic acid solution (w / v) was added while stirring. The sample was placed at 4℃ for 1 h, and the precipitate was discarded. The pH was adjusted to 6-7 using 1 mol / L NaOH solution, and the volume was brought to 250 mL. 2 mL of the extract was placed in a 10 mL test tube, and 1 mL of 6% phenol was added, followed by 5 mL of... mL of concentrated sulfuric acid was rapidly shaken and placed in a 30℃ water bath for 30 min. The absorbance at a wavelength of 490 nm was measured. Using glucose as a standard, a standard curve was prepared using the same treatment method. The polysaccharide content in the fruiting body of black fungus was calculated (see Table 5).

[0046] Determination of total phenol content: The harvested black fungus fruiting bodies were dried in an oven at 40℃ to constant weight, pulverized and passed through an 80-mesh sieve. 1.0 g of sample was accurately weighed, 30 mL of anhydrous methanol was added, and ultrasonic extraction was performed at 50℃ for 40 min. After centrifugation at 6200 rpm for 5 min, the precipitate was discarded. 1 mL of the supernatant was taken into a 10 mL test tube, 2 mL of Folin-phenol reagent was added, mixed well, and allowed to stand for 5 minutes. 3 mL of 15% Na2CO3 solution was added, mixed well, and reacted at room temperature in the dark for 30 minutes. The absorbance at 765 nm was measured. Gallic acid was used as a standard, and a standard curve was prepared using the same treatment method. The total phenol content in the black fungus fruiting bodies was calculated (see Table 5).

[0047] Table 5 Polysaccharide Content

[0048] Example 4 Evaluation of the stress resistance of black fungus DL-Ah001 1. Test varieties Black fungus DL-Ah001.

[0049] 2. Cultivation method: Same as in Example 2.

[0050] 3. Survey and Statistics The tested strains were cultured and viviparous at a relatively high temperature of 33℃. The stability of key indicators such as the number of days to full bag, contamination rate, and germination rate was measured. Each replicate batch consisted of 20 bags of mycelium. The measurement and statistical methods were the same as in Example 2. The results are shown in Tables 6 and 7.

[0051] Table 6. Stress resistance during the culture stage

[0052] Table 7. Resistance during the ear emergence stage

[0053] In summary, the results of the comparative test of the present invention show that the black fungus strain DL-Ah001 has good fruiting condition, high budding rate, high uniformity of fruiting, stable cultivation characteristics, black fruiting bodies, ear-shaped ear pieces with rounded edges, dense ear piece growth, gelatinous texture, ear veins, brown cilia on the back, weak light transmittance, and no stalk.

[0054] DL-Ah001 black fungus is a mid-maturing variety with a shorter production cycle, shortening the time by 11 days compared to 'Heishan' and by 7 days compared to 'Heiwei Banjin'. This avoids the problem of ear-like structures thinning, poor color, red roots, and ear runoff during the hottest days of summer. Even under sudden extreme heat, it maintains good marketability. Furthermore, DL-Ah001 black fungus has a higher germination rate, thicker ear-like structures, better biological conversion rate, and higher expansion rate than 'Heishan' and 'Heiwei Banjin', exhibiting excellent yield, appearance, and expansion properties.

[0055] Black fungus contains polysaccharides and polyphenols, which have effects such as lowering blood lipids, anti-tumor, and immune regulation. The polysaccharide and polyphenol content of black fungus DL-Ah001 is significantly higher than that of existing varieties.

[0056] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0057] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Auricularia auricula-judae, characterized in that, The strain is preserved in China Center for Type Culture Collection, the preservation number is CCTCC NO: M2025971, the preservation address is Wuhan University, Wuhan, China, and the classification name is Auricularia heimuer DL-Ah001, preservation date is May 6, 2025.

2. The cultivation method of the Auricularia auricula strain according to claim 1, characterized in that, comprising the following steps: (1) mother strain propagation: inoculate Auricularia auricula-judae on sterilized mother strain test tube medium, and place under 25℃ condition, and culture in dark for 7 days, and mycelium grows full of the slope; (2) preparation of shake flask liquid strain: inoculate the mycelium obtained in step (1) into shake flask medium with sterilized inoculation rake and inoculation shovel, and culture under 26℃ condition, 165 rpm, and in dark for 8 days, and shake flask liquid strain is prepared; (3) preparation of fermentation tank liquid strain: pour the shake flask liquid strain obtained in step (2) into a fermentation tank, control the temperature of the fermentation tank to be 25℃, the aeration amount is 1:0.7 of the liquid volume per minute / air volume, and the tank pressure is 0.03 MPa, and culture for 9 days, and the fermentation tank liquid strain is obtained; (4) preparation of cultivation strain: inoculate the fermentation tank liquid strain obtained in step (3) into cultivation bag medium, inoculate 15 mL per cultivation bag, and place in a culture room, the number of cultivation bags is 80-85 bags per cubic meter, initially culture in a 26℃ culture room in dark for 2 days, then control the temperature to be constant at 23℃, the air humidity is kept at 55-65% throughout the whole process, and the carbon dioxide concentration in the air is controlled to be 2000-2500 ppm, until the mycelium grows full of the bag; (5) post-maturation and incision: continue to culture for 15 days after the mycelium grows full of the bag to complete post-maturation of the mycelium, move into a small greenhouse in spring, incise nail-shaped holes, the incision depth is 5 mm, and incise 160 holes per bag, avoid direct sunlight, use straw mat or plastic cloth for heat preservation at night, and place for 5 days to make the mycelium recover until the incision completely recovers; (6) management of Auricularia auricula-judae: place the recovered mycelium rods after incision in rows, the row width is 1.4-1.6 m, start to irrigate after placing for 3 days, initially increase humidity without spraying water on the mycelium rods, but spray water on the ground or the greenhouse wall, when the ear buds are basically formed, directly spray water on the surface of the mycelium rods, and keep the air humidity at about 85%, ventilate according to the situation in the morning and evening every day, and cover shading nets on the greenhouse roof to prevent heat in the middle of the day; when the color of the ear pieces gradually becomes lighter, and reaches 70-80% maturity, pick, follow the principle of picking large and leaving small, and picking upper and leaving lower, stop irrigating for 3-4 days after picking, and continue the same management.

3. The cultivation method of the Auricularia auricula-judae strain according to claim 2, characterized in that, the preparation method of the mother strain test tube medium in step (1) is as follows: boil potatoes in a pot after peeling, continue to cook for 20 min after the water boils; filter the potato residue with gauze, and leave the potato liquid; add 20 g of glucose and 17 g of agar to every liter of the potato liquid, and prepare PDA medium after cooking and melting the agar, pour 12 mL of the medium into each 20x200 glass test tube, sterilize at 121℃ for 20 min, place the test tubes in an inclined position, and cool to obtain the medium for standby use; The preparation method of the shake flask culture medium in step (2) is as follows: 200 g of potatoes is weighed, peeled, and then put into a pot; 20 g of wheat bran is weighed, wrapped with 4 layers of gauze, and then put into the pot to be boiled together with the potatoes; after the water boils, it is continuously boiled for 20 min; the boiled juice is filtered with gauze; 20 g of glucose, 5 g of brown sugar, 2 g of KH2PO4, 1 g of MgSO4, and 1 g of VB6 are added into each liter of the filtrate; 600 mL of the prepared solution is measured and poured into a 1000 mL conical flask; and the conical flask is sterilized at 121 DEG C for 30 min. B1 10 mg, 600 mL of the measured solution is poured into a 1000 mL conical flask, and the conical flask is sterilized at 121 DEG C for 30 min; after the conical flask is sterilized at 121 DEG C for 20 min, it is cooled and prepared for use; The preparation method of the fermentation tank culture medium in step (3) is as follows: 1000 L tap water is poured into the fermentation tank, and then soybean powder 3 kg, corn flour 7 kg, glucose 4 kg, brown sugar 6 kg, peptone 1.5 kg, KH2PO40.6 kg and MgSO40.25 kg are sequentially added; cold air in the tank is first discharged by using hot steam, then the tank is pressurized to 0.11 MPa by using hot steam, sterilized for 90 min, and then the liquid shake flask strain is added after the tank is cooled to 25℃; The preparation method of the cultivation bag culture medium in step (4) is as follows: the main materials and auxiliary materials are weighed according to the proportion of 82% sawdust, 12% wheat bran, 2% soybean meal, 2% corn flour, 1% lime and 1% gypsum, and then put into cultivation bags with a diameter of 16 cm and a height of 35 cm, with a weight of 2.4 kg per bag; sterilized at 121℃ for 2 h and then cooled for standby.

4. Use of the strain of Auricularia auricula according to claim 1, characterized in that, The polysaccharide or polyphenol is produced, or used as a parent to breed a new variety of Auricularia auricula.

Images