Cordyceps militaris strain and cultivation method and application thereof

By optimizing the cultivation method of Cordyceps militaris strain HK1181, the problems of low color and low content of active ingredients in Cordyceps militaris resources were solved, and high content of carotenoids was extracted, thereby increasing the market value of Cordyceps militaris.

CN121538088APending Publication Date: 2026-02-17LUDONG UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610042241.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

Existing technologies cannot provide Cordyceps militaris resources with high content and uniform color, and the bioconversion rate of active ingredients such as carotenoids is low, which limits its application in food and medicine.

Method used

The Cordyceps militaris strain HK1181 was used for cultivation, including dark culture, mycelial scratching treatment and light culture, to optimize the culture conditions in order to improve the color of the fruiting bodies and the content of active ingredients, especially carotenoids.

Benefits of technology

It significantly improved the color and content of active ingredients in Cordyceps militaris fruiting bodies, especially the content of carotenoids, reaching 6363.47 ug/g, thereby enhancing the economic value and application potential of Cordyceps militaris.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121538088A_ABST
    Figure CN121538088A_ABST
Patent Text Reader

Abstract

The invention discloses a cordyceps militaris strain and a cultivation method and application thereof, and relates to the technical field of microorganisms, and the preservation number of the cordyceps militaris strain is CGMCC No.42294. The whole cordyceps militaris sporocarp is orange red, uniform in color, free of impurities and dense and obvious in ascocyst, and when the cordyceps militaris sporocarp is applied to breeding, the appearance color of offspring can be remarkably improved, and the economic value is increased. Meanwhile, the carotenoid content of the cordyceps militaris is remarkable and reaches 6363.47 ug / g, and the cordyceps militaris also contains rich active ingredients such as cordycepin, cordyceps polysaccharide and cordyceps protein, is high in biological conversion rate and is an excellent cordyceps militaris resource.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a Cordyceps militaris strain and its cultivation method and application. Background Technology

[0002] Cordyceps militaris is an entomopathogenic fungus belonging to the phylum Ascomycota, class Pyromycetes, order Spheroidales, family Clavicipitaceae, and genus Cordyceps. It is a different species from Cordyceps sinensis (caterpillar fungus) within the same genus. Cordyceps militaris has high medicinal value. Modern research shows that it contains various bioactive substances such as cordycepin, carotenoids, and polysaccharides, playing important roles in anti-inflammatory, anticancer, antibacterial, and immune-enhancing effects, similar to Cordyceps sinensis, making it an ideal substitute. Therefore, the development and application of Cordyceps militaris has a huge potential market.

[0003] Carotenoids refer to two major classes of pigments: hydrocarbons composed of eight isoprene units (carotene) and their oxidation derivatives (lutein). They play important nutritional roles in human growth and development. Naturally occurring carotenoids and lutein are important components of macular pigment in the retina, filtering blue light, preventing retinal damage, and preventing eye diseases such as cataracts. Carotenoids also have antioxidant properties, effectively scavenging oxygen free radicals to delay aging, prevent and treat many diseases caused by excessive free radicals in cells or tissues, and prevent cardiovascular sclerosis, coronary heart disease, and tumors caused by aging. Therefore, in recent years, carotenoids, especially lutein, have gradually become a research hotspot as functional food ingredients. However, carotenoids cannot be synthesized by the human body and are difficult to synthesize chemically. Therefore, the human body must ingest a certain amount of exogenous carotenoids every day to replenish the consumed carotenoids. Providing Cordyceps militaris resources with excellent nutritional value is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] The purpose of this invention is to provide a Cordyceps militaris strain and its cultivation method and application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A strain of Cordyceps militaris, deposited on October 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC) in Beijing, China, with accession number CGMCC No. 42294, and classified as Cordyceps militaris.

[0006] The fruiting bodies of the Cordyceps militaris strain of this invention are brightly colored, orange-red throughout, and appear ruby ​​red under light. The color is uniform and free of impurities, with dense and distinct perithecia. It has a significant content of carotenoids and is rich in active ingredients such as cordycepin and cordyceps polysaccharides. It also has a high bioconversion rate, making it an excellent Cordyceps militaris resource.

[0007] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in the production of Cordyceps militaris.

[0008] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in food production.

[0009] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in the extraction of carotenoids.

[0010] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in the extraction of cordycepin.

[0011] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in the extraction of polysaccharides.

[0012] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in protein extraction.

[0013] Another object of the present invention is to provide the application of the above-mentioned Cordyceps militaris strain in Cordyceps militaris hybridization breeding to improve the appearance and color of the progeny Cordyceps militaris.

[0014] Another objective of this invention is to provide a cultivation method for the above-mentioned Cordyceps militaris strain, comprising the following steps: inoculating the liquid strain of Cordyceps militaris onto a cultivation medium, and incubating it in the dark at 18-20℃ for 8-9 days; when the mycelium penetrates more than 2 / 3 of the substrate, performing a scratching treatment; after scratching, transferring the culture to a light environment at a temperature of 18-20℃ and a humidity of 70%-85%; and harvesting the fruiting bodies after 50 days.

[0015] Compared with existing technologies, this invention provides a Cordyceps militaris strain, its cultivation method, and its applications. The fruiting bodies of this Cordyceps militaris are brightly colored, entirely orange-red, and appear ruby ​​red under light. The color is uniform and free of impurities, and the perithecia are dense and clearly visible. Applying it to breeding can significantly improve the appearance and color of offspring, thereby increasing its economic value. Simultaneously, this Cordyceps militaris has a significant carotenoid content, reaching 6363.47 ug / g, and also contains abundant cordycepin, cordyceps polysaccharides, cordyceps proteins, and other active ingredients, with a high bioconversion rate. It is an excellent Cordyceps militaris resource with huge market potential. Attached Figure Description

[0016] Figure 1The images show the appearance of the Cordyceps militaris strain HK1181 of this invention, where A and D are respectively a morphological image of the fruiting body, a single fruiting body, a cross-section of the fruiting body (with dense perithecia), and a magnified view of the details at the top of the fruiting body. Figure 2 This is the phylogenetic tree of the Cordyceps militaris strain HK1181 of this invention; Figure 3 The biotransformation rate of Cordyceps militaris strain HK1181 in this invention is given, wherein XFg, HK1234 and XFb are other excellent strains collected. Figure 4 This is the standard curve of β-carotene from the Cordyceps militaris strain HK1181 of this invention; Figure 5 The β-carotene content of the Cordyceps militaris strain HK1181 of this invention; Figure 6 The cordycepin content of the Cordyceps militaris strain HK1181 of this invention; Figure 7 The polysaccharide content of the Cordyceps militaris strain HK1181 of this invention; Figure 8 The protein content of the Cordyceps militaris strain HK1181 of this invention. Detailed Implementation

[0017] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] Example 1: Isolation, purification, identification, and preservation of bacterial strains 1. Wipe the Cordyceps militaris specimens collected from the wild with a cotton ball soaked in 75% alcohol. Isolate the strain using the tissue isolation method. Under sterile conditions, break open the sclerotia, take a small amount of sclerotia tissue with tweezers, place it in PDA medium (200 g potato, 18 g agar, 20 g glucose, 1000 ml water, natural pH) and label it.

[0019] The culture dish was placed in a 25℃ constant temperature incubator for dark culture. The mycelial growth was observed regularly. If contamination by other bacteria was found, the strain was transferred to a plate for purification in time. After the mycelium around the tissue germinated, the strain was purified and cultured in time and the strain was preserved to obtain strain HK1181.

[0020] 2. Preparation of mycelium in liquid culture Select a plate culture of strain HK1181, and use a 9mm punch to inoculate one piece of the culture into 100ml of liquid culture medium (20g glucose, 15g peptone, 5g yeast extract, 1g magnesium sulfate, 2g potassium dihydrogen phosphate, 1000ml water, pH natural). Set up at least 4 replicates for each strain, and incubate in a shaker at 21℃ and 140r / min in the dark for 96h.

[0021] 3. Child entity occurrence test Take 5 ml of liquid culture of strain HK1181 and inoculate it into oat medium (30 g oats, 50 ml water, pH natural). Set up more than 3 replicates for each group and incubate at 20℃ in the dark for 14 days. When the mycelium fills the bottle, perform scratching treatment, then irradiate with 750 lx white light and incubate at 18±2℃. Ventilate for 2-3 hours every day. Observe and record the time and morphology of fruiting body germination and take pictures.

[0022] After cultivation, the fruiting bodies of the strain were naturally uniformly orange-red, with a consistent color and no impurities. The ascothecia were dense and clearly visible, hence the name "Gem Red". Figure 1 ).

[0023] 4. ITS gene sequence analysis Mycelia from plates cultured for 20 days were ground in liquid nitrogen, and total DNA was extracted using a kit. Universal primers for fungal identification, ITS1 and ITS4, were used for PCR amplification of the strain's ITS sequence. The PCR amplification reaction system (50 μL) consisted of 5 μL of 10×Extaq buffer, 4 μL of dNTPs (800 μmol / L), 2 μL of Primer ITS1 (10 ng / μL), 2 μL of Primer ITS4 (10 ng / μL), 5 μL of DNA template (50 ng / mL), 0.5 μL of Extaq enzyme (5 U / μL), and 31.5 μL of ddH2O. The PCR reaction program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 1 min, 56℃ annealing for 1 min, 72℃ extension for 2 min, for a total of 30 cycles; followed by a 72℃ extension for 5 min.

[0024] After purification, the PCR amplification product was sequenced. The sequencing results (SEQ ID NO.1) were compared with the GenBank database using BLAST homology. The ITS sequence of the type strain with high homology was selected, and a phylogenetic tree was constructed using the neighbor joining (NJ) method in MEGA 6.0 to confirm that strain HK1181 is Cordyceps militaris. Figure 2 ).

[0025] ACATACCTATCGTTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTATGAGTTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAA TCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAG CATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGATGTCGGCGTTGGGGACCGGCAGCACACCGCCGCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCT CTGCGTAGTACCCCAACTCGCACCGGGAACCCGACGTGGCCACGCCGTAAAACGCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA. (SEQ ID NO.1) 5. Preservation Strain HK1181 was deposited on October 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Beijing, China, with accession number CGMCC No. 42294, and classified as Cordyceps militaris.

[0026] Example 2: Comparison of bacterial bioconversion rates The fruiting bodies of strain HK1181 were cultured in 500mL tissue culture flasks filled with culture medium (30g oats, 50ml water), sterilized at 121℃ for 25 minutes, and then cooled. 5mL of liquid inoculum was added to each flask, and the flasks were incubated in the dark at 18-20℃ for 8-9 days. When more than 2 / 3 of the mycelium had penetrated the bottom, a scratching treatment was performed. After scratching, the flasks were transferred to a light-cultured environment at 18-20℃ and 70%-85% humidity. The fruiting bodies were harvested after 50 days.

[0027] Fresh weight of fruiting bodies was determined by direct weighing after harvest, while dry weight was determined by drying the samples in a 60℃ oven to constant weight before weighing. Bioconversion rate was calculated using the following formula: V = (G1 / G2) × 100% In the formula, G1 represents the fresh weight of Cordyceps militaris fruiting bodies, and G2 represents the dry weight of the culture medium.

[0028] The biotransformation rate of strain HK1181 was 149.28%, significantly higher than that of other control strains (see Table 1 and...). Figure 3 ).

[0029] Table 1

[0030] Example 3: Determination of active ingredients in strains 1. Extraction of carotenoids from Cordyceps militaris using a compound enzyme method Fresh Cordyceps militaris fruiting bodies were dried at 60℃ to constant weight, pulverized, and passed through a 60-mesh sieve for later use. Three 2g portions of Cordyceps militaris powder were weighed separately, and 20mL of a mixed solution of acetone and 60% ethanol (volume ratio = 2:1) and a complex enzyme of cellulase (50U / mg) and pectinase (30000U / mg) (mass ratio = 2:1) were added. The pH of the solution was adjusted to 4. Enzymatic hydrolysis was performed at 50℃ for 45 min, with a complex enzyme concentration of 0.5%. The mixture was centrifuged at 4500r / min for 10 min. The supernatant was diluted 100 times, and the absorbance of the extract was measured using a spectrophotometer at a wavelength of 445nm. The extraction yield of carotenoids from Cordyceps militaris was obtained based on the standard curve equation.

[0031] Results: A standard working curve was plotted with β-carotene mass concentration as the x-axis (ug / ml) and absorbance values ​​as the y-axis. Figure 4 The linear regression equation obtained was y = 0.0376x + 0.0134 (where x is the concentration of β-carotene, μg / mL; y is the absorbance value), and the correlation coefficient was 0.99147, indicating that the mass concentration of β-carotene has a good linear relationship with its absorbance value in the range of 2~5ug / ml.

[0032] Then calculate the β-carotene content using the following formula:

[0033] In the formula: c is the content of β-carotene, μg / g; x is the concentration of β-carotene, μg / mL; V is the volume of the mixture of acetone and 60% ethanol, mL; m is the mass of the powder sample, g.

[0034] The results are as follows Figure 5As shown, the β-carotene content is relatively low in XFg, at 1824.47 ug / g; in XFb and HK1234, the contents are 2354.38 ug / g and 2619.40 ug / g, respectively; while the content of the strain HK1181 of this invention is relatively rich, at 6363.47 ug / g, which is 2 to 3 times that of other materials.

[0035] 2. Cordycepin content Cordycepin and adenosine were extracted and determined from Cordyceps militaris fruiting bodies and embryos (methods refer to industry standard NY / T2116-2012). Statistical results showed that the cordycepin content in strain HK1181 of this invention was 4.06 mg / 100g. Figure 6 ).

[0036] 3. Polysaccharide content Accurately weigh 0.4 g of Cordyceps militaris fruiting body sample and place it in a centrifuge tube for later use. Add 20 mL of deionized water to make the sample concentration 20 mg / mL, and extract in an ultrasonic extractor at 60℃ and 200W for 60 minutes. Centrifuge at 6000 r / min for 20 minutes, collect the supernatant, and add 3 volumes of anhydrous ethanol. Precipitate in an ethanol bath at 4℃ for 10 hours, and dry the precipitate in an oven at 60℃ to obtain crude polysaccharide. Dissolve the precipitate in 60℃ warm water to obtain the sample to be tested. The specific steps for determining the crude polysaccharide concentration and plotting the standard curve are shown in Table 2. Calculate the content of crude polysaccharide according to the formula.

[0037]

[0038] In the formula: C represents the mass concentration of Cordyceps militaris extract (mg / mL), n represents the dilution factor of Cordyceps militaris polysaccharide extract, V represents the volume of Cordyceps militaris polysaccharide solution (mL), and m represents the dry weight (g) of the original Cordyceps militaris fruiting body powder.

[0039] Table 2

[0040] The results showed that the polysaccharide content of the HK1181 strain of this invention was approximately 9.85 mg / g. Figure 7 ).

[0041] 4. Protein content The protein content of Cordyceps militaris fruiting bodies was extracted and determined using the automatic Kjeldahl nitrogen analyzer method as specified in the national standard GB5009.5-2016. The results showed that the protein content of strain HK1181 in this invention was 27.57 g / 100g (…). Figure 8 ).

Claims

1. A strain of Cordyceps militaris, characterized in that, The strain was deposited on October 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Beijing, China, with accession number CGMCC No. 42294, and classified as Cordyceps militaris.

2. The application of the Cordyceps militaris strain according to claim 1 in the production of Cordyceps militaris.

3. The application of the Cordyceps militaris strain according to claim 1 in food production.

4. The application of the Cordyceps militaris strain described in claim 1 in the extraction of carotenoids.

5. The application of the Cordyceps militaris strain according to claim 1 in the extraction of cordycepin.

6. The application of the Cordyceps militaris strain according to claim 1 in the extraction of polysaccharides.

7. The use of the Cordyceps militaris strain according to claim 1 in protein extraction.

8. The application of the Cordyceps militaris strain according to claim 1 in Cordyceps militaris hybridization breeding.

9. The cultivation method of the Cordyceps militaris strain according to claim 1, characterized in that, Includes the following steps: The liquid spawn of Cordyceps militaris strain was inoculated into the cultivation medium and placed in the dark at 18-20℃ for 8-9 days. When the mycelium penetrated more than 2 / 3 of the bottom, the mycelium was scratched. After scratching, the culture was transferred to a light culture at a temperature of 18-20℃ and a humidity of 70%-85%. The fruiting bodies were harvested after 50 days.

Citation Information

Patent Citations

  • Cordyceps militaris albino strain and cultivation method of fruit body thereof

    CN102210255A

  • Method for mycoplasm culture of Mili entomogenous fungus for highly yielding carotenoids, and preparation methods of Mili entomogenous fungus products

    CN107475122A

  • Cordyceps militaris strain tiger rice base (H type) and application thereof

    CN112119837A

  • Increasement of bio-active substances of Cordycepsmilitaris by illuminating light

    KR1020020064689A

  • Novel mushroom strains, extracts thereof and compositions comprising them

    WO2022195581A1