Method for multi-target editing of Cas12 protein in tobacco and application thereof

Abstract

The invention discloses a method for multi-target editing of Cas12 protein in tobacco and application of the method, and the method comprises the following steps: introducing Cas12i3 mutant protein and a carrier containing a plurality of tRNA-crRNA expression cassettes into tobacco cells together, so that the Cas12i3 mutant protein and crRNA generated by transcription of the tRNA-crRNA expression cassettes have a synergistic effect, and a plurality of targets are efficiently edited in one carrier at the same time. According to the invention, the specific Cas12i3 protein variant is combined with a multi-expression cassette tRNA strategy, so that the problem of low multi-target editing efficiency of the protein in dicotyledonous plants such as tobacco and the like is solved. The invention provides a new method which is simple to construct and efficient to edit, and provides a powerful new tool for genetic improvement of crops.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to a method for multi-target editing of the Cas12 protein in tobacco and its application. Background Technology

[0002] In 2012, with the verification of the in vitro DNA cleavage activity of a class of nucleases called CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated) nucleases, this class of nucleases derived from the bacterial adaptive immune defense system was rapidly popularized as a third-generation gene editing tool. In 2013, the CRISPR-Cas system was first applied to gene editing in human cells, and subsequently rapidly applied to various crops such as rice, corn, soybeans, wheat, and tobacco. Unlike the previous two generations of gene editing technologies (zinc finger nucleases ZFN and transcription activator-like effector nucleases TALEN), the CRISPR-Cas system is very simple to design and construct. The system requires only a nuclease protein containing DNA binding and cleavage functions and a guide RNA to guide the nuclease protein to bind to DNA. Furthermore, the target site selection of the CRISPR-Cas system is extremely flexible, requiring only a specific sequence near the target site. Because the system is simple to build and highly efficient, it has rapidly become a mainstream gene editing technology in a short period of time.

[0003] CRISPR / Cas9 is also widely used in tobacco. In recent years, the search for new class II CRISPR-Cas systems has led to the discovery of new type V systems, including Cas12c, Cas12d, Cas12g, Cas14a, and Cas12j effectors. These novel type V systems differ functionally from previously known class II effectors, thus enriching the CRISPR-Cas gene editing toolkit. Among the newly discovered type V endonucleases, Cas12i is a single RNA-guided nicking enzyme that primarily cleaves the non-target strand of target DNA by recognizing the 5'-TTN-3' PAM sequence. The nicking activity of Cas12i has the potential for highly specific gene editing. Like Cpf1, Cas12i can process its pre-crRNA into mature crRNA, providing a promising alternative platform for multiplex gene editing. Furthermore, compared to the commonly used Cas9 and Cpf1, Cas12i has a relatively small amino acid size (1033-1093 aa), which greatly facilitates the use of gene editing tools.

[0004] In 2015, Xie Kabin published "Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system" in PNAS, which used endogenous tRNA from rice for multi-target editing, and this method has been widely applied in rice. In 2017, Qi Yiping's team used the HH / HDV ribozyme system for multi-target editing of LbCpf1 (Cas12a), and the results showed high efficiency. In 2022, Chen Qijun's team used tRNA / HDV elements for multi-target editing of the PE system, and the results showed good efficiency. As recorded in CN111757889B, Cas12i3 (i.e., the Cas12f.4 protein in this patent) showed certain editing activity in monocotyledonous maize. However, when the inventors studied the editing activity of this enzyme in dicotyledonous plants (e.g., Arabidopsis thaliana, soybean, etc.), they found that the editing efficiency of this enzyme in dicotyledonous plants was low, and even failed to show editing activity at some sites. Editing multiple genes simultaneously within a single plant is even more challenging. Therefore, this application is submitted. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a method for multi-target editing of Cas12 protein in tobacco and its application. In view of the problem of low efficiency of multi-target editing of Cas12i3 protein variants in tobacco, this invention innovatively proposes to combine mutants with multi-expression cassette tRNA multi-target strategy to achieve efficient and simultaneous editing of multiple genes with a single vector, which is significantly better than traditional tRNA-HDV and other schemes, and provides a reliable tool for the precise multi-gene improvement of tobacco and even dicotyledonous plants.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solution: A method for multi-target editing of Cas12i3 protein in tobacco, the method comprising: co-introducing Cas12i3 mutant protein and a vector containing multiple tRNA-crRNA expression cassettes into tobacco cells, so that the Cas12i3 mutant protein and the crRNA transcribed from each tRNA-crRNA expression cassette work synergistically to simultaneously and efficiently edit multiple targets in one vector.

[0007] Preferably, in the above technical solution, the Cas12i3 mutant protein is the Cas12i3-M20 protein, whose amino acid sequence contains D851L, A133L, S7R and D267R mutations relative to the wild-type Cas12i3 protein; and the plurality of tRNA-crRNA expression cassettes are at least two.

[0008] Preferably, in the above technical solution, the plurality of tRNA-crRNA expression cassettes are all driven by the OsU3 promoter, and each expression cassette contains a tRNA sequence located at the 5' end of the crRNA sequence.

[0009] Preferably, in the above technical solution, the multiple target sites of the expression cassette are located in the NtCCD8 gene, NtPDS gene and NtWOX gene of tobacco.

[0010] Preferably, in the above technical solution, the introduction method is transient transfection of tobacco protoplasts or stable transformation of tobacco mediated by Agrobacterium.

[0011] Application of a method for multi-target editing of the Cas12i3 protein in tobacco in simultaneous knockout of multiple genes in tobacco.

[0012] A carrier for use in the above method, the carrier comprising: (1) The nucleic acid molecule encoding the Cas12i3 mutant protein; and (2) Multiple tRNA-crRNA expression cassettes, each driven by the OsU3 promoter and containing a tRNA sequence located at the 5' end of the crRNA sequence.

[0013] A tobacco cell, wherein the tobacco cell is introduced into a vector by the above method and edited at multiple target sites.

[0014] Application of a vector in improving the multi-target editing efficiency of Cas12i3 protein in tobacco.

[0015] The above-described technical solution of the present invention has the following beneficial effects: This invention addresses the challenge of low multi-target editing efficiency of the Cas12i3 protein in dicotyledonous plants such as tobacco by combining a specific Cas12i3 protein variant (Cas12i3-M20) with a multi-expression cassette tRNA strategy. It significantly improves the simultaneous editing efficiency of multiple targets, far outperforming other multi-target strategies. This invention provides a simple and efficient new method, offering a powerful new tool for crop genetic improvement. Attached Figure Description

[0016] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments of the invention and, together with their description, serve to explain the principles of the invention.

[0017] Figure 1 This is a schematic diagram of the Cas12i3 expression vector (HJ0067) of Example 1.

[0018] Figure 2 This is a schematic diagram of three multi-target crRNA vector expression cassettes. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that, unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention.

[0020] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available. Unless otherwise specified, the equipment used in the experiments is well known to those skilled in the art.

[0021] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0022] The amplification primers used for each target site in tobacco protoplasts are as follows: Primer YP0512(F): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGTTCTACCACCAGATGAAGTG; Primer YP0513(R): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTGGAAAAACTTATAACAAGCGACT is used to amplify the target NtCCD8, and the PCR product size is 259bp.

[0023] Primer YP0514(F): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATATCAGGTTTGGGTGGTTTGTC; Primer YP0515(R): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAATAGGAATAGTGAACACCCTTGC is used to amplify the target NtPDS, and the PCR product size is 259bp.

[0024] Primer YP0516(F): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACTCTTTTGTTTTTGTGTTTGTCG; Primer YP0517(R): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTGTAATCATAACAGCATAATGGCC is used to amplify the target NtWOX, and the PCR product size is 259bp.

[0025] The amplification primers used for each target site in stable T0 tobacco seedlings are as follows: Primers YP1046(F): 5'-AAGAGAATATTCTTTGCTGGACGTGG-3' and primers YP1047(R): 5'-GATGAACCTTATTTTGGGAAGGTGAAAATC-3' were used to amplify the target site NtCCD8, and the PCR product size was 599bp.

[0026] Primers YP1048(F): 5'-GGTTGCACTCTTCTAAGGCTTGCAATC-3' and primer YP0467(R): 5'-AATAGGAATAGTGAACACCCTTGC-3' were used to amplify the target NtPDS, and the PCR product size was 588bp.

[0027] Primers YP1053(F): 5'-ATCTTGTAATCATAACAGCATAATGGCC-3' and primers YP1040(R): 5'-GTAAAGTTGCATTCGTGTTTGGATTTTGAGAG-3' were used to amplify the target site NtWOX1, and the PCR product size was 444bp.

[0028] In the following examples, the tobacco protoplast editing efficiency of Cas protein is the proportion of reads occupied by mutant cells in the sequencing results after transfection of protoplast cells; the tobacco T0 seedling editing efficiency of Cas protein is the number of positive T0 seedlings with knockout mutations / the total number of positive T0 seedlings analyzed × 100%.

[0029] Example 1: Validating the editing efficiency of the Cas12i3 protein mediated by different multi-target approaches in tobacco protoplasts.

[0030] The protein sequences of the Cas12i3-WT and Cas12i3-M20 (trex + Cas12i3-D851L, A133L, S7R, D267R) mutant combinations were optimized using dicotyledonous plants. Corresponding nuclear localization sequences were added to the N-terminus and C-terminus, along with BamHI and NotI restriction sites. These sequences were synthesized at GenScript Biotech in Nanjing. The synthesized target fragments were digested with BamHI and NotI, purified, and ligated into the purified pr35S-Kan-Col backbone vector, yielding HJ0066 and HJ0067, which are protoplast transformation vectors containing the Cas12i3 (WT) protein sequence and Cas12i3-M20, respectively. The main enzymes and kits used in vector construction are as follows: Fragment amplification enzyme: 2 KeyPo Master Mix (DyePlus) (Vazyme): See the instruction manual for detailed experimental procedures. Gel Extraction Kit: DNA Gel Extraction Kit (Safe and Convenient) (Qingke): See the instruction manual for detailed experimental procedures. Plasmid Extraction Kit: FlashPure Rapid Plasmid Mini-Prep Kit (Qingke): See the instruction manual for detailed experimental procedures. Cloning Intermediate Vector Kit: pEASY®-Blunt ZeroCloning Kit (Zhengshijin): See the instruction manual for detailed experimental procedures. Seamless Cloning Kit: NEBuilder HiFi DNAAssembly Master Mix (NEB): See the instruction manual for detailed experimental procedures. T4 Ligase: T4 DNA Ligase (NEB): See the instruction manual for detailed experimental procedures. A schematic diagram of the HJ0066 vector is shown below. Figure 1 As shown. Three multi-target approaches are designed, and the expression box diagram is shown below. Figure 2 As shown.

[0031] The HJ0144 vector uses the OsU3 promoter to drive the crRNA target sequence, with three repeats of the expression cassette, each containing a different target. The HJ0145 vector adds tRNA to the 5' end of the crRNA target sequence, using the OsU3 promoter to drive the tRNA+crRNA target sequence, with three repeats of the expression cassette. The HJ0146 vector adds tRNA to the 5' end of the crRNA target sequence and HDV to the 3' end, repeating three times in a tRNA-crRNA target sequence-HDV pattern, with the OsU3 promoter driving this single expression cassette. All of these elements can be directly synthesized. The pr35S-Kan-Col backbone vector is digested with MluI, and the synthesized fragments are amplified by PCR. The target fragments are then ligated into the backbone vector using NEBuilder HiFi DNA Assembly Master Mix to obtain the HJ0144, HJ0145, and HJ0146 vectors. The HJ0144, HJ0145, and HJ0146 multi-expression cassette tRNAs targeting multiple sites are shown in SEQ ID No. 3-5.

[0032] The information on the three target points edited by Cas12i3 is shown in Table 1 below: Table 1

[0033] The vectors corresponding to the Cas12i3 protein (HJ0066, HJ0067) and the corresponding crRNA vectors HJ0144, HJ0145, and HJ0146 were used for plasmid extraction, and the results met the quality control requirements. The Cas12i3 protein vector and crRNA vector were mixed at a ratio of 10ug:10ug and transformed into tobacco protoplast cells (Tobacco Protoplast Preparation and Transformation Kit, Coolaber). Each combination was performed in 5 replicates. After transformation, the cells were incubated at room temperature for 48 hours, and DNA was extracted from the protoplast cells. PCR amplification primers were designed near the target gene site to amplify the corresponding band (product length approximately 250bp). The PCR product was sent to Qingke Biotechnology for Fast NGS sequencing (Illumina platform MiSeq sequencer). The mutation efficiency of the Cas12i3 protein at the target site when used in combination with different crRNA vectors is shown in Table 2. Table 2

[0034] As can be seen from the table above, for the Cas12i3 wild-type protein, when it was co-transformed into tobacco protoplasts with the HJ0144-multi-expression cassette multi-target vector and the HJ0146-single-expression cassette tRNA-HDV multi-target vector, the editing efficiency for all three targets was 0; only when it was co-transformed with the HJ0145-multi-expression cassette tRNA multi-target vector could mutations for all three targets be obtained in tobacco protoplasts. For the Cas12i3-M20 protein, when transformed into tobacco protoplasts with the HJ0144-multi-expression cassette multi-target vector, the editing efficiencies for the three targets were 4.71%, 1.65%, and 0.15%, respectively. When transformed with the HJ0145-multi-expression cassette tRNA multi-target vector, the editing efficiencies for the three targets increased to 9.01%, 3.35%, and 0.61%, respectively. When transformed with the HJ0146-single-expression cassette tRNA-HDV multi-target vector, the editing efficiencies for the three targets decreased to 0.52%, 0.2%, and 0.00%, respectively. These two sets of results simultaneously demonstrate that the HJ0146-single-expression cassette tRNA-HDV multi-target approach significantly reduces the multi-target editing efficiency of the Cas12i3 protein, while the HJ0145-multi-expression cassette tRNA multi-target approach significantly increases the multi-target editing efficiency of the Cas12i3 protein.

[0035] Example 2: Validating the editing efficiency of the Cas12i3 protein mediated by different multi-target approaches in tobacco stable transformation leaves.

[0036] After three rounds of combination optimization, a Cas12i3-M20 (trex+Cas12i3-D851L, A133L, S7R, D267R) (SEQ ID No. 2) combined mutant was screened. Compared to the wild-type Cas12i3 protein (SEQ ID No. 1), it possesses mutations at amino acid sites 851, 133, 7, and 267, namely D851L, A133L, S7R, and D267R, and has an N-terminal fusion with a Trex exonuclease. Based on this mutant, it was combined with three different multi-target approaches from Example 1 to construct three stable transformation vectors, corresponding to HJ0852, HJ0850, and HJ0851.

[0037] The corresponding plasmids were transferred into Agrobacterium LBA4404. The identified bacterial culture was spread onto YEB solid medium and incubated at 28°C until the bacterial colony covered the entire plate (approximately 2 days). The bacterial cells were then resuspended in liquid medium (OD200). 600 Approximately 0.6-0.8).

[0038] The simplified steps for stable transformation of tobacco are as follows: Pre-cultured tobacco leaf discs are immersed in the aforementioned suspended bacterial culture for 10 minutes. The leaves are then removed and the bacterial solution is absorbed onto sterilized filter paper. The upper surface of the leaves is placed in contact with the culture medium, and the leaves are laid flat on a solid culture medium and co-cultured at 28°C in the dark for 3 days. The co-cultured leaves are then placed on MS medium and cultured under conditions of (25°C, 16h light) / (25°C, 10h darkness). After approximately one month, green, swollen callus tissue can be observed at the edge of the leaf disc. Once the callus tissue has grown to a diameter of 2cm, it is placed on rooting medium to induce bud formation. The green buds are cut off and transferred to MS solid culture medium for rooting. Roots emerge from the green buds after approximately 10 days.

[0039] The transformed tobacco leaves were sampled, DNA was extracted using a kit, and transgenic positive identification was performed. Sequences near the target sites were amplified using primers corresponding to the three target sites. The PCR products were sent to Qingke for deep sequencing. The editing efficiency of different multi-target methods of Cas12i3-M20 on each target site was detected, as shown in Table 3 below. Table 3

[0040] As shown in the table above, in the leaves of stably transformed tobacco T0 seedlings, when Cas12i3-M20 was used to edit three targets using a multi-expression cassette multi-target approach, the editing efficiencies were 6.7%, 0.0%, and 9.2%, respectively. When Cas12i3-M20 was used to edit three targets using a multi-expression cassette tRNA multi-target approach, the editing efficiencies increased to 26.7%, 6.7%, and 31.9%, respectively. When Cas12i3-M20 was used to edit three targets using a single expression cassette tRNA-HDV multi-target approach, the editing efficiencies decreased to 0%, 0%, and 2.7%. The overall trend is consistent with the results from protoplasts. This indicates that the multi-expression cassette tRNA multi-target approach used by Cas12i3-M20 has the highest efficiency in editing three targets.

[0041] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various different choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. A method of multiplexed editing of Cas12i3 proteins in tobacco, characterized in that, The method comprises: co-introducing a Cas12i3 mutant protein and a vector containing multiple tRNA-crRNA expression cassettes into tobacco cells, so that the Cas12i3 mutant protein and the crRNA transcribed from each tRNA-crRNA expression cassette synergize to simultaneously and efficiently edit multiple target sites in one vector.

2. The method of claim 1, wherein, The Cas12i3 mutant protein is a Cas12i3-M20 protein, and the amino acid sequence thereof comprises D851L, A133L, S7R, and D267R mutations relative to the wild-type Cas12i3 protein; and the multiple tRNA-crRNA expression cassettes are at least two.

3. The method of claim 1, wherein, The multiple tRNA-crRNA expression cassettes are each driven by an OsU3 promoter, and each expression cassette comprises a tRNA sequence located at the 5' end of a crRNA sequence.

4. The method of claim 1, wherein, The multiple target sites of the expression cassettes are located in NtCCD8 genes, NtPDS genes, and NtWOX genes of tobacco.

5. The method of claim 1, wherein, The introduction mode is tobacco protoplast transient transfection or Agrobacterium-mediated stable transformation of tobacco.

6. Use of the method according to any one of claims 1-5 in tobacco multi-gene synchronous knockout.

7. A vector for use in the method of any one of claims 1-5, wherein, The vector comprises: (1) a nucleic acid molecule encoding a Cas12i3 mutant protein; and (2) multiple tRNA-crRNA expression cassettes, each expression cassette being driven by an OsU3 promoter and comprising a tRNA sequence located at the 5' end of a crRNA sequence.

8. A tobacco cell, characterized in that, The tobacco cells are introduced with the vector of claim 7 at multiple target sites through the method of any one of claims 1-5.

9. Use of the vector of claim 7 in improving the multi-target site editing efficiency of a Cas12i3 protein in tobacco.

Images